SNP (Single Nucleotide Polymorphism) molecular marker related to feed conversion rate of large white pigs and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the feed conversion rate of large white pigs and application thereof, and belongs to the technical field of molecular marker-assisted selection. According to the SNP molecular marker related to the feed conversion rate of the large white pigs disclosed by the invention, DNA samples of 5256 large white pigs are subjected to genetic typing by utilizing a Porcine 80K SNP high-density chip, and an SNP site remarkably related to the feed conversion rate of the pigs is finally screened out through genome-wide association analysis (GWAS). A site genome version of the SNP molecular marker corresponds to a 263045504 site on a No.1 chromosome of an Enmbl Sscrofa 11.1 reference genome, a polymorphic site of the SNP molecular marker is G or A, and when the genotype of the site is G / G, the pig has a relatively high feed utilization rate.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted selection, and more particularly to a SNP molecular marker associated with the feed conversion rate of Large White pigs and an application thereof. Background Art

[0002] Pork is one of the main sources of meat for humans. my country is not only a major pork producer, but also a major pork consumer. Pork has long dominated the meat consumption structure in my country. The continuous development of the economy and the upgrading of market consumption structure and consumer consumption habits have put forward higher requirements for the pig farming industry. The selection and breeding of excellent pig breeds with high reproductive capacity, fast growth rate and good meat quality has become the focus of modern breeding work. Early breeding work mainly focused on the phenotypes of individuals, siblings and offspring, and the disadvantages were low efficiency and slow progress. With the advancement of molecular biology, molecular marker-assisted selection has begun to be carried out in breeding work and gradually matured; compared with traditional breeding technology, molecular marker-assisted selection is less affected by environmental factors, has a short generation interval, and has a high breeding accuracy rate, which greatly accelerates the breeding process and improves breeding efficiency. On this basis, thanks to the rapid development of high-throughput sequencing technology and the completion of livestock and poultry related gene resequencing, a genome-wide association study (GWAS) method that uses single nucleotide polymorphisms (SNPs) as molecular markers and can screen SNPs related to the target phenotypic trait variation across the entire genome has been increasingly used in livestock and poultry breeding, and has achieved a series of remarkable results.

[0003] As one of the important growth traits of pigs, feed conversion ratio (FCR) reflects the efficiency of pigs in using nutrients in feed to maintain metabolism, promote muscle growth and fat deposition. It is directly related to the feed cost of breeding and is the key to whether the company can make a profit. Improving the feed efficiency of pigs is of great significance to the overall progress of the breeding industry. Based on this, screening out SNP sites related to feed conversion ratio is conducive to providing a theoretical basis and reference for subsequent pig breeding work.

[0004] Therefore, providing a SNP molecular marker related to the feed conversion rate of Large White pigs and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a SNP molecular marker related to the feed conversion rate of Large White pigs and its application. The present invention performs genotyping on the collected DNA of 5256 Large White pigs, and uses the GWAS method to further screen out SNP sites that are significantly correlated with the pig feed conversion rate trait, in order to provide a new molecular marker for the selection of the feed conversion rate trait of Large White pigs.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] By measuring and recording the feed conversion rate of 5256 large white pigs, the collected DNA was sequenced by Porcine 80K SNP high-density functional site chip, and the total number of SNPs on the chip was 187255 markers. After genotype quality control, the remaining 97476 markers and 5256 individuals were subjected to GWAS to screen out SNP sites significantly related to pig feed conversion efficiency. According to the Ensemble database Sus Scrofa 11.1 version reference genome, a significant SNP site was finally screened out, located at chr1:263045504, and the nucleotide sequence thereof is shown in SEQ ID NO.1. The SNP marker is located at the 101st position of the sequence, and the polymorphic sites are G or A respectively. The SNP marker screened by the present invention can be used as a molecular marker for pig feed conversion rate. For the chr1:263045504 site, a strain with a genotype of G / G should be selected for breeding.

[0008] ATTTAACCAAGTCCCAGTTCTGGCATCTTTCTATGCCATGGGAGCCTGGTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTCCCCAGCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACT CTTTTAGTTTCCACAATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACATAGCACAATGACTCTGGT; SEQ IDNO.1.

[0009] A SNP molecular marker associated with the feed conversion rate of Large White pigs. The SNP molecular marker is located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1, and its polymorphic site is G or A.

[0010] Furthermore, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID NO.1; the SNP molecular marker is located at the 101st position of the nucleotide sequence shown as SEQ ID NO.1.

[0011] Further, a primer for detecting the SNP molecular marker, the primer sequence is as follows:

[0012] Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO.2;

[0013] Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO.3.

[0014] Furthermore, the SNP molecular marker or the primer is used in detecting the feed conversion rate trait of pigs.

[0015] Furthermore, a strain with a genotype of G / G at the chr1:263045504 locus was selected for breeding, and the strain with a genotype of G / G had a high feed utilization rate.

[0016] Furthermore, the breed of the pig is Large White pig.

[0017] Furthermore, the SNP molecular marker or the primer is used in pig genetic breeding.

[0018] Furthermore, a kit for detecting the SNP molecular marker comprises the primers described in claim 3.

[0019] Furthermore, a method for improving pig breeds comprises the following steps: detecting the SNP molecular markers on pig chromosome 1, selecting strains with a genotype of G / G for breeding, thereby reducing the feed consumption of offspring pigs during the production process, improving feed conversion rate traits, and increasing feed utilization.

[0020] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a SNP molecular marker related to the feed conversion rate of large white pigs and its application. The DNA of 5256 large white pigs collected by the present invention is genotyped by Porcine 80KSNP high-density functional site chip, and a SNP site significantly related to the pig feed conversion rate trait is identified by whole genome association analysis, which is located at the 263045504 nucleotide site of chromosome 1. When the genotype of this site is G / G, the pig has a higher feed utilization rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0022] Figure 1 The attached figure shows the distribution of feed conversion rate phenotypes of the experimental group of Large White pigs; the abscissa is the phenotypic value of the experimental group;

[0023] Figure 2 The attached figure is a Manhattan plot of the genome-wide association analysis of the feed conversion rate trait; the present invention selects a SNP located at chr1:263045504 with a smaller P value on the threshold line for subsequent further analysis;

[0024] Figure 3 The attached figure is a Q-Qplot diagram of the genome-wide association analysis of feed conversion rate traits;

[0025] Figure 4 The attached figure shows the genotyping of the SNP sites screened by the present invention for 5256 Large White pigs; the ordinate in the figure is the phenotypic value of FCR, and the abscissa is the genotypes of the three groups GG, GA and AA. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1 Genotyping Detection

[0028] (1) Ear samples were collected from 5256 Large White pigs, DNA samples were extracted and genotyped using the Porcine 80K SNP high-density functional locus array, resulting in a total of 187,255 SNP loci.

[0029] (2) Plink v1.90 software was used to perform quality control on the genotype data. The quality control standards were as follows: SNP call rate > 90%, minimum allele frequency (MAF) > 0.01, mind < 0.1, geno < 0.1, and then the missing genotypes were filled according to the Beagle default parameters. The genotype files after filling were quality controlled again, and the standard was MAF > 0.01.

[0030] (3) After quality control, 5256 individuals and 97476 SNP loci were retained for subsequent GWAS studies of feed conversion efficiency traits.

[0031] Example 2 Genome-wide association analysis of SNP loci and feed conversion efficiency traits

[0032] (1) The feed conversion rate data of 5256 large white pigs were collected and recorded using the Aoshiben production performance measurement system. The distribution is as follows: Figure 1 As shown, feed conversion efficiency was used as a phenotype in GWAS analysis.

[0033] (2) The MLM model in the rMVP package was used for analysis, adding field and sex as fixed effects and the first three PCs as covariates. The specific model was: y = Xβ + Vα + Zμ + e, where y is the phenotypic value, β is the fixed effect, α is the SNP vector, μ is the random effect, X, V, and Z are the association matrices, and e is the residual vector.

[0034] (3) To improve the reliability of the experimental results, the present invention uses the Bonferroni method for correction and sets the genome significance level threshold to 0.05 / N (N is the number of markers, which is 97476 in the present invention). According to the results of GWAS, the P value of each SNP site is converted to -log 10 (P), the significant threshold line is based on the formula -log 10 (0.05 / N) is calculated, that is, the -log of each SNP site 10 When the (P) value is greater than or equal to 6.29, it indicates that there is a significant association between the SNP and the trait. Then, the Manhattan plot and QQ plot of the feed conversion rate trait are drawn using R packages such as qqman and CMplot in the R language ( Figure 2 , Figure 3 ).

[0035] (4) The present invention further screened out a variant site with a small P value located on pig chromosome 1 with accession number rs320361477 from the SNP sites on the significance threshold line. The differences in group phenotypic values ​​between different genotypes in the experimental group at this site and the distribution of the number of individuals with corresponding phenotypic values ​​are shown in the following figure: Figure 4 For the SNP loci finally screened, the lines with genotype G / G should be selected for breeding.

[0036] Example 3 Amplification and sequencing of target DNA sequences

[0037] (1) Primer design

[0038] For SEQ ID NO.1, the following primers were designed:

[0039] Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO.2;

[0040] Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO.3.

[0041] (2) PCR amplification:

[0042] PCR reaction system: Add 5 μl of Taq Mix, 0.3 μl of forward primer and reverse primer, 1 μl of DNA template, and ddH 2 The reaction conditions of PCR were as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 30 s, 35 cycles, and final extension at 72°C for 5 min.

[0043] (3) DNA sequence determination:

[0044] Finally, the products amplified by PCR are sequenced, and the gene fragment sequencing is required to be bidirectional.

[0045] The sequencing result is shown in SEQ ID NO.4:

[0046] ATTTAACCAAGTCCCAGTTCTGGCATCTTTCTATGCCATGGGAGCCTGGTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTCCCCARCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACT CTTTTAGTTTCCACAATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACATAGCACAATGACTCTGGT; SEQ IDNO.4.

[0047] Note: R in the sequence table is the mutation site G / A, and the primer sequences are shown in bold at the beginning and end of the sequence.

[0048] (4) The present invention provides a method for improving the feed conversion rate trait of pigs, comprising the following steps: detecting the SNP site at the 263045504 nucleotide on chromosome 1 of pigs, and selecting a strain with a genotype of G / G at the site for breeding, thereby reducing the feed consumption of large white pigs during the production process to improve feed utilization.

[0049] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker associated with feed conversion rate of Large White pigs, characterized in that: The SNP molecular marker is located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1, and its polymorphic site is G or A.

2. The SNP molecular marker associated with feed conversion rate of Large White pigs according to claim 1, characterized in that: The nucleotide sequence containing the SNP molecular marker is shown as SEQ ID NO.1; the SNP molecular marker is located at the 101st position of the nucleotide sequence shown as SEQ ID NO.

1.

3. A primer for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The primer sequences are as follows: Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO.2; Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO.

3.

4. Use of the SNP molecular marker according to any one of claims 1 to 2 or the primer according to claim 3 in detecting the feed conversion rate trait of pigs.

5. The use according to claim 4, characterized in that: The strains with the genotype of G / G at the chr1:263045504 locus were selected for breeding. The strains with the genotype of G / G had high feed utilization rate.

6. The use according to claim 4, characterized in that: The breed of the pig is Large White pig.

7. Use of the SNP molecular marker according to any one of claims 1 to 2 or the primer according to claim 3 in pig genetic breeding.

8. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the primer described in claim 3.

9. A method for improving pig breeds, characterized in that: The following steps are involved: Detect the SNP molecular marker as described in any one of claims 1-2 on pig chromosome 1, and select the strain with genotype G / G for breeding.

Images