Application of TaMYB-7B and coding gene thereof in regulation and control of wheat tiller number

Abstract

The invention discloses application of TaMYB-7B and a coding gene thereof in regulation and control of wheat tiller number, and belongs to the technical field of gene engineering. The invention finds for the first time that the TaMYB-7B gene is a novel gene capable of simultaneously regulating and controlling the tillering number and grain traits of wheat. The TaMYB-7B gene is interfered, knocked out, silenced or mutated, so that the tiller number of a plant can be increased, the grain length is increased, the hundred-grain weight is increased, finally, the yield of a single wheat plant can be increased, and a foundation is laid for wheat yield improvement and character improvement.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of TaMYB-7B and its encoding gene in regulating wheat tiller number. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is a widely cultivated crop and an important food resource. Achieving a synergistic increase in yield and resource utilization is an urgent need for the large-scale and sustained improvement of actual wheat productivity.

[0003] Wheat yield hinges on three core factors: number of spikes per plant, number of grains per spike, and thousand-grain weight. The number of spikes per plant is typically the most critical, while tillering and spike formation are key determinants of spike number. Furthermore, grain shape and quantity are directly related to yield. Therefore, studying the molecular mechanisms and developmental patterns of wheat tillering, spike formation, and grain formation is of great significance for improving wheat yield and plant architecture.

[0004] In the course of evolution, branching allows plants to better adapt to their environment. Tillering is a special form of branching in grasses (Poaceae). Its naming principle is as follows: tillers arising from the base of the main stem and from non-elongating internodes are called primary tillers; tillers arising from the base of primary tillers are called secondary tillers, and so on. Tillering is closely related to crop yield and is influenced by various factors, including genetic factors, endogenous hormones, and the external environment. Tillering occurs in two stages: the formation of axillary meristems and the elongation of axillary buds. Tillering is regulated by genetic factors, as well as influenced by hormones and the external environment. Tillering formation is affected by many genes, primarily three of which are involved in its development. OSH1, LAX and MOC1 . OSH1 belong KNOX Homeobox gene family, studies have shown that KNOX Genes are expressed before organ differentiation and in meristematic tissues such as shoot apical meristem and axillary meristem to maintain cell non-differentiation. LAX Encoding a plant-specific bHLH transcription factor, expressed in the boundary region between the shoot apex meristem and newly formed meristem in the aboveground part of the plant, it is a major regulator controlling the formation of axillary bud primordia in rice and is associated with... LAX1 They jointly participated in the development of meristematic tissues. MOC1 It encodes a GARS family transcription factor that controls axillary meristem formation during both vegetative and reproductive growth stages. moc1 The mutant will cause rice to not produce tillers and only have one main stem, which is a key factor in the initiation of rice tillering buds.

[0005] Plant hormones coordinate the formation and development of axillary meristems through a complex regulatory network. Auxin spatial distribution is a key regulator of axillary meristem development, and its apical dominance effect inhibits axillary meristem formation through polar transport. Experiments have confirmed that a low-auxin microenvironment in leaf axils is crucial for maintaining... SHOOT MERISTEMLESS (STM) Gene expression is a necessary condition, and ectopic expression of auxin synthase or inhibition of PIN family protein-mediated polar transport both hinder axillary meristem development. The auxin-responsive factor ARF5 / MONOPTEROS (MP) and the phosphorylation regulator PID jointly maintain axillary low-auxin homeostasis by dynamically regulating PIN protein localization. Unlike the inhibitory effect of auxin, cytokinin directly activates axillary meristem formation via pulse signals detected by a TCS signal sensor, and the expression of its key biosynthetic enzyme AIPT is affected by... STM Gene regulation, and the integrity of cytokinin receptors and downstream signaling pathways, are crucial for auxin development. Stigrolium lactone, as a novel regulatory factor, catalyzes β-carotene production via CCD7 / CCD8 enzymes, inhibiting PIN1 protein localization and thus blocking auxin transport. MAX2 The signal transduction system involving genes is key to its inhibitory effect. Furthermore, hormones interact with each other, forming a complex balance system.

[0006] Common wheat is an allohexaploid with a large genome, a long growth cycle, and relatively limited genomic information. The discovery and functional identification of wheat tillering genes are more complex than those of many other crops. Therefore, fully exploring wheat tillering-related genes and conducting functional studies can lay a theoretical foundation for increasing wheat yield and improving traits, which will help achieve high and stable wheat yields and increase economic benefits. Summary of the Invention

[0007] In view of the above-mentioned prior art, the purpose of this invention is to provide the application of TaMYB-7B and its encoding gene in regulating wheat tiller number.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides TaMYB-7B The use of genes in at least one of the following (1)-(3): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Plant breeding; The TaMYB-7B Genes are nucleic acid molecules as shown in (i), (ii), or (iii) below: (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.1; (ii) Nucleic acid molecules other than (i) that encode the amino acid sequence shown in SEQ ID NO.2; (iii) A nucleic acid molecule that has 90% or more identity with the nucleic acid molecule defined in (i) or (ii) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.2.

[0009] In the above applications, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA or mRNA.

[0010] The term "identity" used here refers to sequence similarity to native nucleic acid sequences. Identity can be evaluated using computer software, such as the BLAST algorithm (Altschul). et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).

[0011] In the aforementioned nucleic acid molecules, the 90% or more identity can be at least 90%, 92%, 93%, 95%, 96%, 98%, or 99% identity.

[0012] In the above applications, the grain shape includes: grain length and grain width.

[0013] In the above applications, the plant breeding refers to the cultivation of high-yield plant varieties.

[0014] In the above applications, the plant is preferably a grass, including but not limited to: wheat, barley, oats, rye, corn, rice, sorghum, etc.

[0015] This invention is the first to discover that, TaMYB-7B The gene is a novel gene that regulates wheat tiller number and grain traits. TaMYB-7B Gene interference, knockout, silencing, or mutation can increase the number of effective tillers in wheat, and improve the grain length, grain width, and 100-grain weight.

[0016] Tiller number and grain traits are key agronomic traits affecting wheat yield. An appropriate tiller number helps to construct a reasonable plant population structure, improve photosynthetic efficiency, and achieve high yields. Therefore, regulating tiller number is crucial. TaMYB-7B Gene expression can enable the breeding of high-yield wheat varieties.

[0017] A second aspect of the invention provides the use of the TaMYB-7B protein in at least one of the following (1)-(3): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Regulate plant yield.

[0018] The TaMYB-7B protein is any one of the proteins shown in (A1)-(A3) below: (A1) A protein with the amino acid sequence shown in SEQ ID NO.2; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); (A3) A protein having the same function as the amino acid sequence shown in SEQ ID NO.2, by substitution and / or deletion and / or addition of one or more amino acid residues.

[0019] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0020] A third aspect of the invention provides regulation TaMYB-7B The use of a substance that expresses the gene or regulates the activity and / or content of the TaMYB-7B protein in at least one of the following (1)-(4): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Regulating plant yield; (4) Plant breeding.

[0021] In this invention, the regulation can be increased, enhanced, or improved; the regulation can also be decreased, weakened, or reduced.

[0022] In some preferred implementation schemes, regulation TaMYB-7B The substance that expresses the gene or regulates the activity and / or content of the TamyB-7B protein can be any of the following: e1) Suppress, reduce, or silence TaMYB-7B Nucleic acid molecules involved in gene expression; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).

[0023] The vectors mentioned are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be interference vectors. TaMYB-7B RNAi vectors for gene expression.

[0024] A fourth aspect of the present invention provides a method for regulating the number of tillers and grain traits in wheat, comprising the following steps: wheat plants TaMYB-7B Gene interference, knockout, silencing, or mutation can be used to increase the number of tillers, grain length, grain width, and 100-grain weight in wheat.

[0025] Among the methods described above, techniques such as RNA interference, homologous recombination, VIGS technology, T-DNA insertion, and CRISPR-Cas9 gene editing can be used to... TaMYB-7B Gene interference, knockout, silencing, or mutation.

[0026] A fifth aspect of the present invention provides a method for cultivating high-yield wheat, comprising the following steps: wild wheat TaMYB-7B Gene interference, knockout, silencing, or mutation can be used to obtain mutant strains with increased effective tiller number, increased grain length, grain width, and 100-grain weight; the yield of the mutant strains is higher than that of wild-type wheat.

[0027] The beneficial effects of this invention are: This invention is the first to discover: TaMYB-7B The gene is a novel gene capable of simultaneously regulating both tiller number and grain traits in wheat. TaMYB-7B Gene interference, knockout, silencing, or mutation can increase the number of tillers in a plant, while also increasing grain length and 100-grain weight, ultimately improving the yield per wheat plant and laying the foundation for increased wheat yield and improved traits. Attached Figure Description

[0028] Figure 1 for TaMYB-7B Analysis of expression patterns.

[0029] Figure 2 for TaMYB-7B Subcellular localization of proteins.

[0030] Figure 3 for TaMYB-7B Identification results of genetically transformed plants with RNAi.

[0031] Figure 4 for TaMYB-7B Phenotypic analysis of RNAi plants; in the figure, A represents wild-type Fielder and... TaMYB-7B -RNAi plants at the jointing stage; B represents wild-type Fielder and... TaMYB-7B -RNAi mature plants; C represents wild-type Fielder and TaMYB- 7B -RNAi seed length and width phenotype; D represents wild-type Fielder and TaMYB-7B -RNAi 100-grain weight phenotype.

[0032] Figure 5 For wild-type Fielder and TaMYB-7B -Statistical analysis of RNAi plant phenotypes (maximum number of tillers, effective number of tillers, plant height, grain length, grain width, and 100-grain weight); In the figure, *: P < 0.05, **: 0.01 <P<0.001,***:P<0.001。 Detailed Implementation

[0033] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0034] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0035] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0036] Example 1: Wheat TaMYB-7B Analysis of gene cloning and expression patterns 1. Wheat TaMYB-7B Gene cloning: Using wild-type Fielder wheat as the material, the CDS sequence and amino acid sequence of the wheat TaMYB-7B gene were found on the WheatOmics 1.0 and Ensembl Plants websites, and sequence alignment was performed using DNAMAN software. Based on the information obtained from the websites... TaMYB-7B Based on the gene's base sequence, primers for its specific fragment were designed. Using shoot tip cDNA from wild-type spring wheat (Fielder) as a template, PCR amplification was performed, and the amplified products were sequenced. Sequencing results showed... TaMYB-7B The CDS is 1254 bp in length and encodes 417 amino acid residues. The CDS nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2.

[0037] 2. Wheat TaMYB-7B Analysis of gene expression patterns: For testing TaMYB-7B To investigate the expression levels in different parts of wheat plants, we used tillering buds (AM), leaves, roots, shoot apical meristems (DR) at the two-ridge stage, and spikelets (SP) of wild-type Fielder wheat as experimental materials. TaMYB-7B The expression level was quantitatively detected. Details are as follows: Fresh wheat tissue was collected, ground in liquid nitrogen, and total RNA was extracted using the NewSemi Total RNA Column Extraction Kit (M5102). RNA was reverse transcribed using the Tiangen FastKing cDNA First Strand Synthesis Kit (KR116).

[0038] Quantitative PCR was performed using Mona Biotechnology's SuperRealPreMix Plus (SYBR Green) reagent. Three biological replicates and three technical replicates were set up for each sample to ensure the reliability of the experimental data. Samples were stored in a Roche Light Cycler 96 real-time PCR instrument. The upstream and downstream primers were: RT- MYB-7B -F1: 5'-CGCTCGTAAGAACAACAAGGA-3'; RT- MYB-7B -R1: 5'-CTTCATAGAGTGGAGGCTAATTCTTCA-3'.

[0039] ACTIN-F: 5'-GCCATGTACGTCGCAATTCA-3'; ACTIN-R: 5'-AGTCGAGAACGATACCAGTAGTACGA-3'.

[0040] The results show TaMYB-7B It is expressed in tillers, leaves, roots, shoot apical meristems, and spikelets, with the highest expression level in tillers, followed by shoot apical meristems and leaves at the two-ridge stage, and relatively low expression in roots. Figure 1 ).

[0041] Example 2: Wheat TaMYB-7B Sublocalization analysis of genes 1. Test method: According to wheat TaMYB-7B The CDS sequence of the gene was used to design primers for gene cloning using DNAman software. Two restriction enzyme sites, BmaHI and KpnI, were selected in the expression vector 35S::GFP and added to the 5' end of the forward and reverse primers, respectively. PCR amplification was then performed. TaMYB-7B The CDS sequence was obtained and recovered via gel extraction. Specific primers are as follows: TaMYB-7B -PORKⅡ-F: 5'-cgggggactctagaggatccATGTCCAGCAACAAGGTAGC-3'; TaMYB-7B -PORKⅡ-R: 5'-cccttgctcaccatggtaccATTTTGATGGGTAGTTTG-3'.

[0042] Will TaMYB-7B The gel reversion product was ligated into the 35S::GFP vector to construct the fusion protein expression vector 35S:: TaMYB- 7B -GFP was transformed into E. coli competent cells TOP10, and the plasmid was extracted through screening and sequencing. This plasmid was then transformed into Agrobacterium tumefaciens competent cells GV3101. After successful screening, the recombinant vector 35S:: was transiently transfected. TaMYB-7B -GFP bacterial solution was injected into the lower epidermis of tobacco leaves. 48 hours later, the lower epidermis of the tobacco leaves was peeled off and observed using a Zeiss laser confocal microscope (LSM880).

[0043] 2. Test Results: The results showed that 35S::TaMYB-7B- The co-localization of GFP and mCherry in the cell nucleus indicates that... TaMYB-7B Located in the cell nucleus ( Figure 2 ).

[0044] Example 3: TaMYB-7B - Creation and phenotypic analysis of RNAi transgenic wheat 1. Test method: In order to investigate TaMYB-7B We built the functionality. TaMYB-7B -RNAi vectors, using wild-type Fielder wheat embryos as material, utilize Agrobacterium-mediated genetic transformation.

[0045] According to wheat TaMYB-7B Primers were designed using DNAman software based on the gene's CDS sequence (SEQ ID NO.1). TaMYB-7B -RNAi-F and TaMYB-7B -RNAi-R, amplification TaMYB-7B A 170bp specific sequence fragment that distinguishes it from other genes; TaMYB-7B -RNAi-F: CACCTAGCTCCACTCTATGAAG; TaMYB-7B -RNAi-R:CTACAGATTTGGCATTGGCA.

[0046] Specific sequence fragments were ligated into the pENTR-D-TOPO vector and transformed into competent *E. coli* cells TOP10. Single colonies were cultured and tested using a shaking method. Bacteria with correctly sequenced colonies were selected for plasmid extraction via shaking. The plasmids were then digested with EcoR V enzyme. Fragments successfully digested using gel electrophoresis were subjected to a LR reaction. The LR reaction system consisted of 1 μL of the fragment, 1 μL of the PC336 expression vector (provided by Professor Fu Daolin's research group at Shandong Agricultural University), and 0.5 μL of LR enzyme. After incubation at 25°C for 3 hours, the fragments were transformed into competent *E. coli* cells. Bacterial screening and sequencing were performed to extract plasmids, which were then transformed into competent *Agrobacterium* cells (EHA105). Wild-type Fielder wheat embryos were used as experimental material, and *Agrobacterium*-mediated transformation was employed for wheat genetic transformation.

[0047] For the acquired TaMYB-7B- RNAi-transformed plants were identified. Primers "bar-F" and "bar-R" were used to amplify the herbicide resistance gene "bar" on the PC336 vector to verify the vector backbone. Since the forward and reverse fragments of the target gene (TaMYB-7B) in the RNAi vector form an inverted repeat structure through a spacer region, specific primers "PC336-306" and "PC336-46" were designed for the PC336 vector. These were paired with the forward primer "TaMYB-7B-RNAi-F" and the reverse primer "TaMYB-7B-RNAi-R" for the specific fragment, respectively, to amplify the inserted target gene fragment in the vector. Specifically, "PC336-306" and "TaMYB-7B-RNAi-F" amplified the forward fragment of the target gene (approximately 350 bp in length), while "PC336-46" and "TaMYB-7B-RNAi-R" amplified the reverse fragment. The reverse fragment of the target gene (approximately 400 bp in length) was amplified by combining the two to verify the correct insertion of the target gene repetitive structure in the RNAi vector.

[0048] bar-F: GGCGGTCTGCACCATCGTCAACCACTAC; bar-R: AGTCCAGCTGCCAGAAACCCACGTCATG.

[0049] PC336-306: GACCTCGCAAGGCATATTG; PC336-46: TTTAGCCCTGCCTTTCATACG.

[0050] Select the three successfully constructed buildings: #1, #2, and #3. TaMYB-7B- RNAiT3 generation lines were planted in the field to observe phenotypes and statistically analyze their agronomic traits. The maximum number of tillers in wheat was measured at the early jointing stage, while plant height and effective tiller number were measured after maturity.

[0051] 2. Test Results: TaMYB-7B The identification results of RNAi-transformed plants are as follows: Figure 3 As shown, the results indicate that this embodiment successfully constructed... -RNAi genetically transformed plants.

[0052] TaMYB-7B The results of the agronomic trait investigation of the RNAiT3 generation lines are as follows: and TaMYB-7B- As shown, the results indicate that the maximum number of tillers in wild-type plants is 26-30. RNAi plants have 29-38 effective tillers; at maturity, wild-type plants have 14-18 effective tillers. Figure 4 The effective number of tillers in RNAi plants is 16-22. The above statistical results indicate that... RNAi promotes tillering in wheat.

[0053] The average grain length of wild-type plants is approximately 6.5 mm. Figure 5 The RNAi plants had a seed size of 7 mm; the wild-type plants had a 100-seed weight of approximately 3.5 g. The amount in RNAi plants was 3.8g.

[0054] The above statistical results indicate that, compared with the wild type, TaMYB-7B- TaMYB-7B- TaMYB-7B- TaMYB-7B- TaMYB-7B- TaMYB-7B Some key yield traits of the three RNAi lines showed beneficial changes, including grain length and 100-grain weight that were higher than those of the wild type.

[0055] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. TaMYB-7B The use of genes in at least one of the following (1)-(3): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Plant breeding; The TaMYB-7B Genes are nucleic acid molecules as shown in (i), (ii), or (iii) below: (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.1; (ii) Nucleic acid molecules other than (i) that encode the amino acid sequence shown in SEQ ID NO.2; (iii) A nucleic acid molecule that has 90% or more identity with the nucleic acid molecule defined in (i) or (ii) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The grain shape includes: grain length and grain width.

3. The application according to claim 1, characterized in that, The plant breeding mentioned refers to the cultivation of high-yielding plant varieties.

4. The application according to claim 1, characterized in that, The plant is a grass; preferably, the plant is wheat, barley, rice, corn, sorghum, oats or rye.

5. The use of TaMYB-7B protein in at least one of the following (1)-(3): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Regulating plant yield; The TaMYB-7B protein is any one of the proteins shown in (A1)-(A3) below: (A1) A protein with the amino acid sequence shown in SEQ ID NO.2; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); (A3) A protein having the same function as the amino acid sequence shown in SEQ ID NO.2, by substitution and / or deletion and / or addition of one or more amino acid residues.

6. Regulation TaMYB-7B The use of a substance that expresses the gene or regulates the activity and / or content of the TaMYB-7B protein in at least one of the following (1)-(4): (1) Regulating the number of tillers in plants; (2) Regulating the shape and weight of plant seeds; (3) Regulating plant yield; (4) Plant breeding.

7. The application according to claim 6, characterized in that, Regulation TaMYB-7B The substance that expresses the gene or regulates the activity and / or content of the TaMYB-7B protein is any one of the following: e1) Suppress, reduce, or silence TaMYB-7B Nucleic acid molecules involved in gene expression; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).

8. A method for regulating wheat tiller number and grain traits, characterized in that, Includes the following steps: wheat plants TaMYB-7B Gene interference, knockout, silencing, or mutation can be used to increase the number of tillers, grain length, grain width, and 100-grain weight in wheat.

9. The method according to claim 8, characterized in that, Using RNA interference, homologous recombination, VIGS technology, T-DNA insertion, or CRISPR-Cas9 gene editing to... TaMYB-7B Gene interference, knockout, silencing, or mutation.

10. A method for cultivating high-yield wheat, characterized in that, Includes the following steps: wild wheat TaMYB-7B Gene interference, knockout, silencing, or mutation can be used to obtain mutant strains with increased effective tiller number, increased grain length, grain width, and 100-grain weight; the yield of the mutant strains is higher than that of wild-type wheat.

Images