SNP molecular marker of HTR2A gene related to pig backfat thickness character and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker of an HTR2A gene related to a pig backfat thickness character and application of the SNP molecular marker. The molecular marker is from the 20563279 basic group in a pig 11 # chromosome HTR2A gene. A large white pig is selected as a test material, whole genome DNA is extracted from pig blood, and primers are designed according to a pig genome sequence (NC010449.5) published by an NCBI database. And a C or T base substitution exists at the 316th site, so that polymorphism is caused. According to the present invention, the SNP site is subjected to typing, and the association analysis on the American line big white and the French line big white shows that the back fat thickness of the CC genotype individual is significantly thin compared with the back fat thickness of the other genotype individuals; the invention provides a new marker for pig molecular marker-assisted selection, and the new marker is applied to genetic improvement of pig backfat thickness to accelerate the breeding improvement process of high-quality pigs.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of aquaculture molecular marker technology, and particularly relates to a pig backfat thickness related HTR2A gene SNP molecular marker and application thereof. BACKGROUND

[0002] In the pig breeding system, pig backfat thickness is a key indicator of production efficiency. Pig backfat thickness directly affects reproductive performance and fattening effect. Excessive backfat thickness also affects feed conversion efficiency, thereby affecting production efficiency. In the future, pig backfat thickness will be paid more attention to and become one of the important directions of breeding work. By breeding pigs with thinner backfat thickness, the carcass lean meat rate can be effectively improved, thereby providing higher production efficiency and economic efficiency for pig breeding enterprises and promoting the scientific and healthy development of the pig industry. Pig genetic improvement based on molecular breeding will become a rigid demand of the pig breeding industry.

[0003] Current pig genetic improvement still faces multiple bottlenecks. Traditional phenotypes such as pig backfat thickness selection rely on manual use of ultrasonic waves and probe puncture to measure backfat thickness, which has large subjective influence, high cost, large error and long breeding cycle. Moreover, it is difficult to achieve the desired effect through phenotype selection alone. With the rapid development of molecular biology technology, marker-assisted selection (MAS) has become an important supplement to traditional breeding methods. This technology can break through the limitations of traditional breeding by identifying individual genotypic differences at the nucleotide level, and has unique advantages in improving traits with low heritability or difficult to observe directly in vivo. Currently, MAS technology has been widely used in animal genetic improvement, and has promoted the breeding system to enter the era of precision. The breakthrough of single nucleotide polymorphism (SNP) marker technology is a milestone. It is a DNA sequence polymorphism caused by a single base variation, including transition, transversion, insertion and deletion. It provides a new perspective for analyzing the genetic mechanism of complex traits from the molecular level. As an important source of genomic genetic diversity, SNPs are widely distributed in coding and non-coding regions. SNPs in the coding region may affect protein function by changing the amino acid sequence, while SNPs in the regulatory region can regulate gene expression by modifying transcription factor binding sites, interfering with non-coding RNA action or inducing epigenetic changes. This multi-level mechanism makes SNP markers a core tool for accelerating genetic improvement of important economic traits in pigs.

[0004] Genome-Wide Association Study (GWAS) is an important modern breeding technique, which can screen out candidate genes related to economic traits by analyzing single nucleotide polymorphisms in animal genomes. GWAS can accurately capture functional variation sites significantly related to backfat thickness traits in the whole genome range by virtue of high-density marker coverage at the population level and efficient algorithm model. The emergence of GWAS technology can accurately mark specific sites affecting important economic traits on animal genomes and improve breeding efficiency. Studies have shown that 5-hydroxytryptamine receptor 2A (HTR2A) plays an important role in lipid accumulation. In the peripheral CTSL-central 5-HT regulatory loop, 5-HT can regulate fat deposition by activating peripheral lipids and fatty acid beta-oxidation, and overexpression of HTR2A can promote fat generation, and interference of HTR2A can inhibit fat generation to a certain extent. In this study, the SNP site is located in HTR2A, and the site is significantly associated with pig backfat thickness through association analysis, which may affect pig backfat thickness by changing the expression level of HTR2A.

[0005] Improving the backfat thickness of the core group of Large White pigs can improve the meat production efficiency of commercial pigs, enhance the competitiveness of commercial pig production, and improve the benefits of commercial pig breeding. SUMMARY

[0006] The purpose of the present application is to provide a SNP molecular marker related to pig backfat thickness. The SNP molecular marker with the largest effect value significantly related to backfat thickness is found by GWAS association analysis of the genotype data of 2168 Dan-line Large White pig populations. The association of the SNP site with pig backfat thickness is analyzed by cloning the gene sequence of the 20562964-20563509 segment of pig chromosome 11 and using direct sequencing method to find SNP sites and genotyping method, thereby establishing a new marker-assisted selection site for pig backfat thickness.

[0007] Another purpose of the present application is to provide an application of a SNP molecular marker in improving the backfat thickness, wherein R at position 316 in the nucleotide sequence of the SNP molecular marker is allelic substitution, and the substitution causes polymorphism at the position: the backfat thickness of the living body shows changes; and the CC genotype of the SNP site is a favorable genotype of pig backfat thickness. The present application aims to explore and identify SNP sites related to pig backfat thickness, thereby providing important guidance for genetic breeding of pigs.

[0008] The present application is realized by the following technical solutions:

[0009] A SNP molecular marker related to pig backfat thickness, the site of the SNP molecular marker corresponds to the gene sequence of the segment of 20562964-20563509 of pig chromosome 11, the fragment length is 546 bp, the nucleotide sequence is shown in the attached sequence listing SEQ ID NO. 1, by BLAST comparison on the NCBI website, it is found that there is a nucleotide polymorphism (SNP) site in the amplified fragment, and the specific location is shown in Figure 3 The mutation of the SNP site is that the base at 20563279 of chromosome 11 changes from C to T. According to the Ensembl database query, the mutation site is rs81333780; the SNP molecular marker is significantly related to backfat thickness.

[0010] The test materials selected include American Duroc, Danish Landrace and French Landrace. The whole genome DNA is extracted from the blood of the pigs, and the primer pair is designed according to the pig gene sequence (NC_010449.5) published in the NCBI database. The sequence of the primer pair is as follows:

[0011] Forward primer (SEQ ID NO. 2): 5'-GAGGTGGTTATCTAGGCTCAGT-3',

[0012] Reverse primer (SEQ ID NO. 3): 5'-CATCAGGACAAGAAAGATTGGAAAC-3'.

[0013] The primer pair described above can detect and type the SNP site of the gene region of the segment of 20562964-20563509 of pig chromosome 11.

[0014] After PCR amplification by the primer pair, purification of PCR products, cloning sequencing and sequence alignment analysis, one genetic marker related to pig backfat thickness is screened. The nucleotide sequence of the genetic marker is shown in SEQ ID NO. 1 as follows: wherein the mutation site is at the 316th position of the sequence,

[0015] CTTGCCTGGGAAACTTCTGTGTGTCACAGGGTGTGGCCAAAAAAAAAAAAATCATCATTTGTTAGTAATGGCTGTTTCTGCACAACGACCAGAGACCCAGTCATGTTCAAAGCACCTTACAAAAAATGAGCTGCAGAGAAACAAGTTGCACAGAATAACACAGCTTGTAACTAAGAGTCACCCTGAGTCAACCCTATATGAAAGCCCTCACCCATAGAGACAGTCTGCTTCCTTCTTCCTCCAGCCGCCACCCCAGGAGACAAGCAGGCAGGCTGGAGGGAATGATTCTTGGGGTGCTGGTCAGAGGTCAGCATTCAR(C / T)CCATTTGGTCAAACTTTTATTGCTTAGCTA CTCTGTGCTTGGCACTGAATATCTTAAGACGTGCATTTAGAGGTCTCCCACAGTGCAATCGGGGAAGGCAGATACGGAAACCTCAGAAGAGCTGAGGTGGTTATCTAGGCTCAGTGCCACATGTCTGTAAGATGTGTGGCTGAGGAGTTGGTAGAAGTATTTTTTAAAAAGAGAACGAAAGGCAGTTCTAATGAAAGGGC

[0016] The application provides a method for screening a genetic marker associated with a pig back fat thickness trait, and the method comprises the following steps:

[0017] Genomic DNA is extracted from blood of American Yorkshire, Danish Landrace and French Landrace. Primers are designed according to genomic sequences from upstream -315 to downstream +230 of the site. The genomic DNA of pigs is amplified by PCR using the primers, and the nucleotide sequence from upstream -315 to downstream +230 of the site is obtained by direct sequencing method (the sequence is shown in SEQ ID NO. 1), and the sequence comprises one SNP site. The mutation site can be used as a genetic marker for correlation analysis of the back fat thickness trait of American Yorkshire and French Landrace.

[0018] The application provides a genotyping method for detecting the SNP site in the above sequence.

[0019] The application further provides an application of determining correlation analysis between different genotypes of individuals and the back fat thickness trait by the direct sequencing method, and the application comprises the following steps:

[0020] In order to determine the correlation between the SNP in the region of 20562964-20563509 of pig chromosome 11 and the difference of pig phenotype, the American Duroc, the Danish Landrace and the French Landrace are selected as the test materials; the polymorphism is detected by the direct sequencing method, and the American Duroc and the French Landrace are used as the test materials to analyze the correlation between the polymorphic site and the backfat thickness of the pig.

[0021] Compared with the prior art, the present application has the following advantages and effects:

[0022] The SNP molecular marker located at the 20563279th base of pig chromosome 11 is screened out by the whole genome association analysis, the R at the 316th position in the nucleotide sequence of the site is allelic replacement, and the replacement causes polymorphism at the position. -10 Based on the genotype data of 2168 Danish Landrace pig populations, the SNP site is significantly associated with the live backfat thickness trait, and the P value is 4.16*10 -10 The R at the 316th position in the nucleotide sequence of the SNP molecular marker is allelic replacement, and the replacement causes polymorphism at the position: in the backfat thickness trait, the CC genotype of the SNP site has thinner backfat than other genotypes, and the CC genotype of the SNP site is the favorable genotype of the pig backfat thickness. The present application discloses the genetic regulation effect of the SNP site on the pig backfat thickness trait for the first time, provides a high-precision and high-stability target for pig molecular marker assisted selection, and has important breeding practical value. The present application aims to explore and identify the SNP site related to the pig backfat thickness trait, and then provide important guidance significance for the genetic breeding of pigs. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The genetic marker of the present application is a SNP significantly related to the live backfat thickness, which is obtained by whole genome association analysis of the genotype data of 2168 Danish Landrace pig populations;

[0024] Figure 2 The genetic marker of the present application is a SNP significantly related to the live backfat thickness, which is obtained by whole genome association analysis of the genotype data of 2168 Danish Landrace pig populations;

[0025] Figure 3 The present application is the cloning detection result of the segment of 20562964-20563509 of pig chromosome 7; the concentration of agarose gel is 1.5%; wherein, lanes 1-3: PCR amplification products, lane M: DL2000 Maker;

[0026] Figure 4The application provides a nucleotide sequence of a 20562964-20563509 segment of a pig chromosome 11; wherein 1 mutation site in the sequence is a specific site causing polymorphism of the segment.

[0027] Figure 5 The sequencing result of the genetic marker sequence; three genotypic sequencing results of the Danish, French and American lines, wherein a bimodal map exists, and base "C" is mutated into "T". DETAILED DESCRIPTION

[0028] Example 1: Identification of the genetic marker of the application

[0029] Based on the genotype data of the Danish Landrace pig population, a univariate linear mixed model of Gemma (version 0.98.5) software is used for whole genome association analysis. The first three principal components are corrected in the model to control the population structure, and gender and batch are included as fixed effects, and the P value is 4.16E-10.

[0030] Example 2: Obtaining of the 20562964-20563509 region DNA fragment of the pig chromosome 11 and establishment of a SNP detection method

[0031] According to the genomic sequence of the 20562964-20563509 segment of the pig chromosome 11, a primer pair is designed, and the specific sequence is as follows:

[0032] Forward primer (SEQ ID NO. 2): 5'-CTTGCCTGGGAACTTCTGTGTGT-3',

[0033] Reverse primer (SEQ ID NO. 3): 5'-GCCCTTTCATTAGAACTGCCTTTCG-3'.

[0034] The above primer pair is used for PCR amplification in the genomic DNA of different test population pigs.

[0035] The PCR reaction system is shown in Table 1.

[0036] Table 1 PCR reaction system

[0037]

[0038] The PCR reaction conditions are shown in Table 2.

[0039] Table 2 PCR reaction conditions

[0040]

[0041]

[0042] After the PCR product was purified and cloned, Wuhan Hechong Gene Technology Co., Ltd. was commissioned to conduct sequence determination. Through BLAST comparison and analysis, it was found that there was a C / T base mutation at the 316th base of the sequence, and the site was polymorphic in the American Large White, Danish Large White, and French Large White populations.

[0043] Example 3: Association analysis and application of genetic markers of the application to the number of teats trait of different breeds of pigs

[0044] In order to determine the correlation between the SNP in the region of 20562964-20563509 of pig chromosome 11 and the difference in pig phenotype, the American Large White (522) and the French Large White (492) were selected as test materials in this embodiment. Polymorphism detection was performed by direct sequencing method, and the correlation between the polymorphic site and the backfat thickness trait of pigs was analyzed. The association between genotype and phenotype value was analyzed by using the mixed linear model (Mixed) in the SAS (version 9.4) statistical software. The analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm , wherein Y ijkl is the trait observation value; u is the total average value of the trait; G i is the genotype effect; F j , S k , B l are fixed effects, respectively family, sex, batch effect; ε ijklm is a random error, which is assumed to follow N~(0, σ 2 ) distribution.

[0045] After polymorphism detection of the rs81333780 site in the region of 20562964-20563509 of pig chromosome 11, three genotypes were detected in the above populations. The genotype frequency and its distribution are shown in Table 3.

[0046] Table 3 Genotype frequency and allele frequency of polymorphic site rs81333780

[0047]

[0048] From Table 3, it can be seen that the C allele frequency of the polymorphic site rs81333780 is higher than the T allele frequency in the American and French Large White populations. The results of Hardy-Weinberg equilibrium test show that in the American Large White (χ 2 =2.968, P=0.08>0.05) and French Large White (χ 2= 2.537, P = 0.11 > 0.05) and the genotype distribution of the polymorphic site rs81333780 was in accordance with Hardy-Weinberg equilibrium.

[0049] Table 4 Association analysis of rs81333780 with live backfat thickness in American Yorkshire pigs

[0050]

[0051]

[0052] Table 5 Association analysis of rs81333780 with live backfat thickness in French Yorkshire pigs

[0053]

[0054] Note: The above values are least square means ± standard errors; in each pig breed, the same column contains the same letter, indicating no significant difference (P > 0.05), different letters indicate significant difference (P < 0.05), capital letters indicate extremely significant difference (P < 0.01), lowercase letters indicate significant difference (P < 0.05), and no letter indicates no significant difference (P > 0.05). The number in parentheses represents the number of pigs.

[0055] Through the analysis of Table 4 and Table 5, it was found that the polymorphic site rs81333780 was significantly associated with live backfat thickness in American Yorkshire pigs and French Yorkshire pigs (P < 0.05), and the live backfat thickness of individuals with CC genotype was significantly lower than that of individuals with TT genotype (P < 0.05). From the aspects of genetic stability and genetic progress, CC genotype has obvious advantages in reducing live backfat thickness. Based on the above results, we speculate that the polymorphic site rs81333780 can be used as a potential genetic marker for increasing the number of pig teats and reducing backfat thickness.

[0056] Main references

[0057] [1] Lavery A, Lawlor P G, Magowan E, et al. An association analysis of sow parity, live-weight and back-fat depth as indicators of sow productivity [J]. Animal, 2019, 13(3): 622-630.

[0058] [2] Ramos A M, Crooijmans R P M A, Affara N A, et al. Design of a high density SNP genotype assay in the pig using SNPs identified and characterized by next generation sequencing technology [J]. PloS one, 2009, 4(8): e6524.

[0059] [3] Tak YG, Farnham PJ. Making sense of GWAS: using epigenomics and genome engineering to understand the functional relevance of SNPs in non-coding regions of the human genome. Epigenetics Chromatin. 207, 8: 57.

[0060] [4] Wang J Y, Wang H X, Chi R B, et al. Research progress of whole genome association analysis in livestock and poultry [J]. Chinese Journal of Agricultural Sciences, 2013, 46(04): 819-829.

[0061] [5] Lin Y. Research on the construction of natural product in vivo screening platform for anti-fat deposition food based on "peripheral CTSL-central 5-HT" loop [D]. Anhui: Hefei University of Technology, 2019.

Claims

1. A SNP molecular marker of the HTR2A gene associated with pig backfat thickness, characterized in that: The SNP molecular marker is located at base 20563279 in the HTR2A gene on pig chromosome 11. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R in the sequence is C or T.

2. The SNP molecular marker according to claim 1, characterized in that The pigs include Danish White Pigs, American Large White Pigs and French Large White Pigs.

3. The SNP molecular marker according to claim 1, characterized in that The sequences of the primer pairs used to detect the SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The use of the SNP molecular marker according to claim 1 in improving the pig backfat thickness trait, characterized in that: The R at position 316 in the nucleotide sequence of the SNP molecular marker represents an allele replacement, which results in a polymorphism at this position.

5. The use of the SNP molecular marker according to claim 4 in improving the pig backfat thickness trait, characterized in that: The CC genotype of the SNP site in the application has thinner back fat than other genotypes.

6. A genotype for improving pig backfat thickness, characterized in that: The genotype is a CC genotype based on the SNP site according to claim 1.

Images