SNP (Single Nucleotide Polymorphism) molecular marker related to litter size character of pig and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular markers, and discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the litter size character of pigs and application of the SNP molecular marker. The SNP molecular marker is located at a 34977540bp site of a chromosome 2 of an international pig reference genome Sscrofa11.1 version, and the nucleotide sequence of the site is G or A and is located in an exon region of an LUZP2 gene. The invention also discloses an application of the SNP molecular marker in breeding of the litter size character of the boar, and provides a method for breeding or auxiliary breeding of the boar with high / low litter size based on the marker. The invention also provides a specific primer for identifying the SNP site. By applying the technologies, accurate prediction and efficient screening of the litter size of the large white pigs can be achieved, the breeding efficiency of excellent breeding pigs is remarkably improved, and the population improvement process is accelerated. The invention also provides important technical support for sustainable development of pig raising industry, also provides theoretical basis for research in related fields, and is expected to promote further development of pig genetic improvement work.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology and molecular marker technology, and in particular to a SNP molecular marker related to pig litter size traits and an application thereof. Background Art

[0002] Large White Pig is an important meat pig breed in the global breeding industry, with excellent characteristics such as rapid growth, high lean meat rate, strong reproductive ability and wide adaptability. It has a large litter size, high piglet survival rate, good maternal instinct and strong adaptability under different climatic conditions. Large White Pig has delicate meat and evenly distributed fat. It is often used for hybridization and improvement with other breeds to improve the growth performance and reproductive ability of offspring. It is a key breed in breeding and meat production.

[0003] As a core indicator of reproductive performance, litter size directly affects breeding benefits. Molecular marker-assisted breeding can accurately locate genes or genetic loci associated with high litter size, accelerate the screening and promotion of excellent genotypes, shorten the breeding cycle, reduce breeding costs, and significantly improve reproductive efficiency. Therefore, it is of great significance to carry out molecular marker-assisted breeding based on litter size. By identifying individuals with excellent genetic characteristics in advance, it is not only possible to improve the production performance of the population, but also enhance genetic stability and promote the overall improvement of breeding benefits. Summary of the invention

[0004] In response to the above problems, the present invention proposes a SNP molecular marker related to the pig litter size trait and its application, which can be used for the selection or auxiliary selection of high-litter-size pigs. Through the application of this molecular marker, early screening of high-quality pig breeding can be achieved, effectively shortening the breeding cycle, improving breeding efficiency, and promoting genetic improvement and performance optimization of the population.

[0005] To solve the above problems, this application provides the following technical solutions: This study located a single nucleotide polymorphism (SNP) molecular marker significantly associated with litter size in Large White pigs at 34977540 bp on chromosome 2 of the pig reference genome Sscrofa11.1 for the first time. The site is located in the exon region of the LUZP2 gene, and the nucleotide sequence is G or A. The discovery of this molecular marker provides potential candidate gene support for improving the reproductive performance of Large White pigs.

[0006] The LUZP2 gene (Leucine Zipper Protein 2) encodes a protein that is synthesized during embryonic development and mainly expressed in the adult brain and spinal cord. Studies have shown that abnormal expression of the LUZP2 gene is closely related to complex syndromes such as tumor formation, abnormal reproductive organ development, and mental disorders. Based on its important role in maintaining body functions, this study identified the LUZP2 gene as a candidate gene that affects litter size in Large White pigs.

[0007] By identifying and utilizing this new SNP molecular marker located in the exon region of the LUZP2 gene, it is possible to assist in the screening of large white pig populations with high litter size. Rapid evaluation of individual genotypes helps optimize the reproductive potential of breeding pigs, significantly shorten the breeding cycle, and improve the efficiency of genetic improvement, thereby creating higher economic benefits for the breeding industry and providing the market with high-quality pork products.

[0008] In addition, this study provides the sequence information of 100 bp upstream and downstream of the SNP marker (total length 201 bp), and its detailed nucleotide sequence is recorded in the sequence table SEQ ID NO:1. The SNP site is located at the 101st base R of the sequence, showing a single base mutation of A>G. The sequence polymorphism caused by this mutation provides a molecular basis for evaluating pig litter performance and further promotes the improvement of pig breeding efficiency.

[0009] In the second aspect, the present application also provides the specific application of the above-mentioned SNP molecular markers related to the pig litter size trait in the selection of breeding pigs. Based on the significant correlation between the marker and the litter size trait, by detecting the genotype of this site, the pig litter performance can be analyzed and used for the screening and breeding of breeding pigs.

[0010] The use of this molecular marker will help to achieve accurate evaluation of reproductive performance in the selection of breeding pigs, and provide important technical support and theoretical basis for the breeding of Large White pigs.

[0011] In the third aspect, this patent further discloses a method for pig herd screening and strain breeding using SNP molecular markers related to pig litter size traits, which specifically includes the following contents: Screening and assisted breeding methods (1) Detect the SNP molecular marker at the 34977540 bp site on chromosome 2 of the pig genome, determine whether the base at the site is G or A, and determine the genotype of the target pig to be GG, AG or AA; (2) Select individuals with corresponding genotypes according to breeding objectives: If the goal is to increase litter size, individuals with genotypes of GG or GG and AG can be preferentially selected as breeding pigs, and individuals with genotypes of AA can be eliminated; If the goal is to select individuals with low litter size, pigs with genotype AA can be selected.

[0012] Methods for breeding high litter size pig strains (1) Detect SNP molecular markers related to litter size in reserve breeding pigs and determine their genotypes; (2) Select boars and sows with genotype GG or GA as breeding pigs and breed them; (3) Detect the SNP genotype of piglets born after mating, retain individuals with the genotype of GG or GA, and eliminate AA individuals, thereby breeding a high-reproductive pig breed with high piglet number.

[0013] Optional: The above method can be repeated for multiple generations in steps (2) and (3), continuously selecting breeding pigs with genotypes of GG or GA and eliminating AA individuals. As the number of breeding generations increases, the frequency of allele G in the pig herd gradually increases, further improving the reproductive capacity of future generations of pigs.

[0014] This method realizes efficient breeding pig screening and breeding of excellent strains based on molecular markers, providing technical support and practical approaches for improving the reproductive performance of pigs.

[0015] In the fourth aspect, the present application also provides a primer pair for identifying the above-mentioned SNP molecular markers related to the pig litter size trait and a related kit. The primer pair includes: an upstream primer 5'-AGTGAATCGACTGACAAGGGA-3' (SEQ ID NO: 2) and a downstream primer 5'-CCTTTCATGTGTTTCTCAGCCA-3' (SEQ ID NO: 3). In addition, the patent also provides a kit containing the above-mentioned primer pair for rapid detection of the SNP molecular marker, which is convenient for analyzing and screening target individuals related to pig reproductive performance.

[0016] In a fifth aspect, the present application also provides the use of the aforementioned primer pair or the aforementioned kit in screening or identifying SNP molecular markers related to pig litter size traits and breeding pigs with high litter size traits.

[0017] In a sixth aspect, the present application also provides a method for obtaining a SNP molecular marker related to the total litter size of Large White pigs, the method for obtaining the SNP molecular marker is as follows: (1) In order to eliminate the impact of possible problems during the delivery process of primiparous sows on the total number of piglets born, the total number of piglets born in the second litter of the test group and its related data were counted, including various influencing factors such as the field, year, season, and birthing age, which were used as covariates; the phenotypic data were quality controlled and analyzed by eliminating outliers with a piglet number of 0; (2) Collect pig tissue samples, extract genomic DNA and test its quality, perform genotyping and perform quality control on genotyping data; The quality control method is as follows: first, extract the data information of chromosomes 1 to 18, first filter out the SNP sites with a SNP missing rate higher than 5%, then filter out individuals with a missing rate higher than 5%, remove sites with a minimum gene frequency (MAF) less than 0.01, and finally perform a Hardy-Weinberg equilibrium (HWE) test on each SNP, and remove sites with a p-value less than 10. -6 SNP sites.

[0018] (3) Then, the kinship matrix and the event, year, season, and calving age were used as covariates in the whole genome association analysis using the gemma software, with a P<10 -4 is the significance threshold.

[0019] The SNP molecular marker related to the aforementioned pig litter size trait was screened by the above method. The site is located at the nucleic acid site at the 34977540bp site of chromosome 2, which is an A>G base mutation.

[0020] The present invention has the following advantages and innovations: 1. Through genome-wide association analysis (GWAS), a SNP site (g. 34977540 A>G) significantly associated with the litter size of Large White pigs was identified for the first time in the LUZP2 gene. Studies have shown that the genotype of this site is highly correlated with the litter size trait, among which the GG genotype has the highest litter size, followed by the GA genotype, and the AA type has the lowest. This site can be used as a genetic marker to assist in molecular marker-assisted breeding and genetic improvement of the high litter size trait of Large White pigs.

[0021] 2. For the above SNP sites, the present invention designs a molecular marker identification primer and kit, and develops an efficient molecular marker-assisted breeding method. Through this method, it is possible to quickly screen high-reproductive-performance breeding pigs, accelerate the breeding process, and improve the reproductive capacity of offspring. This technology has significant economic value and application potential.

[0022] 3. The genotype detection technology based on gene chips performs well in non-diagnostic evaluation. Compared with the traditional PCR-RFLP technology, gene chip detection is simpler, more efficient, and has higher sensitivity and specificity, providing a convenient and reliable tool for improving the breeding efficiency of large white pigs.

[0023] 4. The present invention also established a GWAS-based SNP molecular marker screening method, and further clarified its relationship with the reproductive performance of Large White Pigs through functional verification. The screened SNP sites are accurate and comprehensive, significantly improving the efficiency of genetic improvement and accelerating the improvement of Large White Pigs' reproductive performance. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the Manhattan plot of the whole genome association analysis of the present invention. The red mark is the SNP molecular marker screened by the present invention, and the marker is located on chromosome 2 of the Large White pig; Figure 2 QQ plot of genome-wide association analysis of litter size in Large White pigs; Figure 3 This is the SNP density distribution map used in the whole gene association analysis of litter size in Large White pigs; Figure 4 This is the PCA graph involving 1000 Large White pig genomes; Figure 5 This is the distribution diagram of total litter size traits of individuals with different genotypes related to litter size in Large White pigs. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0026] Example 1 Screening of SNP molecular markers related to litter size in Large White pigs 1. Statistical analysis of the test population and phenotypic data In order to eliminate the impact of possible problems during the delivery of primiparous sows on the total number of piglets, the total number of piglets born in the second litter of the test group and its related data were counted. The test group of Large White pigs from a large breeding farm in China was selected, with a group sample size of 1,000 pigs. The number of piglets born was weighed and recorded immediately after birth, and the environmental factors (influencing factors) affecting the number of piglets were also recorded, including the number of farms, years, seasons, and birthing age.

[0027] The phenotypic data were subjected to quality control analysis, and the outliers with a litter size of 0 were eliminated, and finally 961 litter size records were retained. The average litter size of the Large White pig group used in this example was 13.27±3.679, with a minimum of 2 and a maximum of 24.

[0028] 2. Data acquisition and quality control Large white pig tissue samples were collected for DNA extraction. The extracted DNA was genotyped using the "SMIC-1" pig 50K SNP chip, and a total of about 56,000 SNP sites were obtained for subsequent genome-wide association studies (GWAS).

[0029] First, vcftools-0.1.16 was used to extract data information of chromosomes 1 to 18. Then, PLINK v1.9 was used to perform quality control on the genotype data. SNP sites with SNP missing rates higher than 5% were first filtered out. Then, individuals with missing rates higher than 5% were filtered out. Sites with a minimum allele frequency (MAF) less than 0.01 were removed. Finally, each SNP was tested for Hardy-Weinberg equilibrium (HWE), and sites with p values ​​less than 10 were removed. -6 SNP sites.

[0030] 4. Genome-wide association analysis In this example, a mixed linear model was used for analysis, and the group kinship matrix and the significant influencing factors of litter size (including field, year, season and birth age) were used as covariates to participate in the analysis, and SNP loci significantly associated with the litter size of Large White pigs were screened (the results are shown in Figure 1 ) After analysis, a total of 6 SNP loci significantly associated with the litter size of Large White pigs were obtained (see Table 2 for details). According to the pig reference genome (Sscrofa11.1 assembly) information, the LUZP2 gene was further located as a candidate gene.

[0031] Among them, CNC10020728 is a candidate marker related to litter size. The marker is located at 34977540 bp on chromosome 2 and mutates from adenine A to guanine G, expressed as g. 34977540 A>G.

[0032] Table 2 SNP markers and candidate genes related to litter size in Large White pigs Marker site chromosome Site information (bp) Allele P-value Genes within the locus CNC10061439 6 68230725 G / A 1.11E-05 CAMTA1 CNCB10004570 6 69062870 A / G 2.71E-05 CNC10061440 6 68267328 T / C 3.24E-05 CAMTA1 CNC10032538 3 129637449 C / T 5.97E-05 CNC10020728 2 34977540 A / G 7.65E-05 LUZP2 CNCB10005022 6 150297695 C / T 9.33E-05 PATJ 6. Molecular marker application and verification To further analyze the relationship between different genotypes (AA, AG, GG) of the candidate marker site g.34977540A>G and the litter size of Large White pigs, analysis of variance (ANOVA) was used to evaluate the second litter size of 961 Large White pigs, and the Tukey HSD test was used to compare the significance of the differences between different genotypes (see Table 3 for details). In addition, the R package ggplot2 was used to draw violin plots to intuitively display the distribution of litter size of different genotypes, and significant markers were added to highlight the differences (as shown in Figure 5).

[0033] Table 3 Analysis of the difference in litter size between different genotypes of molecular marker g. 34977540 A>G in Large White pigs genotype Number of individuals Genotype frequency (%) Number of litters (head) Multiple comparison results GG 247 41.31 14.1± 3.39 GG vs. AA: *** GA 445 46.99 13.2± 3.73 GG vs. GA: * AA 269 11.70 12.7± 3.73 GA vs. AA: * Note: ** indicates that the litter size between different genotypes is extremely significantly different (P ≤ 0.01); * indicates that the litter size between different genotypes is significantly different (P ≤ 0.05).

[0034] The analysis results showed that the marker site g.34977540 A>G was significantly correlated with the litter size of Large White pigs, among which the litter size of individuals with the GG genotype was 14.1 ± 3.39 pigs, which was significantly higher than that of the GA genotype (13.2 ± 3.73 pigs) and extremely significantly higher than that of the AA genotype (12.7 ± 3.73 pigs). The site is located at the 34977540 bp position of chromosome 2, and mutated from adenine (A) to guanine (G), corresponding to the 101st nucleotide of the nucleic acid sequence table SEQ ID NO:1. The sequence table SEQ ID NO:1 provides a nucleotide sequence of 100 bp upstream and downstream, totaling 201 bp, in which the A / G allele mutation at the 101st base causes the polymorphism of the sequence. As a SNP molecular marker CNC10020728 closely related to the total litter size of Large White pigs, this site can be used for molecular marker-assisted selection, among which GG genotype individuals are suitable as preferred objects for further selection or breeding to improve the reproductive performance of Large White pigs.

[0035] Example 2 Design of primers for identifying SNP molecular markers associated with litter size in Large White pigs and application of the primers In this example, upstream and downstream primers are designed for the detection of the nucleic acid site G / A at the 34977540 bp position of chromosome 2 of the SNP site obtained in Example 1.

[0036] 1. Primer design of target gene sequence According to the target gene sequence, the optimized amplification primers were designed using primer design software. The primer pair sequences are as follows: Upstream primer: 5'- AGTGAATCGACTGACAAGGGA -3' (such as SEQ ID NO: 2) Downstream primer: 5'-CCTTTCATGTGTTTCTCAGCCA -3' (such as SEQ ID NO: 3) 2. Large White Pig Genome Extraction Tissue samples of Large White pigs to be tested were collected, genomic DNA was extracted, and after quality and concentration testing, they were stored at -20°C for future use.

[0037] 3. PCR amplification of SNP loci related to litter size in Large White pigs The extracted DNA was used as a template and PCR amplification was performed using the above primers.

[0038] Amplification system: 10 μL of 2× SuperReal PreMix Plus, 8 μL of ddH2O, 0.5 μL of upstream and downstream primers (10 μM concentration), and 1 μL of cDNA template.

[0039] Amplification Procedure: Pre-denaturation at 95°C for 15 min; Denaturation at 95°C for 20 seconds; annealing at 58°C for 20 seconds; extension at 72°C for 20 seconds; perform 40 cycles.

[0040] Finally, extension was performed at 72°C for 5 min.

[0041] After amplification, the temperature was maintained at 4°C to preserve the product and terminate the reaction.

[0042] 4. Sequencing and analysis of amplified products The PCR product was detected by agarose gel electrophoresis, and the amplified product was sent for sequencing, and the sequence of the amplified product was obtained by sequencing, as shown in SEQ ID NO: 3. The sequencing result of the amplified product was compared and analyzed with the relevant gene fragment of Large White Pig in GenBank (as shown in SEQ ID NO: 1), and the genotype of the target SNP site related to the litter size of the sequence was determined to be GG, AG or AA.

[0043] According to the above results, large white pigs with more or less litter sizes are selected. If large white pigs with more litter sizes are selected, large white pigs with GG and AG genotypes are selected; if small white pigs are selected, large white pigs with AA genotypes are selected.

[0044] Those skilled in the art can design other primers for amplifying the molecular marker or probes for identifying the molecular marker according to the molecular genetic marker of the present invention, so as to detect the genetic marker, for example, by PCR amplification to obtain the molecular genetic marker, and then by cloning and sequencing to obtain the corresponding sequence, or by Bsm-RFLP polymorphism for detection. Therefore, the present invention also includes primers for amplifying the molecular genetic marker or probes for identifying the molecular genetic marker, and a kit containing the primers or probes.

[0045] Example 3 Application of the molecular genetic markers of the present application in Large White pig breeding This embodiment provides a method for applying the molecular genetic marker of the present application to Large White pig breeding or assisted breeding, and the specific steps are as follows: 1) Extract genomic DNA from Large White pigs, detect the deoxynucleotide at position 34977540 of chromosome 2, and determine whether the deoxynucleotide at this position is A or G; 2) According to the genotype of the locus (AA type, AG type or GG type), select the genotype that meets the breeding needs for the next step of seed selection and / or breeding.

[0046] Specifically, if the goal is to breed large white pigs with high litter size, AA-type large white sows will be eliminated and GG-type large white sows will be retained to increase the frequency of allele G from generation to generation. Studies have shown that the total litter size of GG-type large white pigs is higher than that of AA-type, and each GG-type large white pig produces 1.4 more piglets than AA-type. Assuming that there are 10,000 breeding large white sows, and 14,000 piglets are added per litter, these piglets can provide an additional 1,190 tons of large white pork after fattening, based on an estimated slaughter rate of 85%. Therefore, the molecular genetic markers of this application have good application prospects and industrial value in large white pig breeding.

[0047] Example 4 A method for genetic improvement of large white pigs with high litter size trait This embodiment provides a method for genetic improvement of large white pigs with high litter size traits, and the specific steps are as follows: 1) Performing SNP molecular marker detection related to litter size traits on reserve breeding pigs, extracting genomic DNA, and performing detection using the primers and methods of the aforementioned Example 2; 2) Select individuals with genotype GG or GA as breeding pigs, and breed the breeding boars and sows; 3) Conduct SNP molecular marker testing on piglets born after mating, retain individuals with genotype GG or GA, and eliminate individuals with genotype AA, so as to cultivate high-reproductive pig strains with high reproductive performance.

[0048] Furthermore, steps (2) and (3) can be repeated on the basis of step (3), so as to select breeding pigs with genotype GG or GA from generation to generation, eliminate individuals with genotype AA, and gradually increase the frequency of allele G at the SNP site in the pig population, thereby increasing the litter size of the next generation of pigs.

[0049] The present invention can be equivalently replaced or changed according to the technical solution, and all these modifications or replacements should fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with pig litter size, the SNP site is located at 34977540 bp of chromosome 2 of the international pig reference genome Sscrofa11.1 version, the base type of the nucleotide variation site is G or A, and the site is located in the exon region of the LUZP2 gene.

2. The SNP molecular marker associated with pig litter size trait according to claim 1, characterized in that: A 100 bp gene fragment upstream and downstream of the SNP site was taken as the upstream and downstream sequences showing its characteristics. The nucleotide sequence of the upstream and downstream sequences is shown in the sequence table SEQ ID NO:

1. The SNP molecular marker site is located at the 101st site R of the sequence, with a single base mutation of A>G.

3. Use of the SNP molecular marker associated with pig litter size trait according to claim 1 in breeding of pig litter size trait.

4. A method for breeding / assisted breeding of pigs with more / fewer litters using the SNP molecular markers associated with the pig litter size trait as claimed in claim 1, characterized in that: A method for selecting or assisting in the selection of high / low litter size pigs using the SNP molecular markers associated with the pig litter size trait according to claim 1, characterized in that it comprises the following steps: 1) Detect the SNP molecular marker at the 34977540 bp site of chromosome 2 of the pig genome, determine whether the base at the site is G or A, and thus determine whether the genotype of the Large White pig to be tested is GG, AG or AA; 2) Based on the breeding objectives, select Large White pigs with corresponding genotypes for subsequent selection and / or breeding operations.

5. The method according to claim 4, characterized in that: To select pigs with high litter size, in step 2), select individuals with genotype GG or genotype GG and / or AG as breeding pigs, and eliminate individuals with genotype AA; Optionally, if pigs with low litter size are screened, individuals whose allele type detected in step 1) is AA are selected.

6. The use of the SNP molecular marker according to claim 1 in breeding high litter size pig strains, characterized in that: The application comprises the following steps: (1) Detecting the SNP molecular markers related to the pig litter size trait as described in claim 1 in reserve breeding pigs; (2) Selecting individuals with the GG or GA genotype detected in step (1) as breeding pigs, and mating the breeding boars and sows; (3) detecting the SNP molecular marker as described in claim 1 in the piglets born from mating in step (2), retaining the individuals with the genotype of GG or GA at the site, eliminating the individuals with the genotype of AA, and breeding a pig strain with high reproductive performance and high litter size; Optionally, the method further comprises: repeating the operations of steps (2) to (3) with the individuals bred in step (3), thereby selecting breeding pig individuals with molecular marker genotypes of GG or AG in the offspring, and eliminating individuals with AA genotype, so as to increase the frequency of allele G in the offspring pig population generation by generation and increase the litter size of the offspring pigs.

7. A primer pair for identifying the SNP molecular marker associated with pig litter size as claimed in claim 1, characterized in that: The primer pair comprises an upstream primer 5'-AGTGAATCGACTGACAAGGGA-3 and a downstream primer CCTTTCATGTGTTTCTCAGCCA-3', and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

8. A kit for detecting the SNP molecular marker according to claim 1, wherein: The kit contains the primer pair according to claim 7.

9. Use of the primer pair according to claim 7 or the kit according to claim 8 in screening or identifying SNP molecular markers related to pig litter size traits and breeding pigs with high litter size traits.

Images