SNP (Single Nucleotide Polymorphism) molecular marker related to thousand seed weight of wheat and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to thousand seed weight of wheat and application thereof, and belongs to the technical field of molecular marker breeding. The invention discloses a wheat thousand seed weight related SNP-783 site and application thereof, the SNP site corresponds to the 783rd basic group from the 5'tail end of a sequence shown in SEQ ID NO: 1, and when the site is C / C homozygous, the corresponding genotype is A, and when the site is C / C homozygous, the corresponding genotype is B; when the locus is T / T homozygous, the corresponding genotype is B, and the thousand seed weight of the wheat with the homozygous genotype A is greater than or candidate greater than that of the wheat with the homozygous genotype B. The SNP has high effectiveness and potential application value, wheat with high thousand seed weight can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular marker breeding, in particular to a SNP molecular marker related to wheat thousand grain weight and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L.) is one of the most important global food crops and an important source of energy and nutrition for human beings. Thousand grain weight (TGW) is one of the important factors constituting wheat yield and an important index for determining the quality of wheat seeds. Therefore, it has important application value in wheat high-yield breeding to mine excellent allelic variations regulating thousand grain weight and develop functional markers.

[0003] In recent years, QTL positioning of wheat thousand grain weight and related traits has been one of the research hotspots of wheat yield traits. It is reported that QTLs of thousand grain weight and related traits have been positioned on 21 chromosomes of wheat. For example, Yu Manli et al. positioned 6 QTLs of thousand grain weight on 1D, 2B, 3D, 6D and 7A chromosomes by using RIL population created by H307 / Zhengmai9023, which can explain 4.54-13.14% of phenotypic variation. Gao et al. positioned 13 QTLs of thousand grain weight on 1AL, 2DL(2), 3DL, 4AL, 4BS, 5AL(2), 5AS, 5BL, 6A, 7AL and 7BL chromosomes by using Zhou8425B / Changnian RIL population. Among them, QTKW.caas-6A.1 and QTKW.caas-7AL can be detected in all environments, which can explain 4.8-10.3% and 3.5-6.5% of phenotypic variation. Zhang Zeyuan et al. constructed 216 recombinant inbred line population by using Heshangtou and Longchun 23, and identified 51 QTLs related to grain weight in 4 environments by 55k SNP genotyping, including 4 QTLs which can stably exist in 3 or more environments, located on 2D, 5A, 6B and 7D chromosomes. Kim et al. positioned grain traits by using F2-F5 of soft wheat and hard wheat cross, and found 5 QTL sites controlling thousand grain weight, located on 3B, 1AS / 1AL, 1BS / 1BL, 3DL and 2AS, each QTL contributed 5.0%-12.2%. Cao Dong et al. identified 5 QTLs of thousand grain weight by using F2 population, distributed on 1B, 5A, 5B, 5D and 7B chromosomes, which can explain 8.9%-10.9% of phenotypic variation; at the same time, it was found that the same QTL site controlling multiple traits existed on 5B and 7B chromosomes, which belonged to one-factor multi-effect action.

[0004] Although many QTLs related to the thousand kernel weight of wheat have been located at present, due to the fact that the phenotypic contribution rates of most QTLs are small, the additive effect is required to be reflected, and the repeatability is poor among different years and environments, so these QTLs are difficult to be applied to the genetic improvement of the thousand kernel weight of wheat. SUMMARY

[0005] The purpose of the present application is to provide a SNP molecular marker related to the thousand kernel weight of wheat and application thereof, so as to solve the problems existing in the prior art.

[0006] In order to achieve the above-mentioned purpose, the present application provides the following solutions:

[0007] One of the technical solutions of the present application is a SNP molecular marker related to the thousand kernel weight of wheat, wherein the molecular marker is located on the 4A chromosome of the wheat genome, and is a nucleotide sequence shown in SEQ ID NO: 1, and the base at the 783th position of the nucleotide sequence is C or T.

[0008] The second technical solution of the present application is a method for identifying the thousand kernel weight of wheat by using the SNP molecular marker, comprising the following steps: detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the wheat genome DNA to be identified, and the thousand kernel weight of the wheat with the genotype of CC is higher than that of the wheat with the genotype of TT.

[0009] The third technical solution of the present application is a method for identifying the thousand kernel weight of wheat by using the SNP molecular marker, comprising the following steps: detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the wheat genome DNA to be identified, and the thousand kernel weight of the wheat with the genotype of CC is higher than that of the wheat with the genotype of TT.

[0010] The fourth technical solution of the present application is a primer combination for specifically amplifying the SNP molecular marker, wherein the primer combination comprises the sequences shown in SEQ ID NO: 2 to SEQ ID NO: 5.

[0011] The fifth technical solution of the present application is the application of the SNP molecular marker in the breeding of the thousand kernel weight related traits of wheat.

[0012] The sixth technical solution of the present application is the application of the SNP molecular marker in the identification or auxiliary identification of the thousand kernel weight related traits of wheat.

[0013] The seventh technical solution of the present application is the application of the SNP molecular marker in the preparation of a product for identifying or auxiliary identifying the thousand kernel weight related traits of wheat.

[0014] Based on the above technical solutions, the present application has the following technical effects:

[0015] The present application finds, through genetic variation analysis of genes of a natural variation population of wheat, one SNP corresponding to the 783th position from the 5' end of SEQ ID NO:1. Through designing a dCAPS marker for the SNP site, it is found that the SNP has two genotypes: genotype A (C) and genotype B (T). Through correlation analysis, it is proved that the size of 1000-grain weight of the homozygous types of the two genotypes is: genotype A homozygous wheat > genotype B homozygous wheat. The present application also provides a dCAPS marker for detecting the SNP. Experiments prove that by detecting the SNP, wheat with higher 1000-grain weight can be found. The present application provides a new method for molecular marker-assisted selection breeding of wheat, which has important significance in agricultural practice and / or related scientific research for cultivating high-yield wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is the electrophoresis detection result of dCAPS marker enzyme digestion product developed for the SNP of the present application; wherein lane C is the band cut by XhoI, and lane T is the band that cannot be cut by XhoI.

[0017] Figure 2 It is the gene structure mode diagram and SNP site diagram of the present application.

[0018] Figure 3 It is the SNP site and genotyping diagram of the gene in the wheat population material of the present application.

[0019] Figure 4 It is the correlation analysis result diagram of the condition of the genetic polymorphism site in the natural population and the 1000-grain weight.

[0020] Figure 5 It is the verification result diagram of the correlation analysis of the condition of the genetic polymorphism site in the natural population and the 1000-grain weight.

[0021] Figure 6 It is the XhoI recognition site.

[0022] Figure 7 It is the wheat sowing site photo in Example 2.

[0023] Figure 8 It is the wheat harvesting site photo in Example 2. DETAILED DESCRIPTION

[0024] The technical solutions described in the present application are all conventional solutions in the art if not specifically stated, and the reagents or raw materials used are all purchased from commercial channels or have been disclosed if not specifically stated.

[0025] The embodiment of the present application provides a SNP molecular marker related to the thousand-grain weight of wheat, wherein the molecular marker is located on the 4A chromosome of the wheat genome, is the nucleotide sequence shown in SEQ ID NO:1, and the base at the 783th position of the nucleotide sequence is C or T.

[0026] In some specific embodiments, the SNP molecular marker has genotypes CC and TT.

[0027] The embodiment of the present application also provides a method for identifying the thousand-grain weight of wheat by using the SNP molecular marker, and the method comprises the following steps: detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the wheat genome DNA to be identified; and the thousand-grain weight of the wheat with the genotype CC is higher than that of the wheat with the genotype TT.

[0028] In some specific embodiments, the method for detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the wheat genome DNA to be identified is as follows:

[0029] (1) using the wheat genome DNA to be identified as a template, and performing PCR amplification by using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3;

[0030] (2) diluting the PCR product of step (1), and performing PCR amplification by using the primer pair shown in SEQ ID NO:4 and SEQ ID NO:5;

[0031] (3) performing XhoI enzyme digestion on the PCR product of step (2) to obtain an enzyme digestion product; if the enzyme digestion product is two or smaller fragments: 94bp, then the wheat to be detected has the genotype CC at the site; if the enzyme digestion product is one or larger fragment: 118bp, then the wheat to be detected has the genotype TT at the site.

[0032] The embodiment of the present application also provides a primer combination for specifically amplifying the SNP molecular marker, and the primer combination comprises the sequences shown in SEQ ID NO:2 to SEQ ID NO:5.

[0033] The embodiment of the present application also provides the application of the SNP molecular marker in the breeding of the thousand-grain weight related traits of wheat.

[0034] The embodiment of the present application also provides the application of the SNP molecular marker in the identification or auxiliary identification of the thousand-grain weight related traits of wheat.

[0035] The embodiment of the present application also provides the application of the SNP molecular marker in the preparation of a product for identifying or auxiliary identifying the thousand-grain weight related traits of wheat.

[0036] The wheat materials used in the examples of the present invention were all from the China Crop Germplasm Bank (https: / / www.cgris.net / home). Material information can be found on the China Crop Germplasm Information Network, website: https: / / www.cgris.net / contact.

[0037] Example 1

[0038] 1.1 Specific primers for amplifying the genomic fragment containing the wheat SNP and sequence analysis

[0039] A SNP was found on chromosome 4A of the wheat genome (iwgsc_refseqv1.0 assembly for Triticum aestivum), corresponding to position 783 from the 5' end of SEQ ID NO. 1. Two genotypes were found at this site in the naturally occurring wheat population:

[0040] SEQ ID NO: 1(>chromosome:IWGSC:4A:406557729-406560182):

[0041]

[0042]

[0043] Note: The bold and tilted sites in the sequence are SNP sites. The underlined sites represent the sites used for PCR amplification of the sequence 384-1170 shown in SEQ ID NO: 1. The double underlined sites represent the sites used for PCR amplification of the sequence 688-805 shown in SEQ ID NO: 1.

[0044] Genotype A: C; Genotype B: T.

[0045] Based on the sequence differences of different wheat genomes, specific primers were designed to PCR amplify DNA fragments containing the SNP sites:

[0046] F1: ATGAAAGAAGCCCTCCGAGAA (SEQ ID NO: 2);

[0047] R1:TCAGAATAAGGTGCATATCTTCTT (SEQ ID NO: 3)

[0048] F2: CCTGTTTTGAATGTAAGGAC (SEQ ID NO: 4);

[0049] R2: CAAATAACTTCCGGCATGTCTC (SEQ ID NO: 5).

[0050] The sequence of 384-1170 of SEQ ID NO: 1 is amplified by PCR using primers F1 and R1, and the sequence of 688-805 of SEQ ID NO: 1 is amplified by PCR using primers F2 and R2. Enzymatic analysis shows that the polymorphism can be recognized by Xho I.

[0051] 1.2Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0052] 1) Extract the genomic DNA of the wheat to be tested.

[0053] 2) Using the genomic DNA of step 1) as a template, primers F1 and R1 are used for PCR amplification, and the PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2 × TaqMix 10 μL, 1 μL of primer F1 (10 μmol / L) and primer R1 (10 μmol / L) each, and 1 μL of template (20 ng / μL).

[0054] The PCR amplification conditions are as follows: 95°C for 3 min; 95°C for 30 s, 54°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min, and 16°C for storage.

[0055] 3) The PCR product of step 2) is diluted 10 times, and using it as a template, primers F2 and R2 are used for PCR amplification, and the PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2 × TaqMix 10 μL, 1 μL of primer F2 (10 μmol / L) and primer R2 (10 μmol / L) each, and 1 μL of template (20 ng / μL).

[0056] The PCR amplification conditions are as follows: 95°C for 3 min; 95°C for 30 s, 54°C for 30 s, 72°C for 15 s, 35 cycles; 72°C for 10 min, and 16°C for storage.

[0057] 4) The PCR product obtained in step 3) is digested with Xho I to obtain the digested product, which is subjected to 4% agarose gel electrophoresis detection, and whether the PCR product is cut into two fragments is recorded, and the condition of the wheat to be tested at the site is judged and recorded according to the following method:

[0058] If the digested product is two or smaller fragments: 94 bp, then the genotype of the wheat to be tested at the site is C / C; if the digested product is one or larger fragment: 118 bp, then the genotype of the wheat to be tested at the site is T / T. Figure 1 ).

[0059] 5) According to the results of step 4), the wheat is divided into the following two types I and II according to the condition at the site:

[0060] I: C / C (i.e. genotype A homozygous); II: T / T (i.e. genotype B homozygous).

[0061] Note: The former is the case of one homologous chromosome, and the latter is the case of another homologous chromosome.

[0062] 1.3 Typing of natural population by using dCAPS marker and correlation analysis with the thousand kernel weight trait

[0063] In the natural population of 348 hexaploid wheat, each wheat was used as a test wheat for typing, and the amplification products of wheat were sequenced and verified. The results are shown in Table 1.

[0064] Table 1: The case of the polymorphic site in the natural population of wheat

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072] Exon capture sequencing was carried out on 383 materials, and specific genotyping was carried out on these materials, including genotype A homozygous C / C and genotype B homozygous T / T. As shown in Table 2, among the 383 materials, 371 materials could be clearly divided into genotype A homozygous C / C or genotype B homozygous T / T, and the remaining 12 materials could not be genotyped. Figure 3

[0073] In addition, among the 383 materials, 348 had multi-year and multi-point agronomic trait data, and the remaining 35 materials could not meet the subsequent analysis requirements due to insufficient data. Therefore, as shown in Table 2 and Table 3, only 348 data were used in the correlation analysis of the case of genetic polymorphism site in the natural population and the thousand kernel weight. Figure 4

[0074] ​​In 2018, the natural population of wheat was planted in the dry-hot land and dry land and water-hot land of the Sanfenzhan Experimental Station of Hebei Agricultural University (Baoding, Hebei), in 2019 in the dry-hot land and dry land, water-hot land and water land of Hengshui Experimental Station of Hebei Agricultural University (Baoding and Hengshui, Hebei), in 2020 in the dry land and dry-hot land of Gaocun Experimental Station of Hebei Agricultural University (Gaocun Experimental Station), and the thousand-grain weight of each wheat variety was investigated. The association analysis of the thousand-grain weight and the polymorphic site was carried out by using Tassel2.1 software, the mixed linear model + population structure (MLM + (Q + K)) method was selected for analysis, the significant level was P < 0.05, and the results are shown in Table 2 and Figure 3

[0075] Table 2 Association analysis results of the natural population gene polymorphic site and the thousand-grain weight

[0076]

[0077]

[0078] The association analysis results of Table 2 show that the difference of the two types of thousand-grain weight of the natural population formed by the 331 hexaploid wheat shown in Table 1 reaches a significant level (P < 0.05). Among them, the thousand-grain weight of wheat of type I is higher than that of type II. In several environments, the thousand-grain weight of wheat material of type I is 0.682, 0.628, 0.733, 0.622, 1.065, 0.285, 0.699, 1.096, 0.989, 0.871 grams higher than that of type II, respectively. The study of the natural population shows that type I is an excellent genotype for improving the thousand-grain weight of wheat.

[0079] Example 2

[0080] In order to further verify that the genotype of genotype A homozygous is greater than or candidate genotype B homozygous wheat. The association analysis verification of the natural population gene polymorphic site and the thousand-grain weight was carried out on another 120 materials (Table 3), among which 3 materials were not genotyped, so the actual number of samples for association analysis verification was 117, which were used to verify the existence of the relationship between the molecular markers and the traits.

[0081] Table 3 Verification of the polymorphic site in the natural population of wheat

[0082]

[0083]

[0084]

[0085] ​In 2020, the natural population of wheat was planted in the dry-hot land and dry land of Hengshui experimental site of Hebei Agricultural University (Hengshui, Hebei) and the water-hot land in 2021, the dry-hot land and dry land, water-hot land and water land of Pingshan experimental site of Hebei Agricultural University (Hengshui and Pingshan, Hebei) in 2022, the dry land and dry-hot land of Gaocheng experimental site of Hebei Agricultural University (Gaocheng experimental station), and the thousand-grain weight of each wheat variety was investigated, the association analysis of the thousand-grain weight and the polymorphic site was carried out by using Tassel2.1 software, the mixed linear model + population structure (MLM + (Q + K)) method was selected for analysis, the significant level was P < 0.05, and the results were as shown in Table 4 and Figure 5

[0086] Table 4 Association analysis results of the natural population genetic polymorphic site and the thousand-grain weight

[0087]

[0088]

[0089] The verification results of the association analysis in Table 4 show that the difference of the two types of thousand-grain weight formed by the natural population of 120 hexaploid wheat in Table 3 reaches a significant level (P < 0.05). Among them, the thousand-grain weight of wheat of type I is higher than that of wheat of type II. In several environments, the thousand-grain weight of the wheat material of type I is 1.095, 0.544, 0.343, 0.309, 0.745, 0.54, 0.612, 0.514, 0.581, 0.783 grams higher than that of type II respectively. The research on the natural population shows that type I is an excellent genotype for improving the thousand-grain weight of wheat.

[0090] In conclusion, the present application discloses a SNP site related to the thousand-grain weight of wheat and application thereof. The present application finds that there is a SNP corresponding to the 783th position from the 5' end of SEQ ID NO: 1 by analyzing the genetic variation of the coding region of the natural variation population of wheat, and the SNP has two genotypes: genotype A (C) and genotype B (T). It is proved by association analysis that the size of the thousand-grain weight in the homozygous type of the two genotypes is: genotype A homozygous wheat > genotype B homozygous wheat. The present application also provides a dCAPS marker for detecting the SNP. Experiments prove that the wheat with higher thousand-grain weight can be found by detecting the SNP. The present application provides a new method for molecular marker assisted selection breeding of wheat, which has important significance in cultivating high-yield wheat varieties or research.

[0091] ​Obviously, the above embodiments of the present application are merely exemplary but not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, it is not necessary or possible to exhaust all the embodiments. Any modification, equivalent replacement and improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A SNP molecular marker associated with wheat 1000-grain weight, characterized in that: The molecular marker is located on chromosome 4A of the wheat genome and is a nucleotide sequence shown in SEQ ID NO:

1. The 783rd base of the nucleotide sequence is C or T.

2. The SNP molecular marker according to claim 1, characterized in that The SNP molecular marker has genotypes CC and TT.

3. A method for identifying wheat thousand-grain weight using the SNP molecular marker according to claim 1, characterized in that: The following steps are involved: The genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of the wheat to be identified is detected, and the thousand-grain weight of the wheat with the genotype CC is higher than that of the wheat with the genotype TT.

4. The method according to claim 3, characterized in that The method for detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the wheat genomic DNA to be identified is: (1) Using the wheat genomic DNA to be identified as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO: 2 to SEQ ID NO: 3; (2) diluting the PCR product of step (1) and performing PCR amplification using the primer pairs shown in SEQ ID NO: 4 to SEQ ID NO: 5; (3) The PCR product of step (2) is digested with XhoI to obtain digestion products; if the digestion products are two or smaller fragments: 94 bp, the genotype of the wheat to be tested at the site is CC; if the digestion products are one or larger fragments: 118 bp, the genotype of the wheat to be tested at the site is TT.

5. A primer combination for specifically amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The primer combination includes the sequences shown in SEQ ID NO: 2 to SEQ ID NO:

5.

6. Use of the SNP molecular marker according to claim 1 or 2 in breeding for wheat thousand-grain weight-related traits.

7. Use of the SNP molecular marker according to claim 1 or 2 in identifying or assisting in identifying wheat thousand-grain weight-related traits in breeding.

8. Use of the SNP molecular marker according to claim 1 or 2 in the preparation of a product for identifying or assisting in the identification of wheat thousand-grain weight-related traits.

Images