351 results about "Sequence alignment" patented technology

The invention relates to a high-yield lipase strain and application thereof, and belongs to the technical field of bioengineering. According to the invention, grease-rich samples from different sources are subjected to enrichment treatment, a strain with lipase activity reaching 80.8 + / -1.8 U / mL is obtained through neutral red grease plate screening, the strain is identified as Burkholderia cepacia OCRI-Lip100 through sequencing and sequence comparison, the Burkholderia cepacia OCRI-Lip100 is named as Burkholderia cepacia OCRI-Lip100, and the Burkholderia cepacia OCRI-Lip100 is preserved in China Center for Type Culture Collection on July 3, 2024 with a preservation number of CCTCC M20241369. Lipase obtained by fermentation of the strain is sequenced, enzymatic properties, catalytic activity and substrate preference of the lipase are studied, the optimum catalytic temperature is 60 DEG C, the specific enzyme activity is higher than that of commercial lipase, the catalytic activity is further improved to 116 + / -0.5 U / mL when a C14 substrate is catalyzed, and triglyceride can be hydrolyzed into diglyceride. The strain provided by the invention and the lipase produced by the strain enrich the resource library of the existing lipase, and provide a basis for improving the industrial application of the lipase and realizing the high utilization rate of resources.

The invention provides a genetic disease gene detection data analysis method and system based on big data, and relates to the technical field of gene detection data analys.The genetic disease gene detection data analysis method comprises the steps that quality control and duplicate removal are conducted on gene sequencing original data, sequence comparison and variation detection are conducted, and a standard variation detection report is generated; performing multi-scale feature sampling and optimization by using an improved random field diffusion model, inputting high-dimensional feature distribution into a dual self-activation iterative network for feature extraction and integration to obtain a feature mapping matrix and a feature evolution trajectory, and inputting the feature mapping matrix and the feature evolution trajectory into an integrated predictor to obtain an integrated predictor; and in combination with Gaussian mixture process regression analysis and an improved Bayesian reasoning network, establishing a risk association network and training a deep hierarchical decision tree, and outputting a multi-dimensional risk assessment report.

The invention discloses a silver carp 20K liquid phase chip and application thereof, the liquid phase chip comprises a probe combination of 20,909 SNP molecular markers covering a whole genome, the physical positions of the 20,909 SNP molecular markers are determined based on sequence alignment of the silver carp genome (GCA041475455.1), and the site information of the 20,909 SNP molecular markers is shown in the specification table 1. The invention provides a silver carp first type whole genome SNP liquid phase breeding chip, which effectively reduces the application cost of silver carp in genetic diversity analysis, QTL positioning, GWAS analysis and the like in scientific research, solves the problem that no applicable product exists in silver carp molecular auxiliary breeding and whole genome selective breeding, accelerates the progress of silver carp basic research and breeding, and has a wide application prospect. The method is of great significance in improving the utilization efficiency of silver carp germplasm resources, accelerating the breeding process of excellent characters and improving the economic value and environmental adaptability of bred varieties.

The invention belongs to the technical field of biological probiotic screening, and particularly relates to a probiotic screening method based on a convolutional neural network, which comprises the following steps: reading an original probiotic related DNA sequence file, matching the DNA sequence file by adopting a regular expression, removing all non-ATCG base characters to obtain a normalized DNA sequence, and screening the normalized DNA sequence; segmenting the screened DNA sequence by adopting a sliding window method to generate a k-mer fragment set; constructing a k-mer frequency vector according to the occurrence frequency of each k-mer fragment in the sequence; performing normalization processing on the k-mer frequency vector; inputting the k-mer frequency vector after normalization processing into the trained convolutional neural network to obtain a DNA sequence classification result; determining whether a strain corresponding to the sequence is a probiotic or not according to a DNA sequence classification result; according to the method, the k-mer frequency characteristics are extracted by adopting the sliding window, and the calculation complexity of a traditional sequence alignment method is reduced from O (n2) to O (n), so that the consumption of calculation resources is reduced.

The invention discloses an electric power infrastructure line operation behavior intelligent identification method, and belongs to the technical field of mode identification and data processing, and the method comprises the steps: constructing a heterogeneous space-time scene map, and carrying out the multi-modal structural perception of an operation site; segmenting the continuous behavior flow into behavior primitives in an unsupervised manner, and encoding the behavior primitives into observation sequences; analyzing the security operation regulations offline and compiling the security operation regulations into normal form behavior genomes; performing local sequence alignment on the observation sequence and the normal form genome to quantify behavior deviation; and identifying a jump critical point of the risk state based on the deviation disturbance and generating a structured early warning event. According to the method, a heterogeneous space-time scene map is constructed to fuse multi-modal perception data, an actual operation behavior is abstracted into an observation behavior primitive sequence, and the observation behavior primitive sequence and a normal form behavior genome compiled from a safety regulation are subjected to sequence alignment, so that behavior deviation can be quantified, a jump critical point of a risk state can be identified, and the accuracy of the risk state is improved. And accurate and foresight intelligent identification and early warning of operation behaviors are realized.

Compressing files is disclosed. An input file to be compressed is first aligned. Aligning the file includes splitting the file into sequences that can be aligned. When splitting the file into sequences or when performing subsequent recursive splitting, the splitting is based on a longest sequence match. The result is a compression matrix, where each row of the matrix corresponds to part of the file. A consensus sequence is determined from the compression matrix. Using the consensus sequence, pointer pairs are generated. Each pointer pair identifies a subsequence of the consensus matrix. The compressed file includes the pointer pairs and the consensus sequence.

The invention discloses a low-abundance pathogen detection method and system based on metagenome sequencing data, and belongs to the technical field of bioinformatics. The system comprises a species specificity sequence screening module (BactAlert2SSRs), a reference genome database construction module (BactAlert2Lib), a sequence alignment reference genome module (BactAlert2Map), a sequence alignment result analysis module (BactAlert2ID), and an SSRs posterior probability correction module (BactAlert2Rec). The detection system realizes efficient, accurate and reliable detection of low-abundance pathogens, and is suitable for analyzing third-generation metagenome sequencing data.

The invention relates to the technical field of molecular detection, and particularly discloses a liquid chip for identifying opisthopapus taihangensis and Hebei province as well as a preparation method and application of the liquid chip. Genotyping sites of the liquid chip comprise 1140 SNP sites; the physical positions of the 1140 SNP loci are determined based on comparison of a whole genome sequence of a bovine reference genome, and the version number of the whole genome sequence of the bovine reference genome is ARSUCD 1.2; wherein the physical position information of the 1140 SNP loci is as shown in a table 1. The liquid chip can realize genetic typing of the opisthopapus taihangensis and the Hebei province cattle, has the advantage of high detection rate, and can obviously cluster the opisthopapus taihangensis and the Hebei province cattle into two classes when clustering analysis is carried out on the opisthopapus taihangensis and the Hebei province cattle, so that a marker combination of the liquid chip can represent whole genome re-sequencing genes, assists in distinguishing the opisthopapus taihangensis and the Hebei province cattle, and is high in accuracy and high in accuracy. Therefore, the variety identification of the opisthopapus taihangensis and the Hebei Hebei is realized.

The application discloses a kind of electric power infrastructure line operation behavior intelligent identification method, belong to pattern recognition and data processing technical field, it includes constructing heterogeneous space-time scene atlas to carry out multi-modal structured perception to operation site;Continuous behavior flow is unsupervised and is divided into behavior base element and is encoded as observation sequence;Offline analysis safety operation regulation and is compiled as paradigm behavior genome;Observation sequence and paradigm genome are locally sequenced to be aligned to quantify behavior deviation;The jump critical point of risk state is identified based on deviation disturbance, and structured early warning event is generated.The application constructs heterogeneous space-time scene atlas to fuse multi-modal perception data, abstracts actual operation behavior as observation behavior base element sequence, and carries out sequence alignment with paradigm behavior genome compiled from safety regulation, can quantify behavior deviation and identify the jump critical point of risk state, realize accurate, forward-looking intelligent identification and early warning to operation behavior.

The invention provides a protein language model pre-training and protein mutation method and related products. According to one specific embodiment of the protein language model pre-training method, a sample protein data set is obtained; generating a multi-sequence alignment probability distribution sequence corresponding to the sample protein data according to the amino acid residue probability distribution of multiple sequences in each sample protein data alignment at each site; the sample protein sequence in each sample protein data and the corresponding multi-sequence comparison probability distribution sequence and structure sequence are sequentially connected in series in the forward direction or the reverse direction, and a multi-modal sequence corresponding to the corresponding sample protein data is generated; and finally, performing autoregression pre-training on the protein language model based on the multi-modal sequence corresponding to each sample protein data to obtain a pre-trained protein language model. Namely, the prediction performance of the model is improved by introducing a multi-sequence comparison probability distribution sequence as an independent intermediate reasoning mode and thinking chains in two directions.

The invention discloses a method, a system and equipment for detecting internal tandem repeat and a storage medium, and the key points of the technical scheme are as follows: obtaining a first reference sequence according to at least one target exon sequence corresponding to a protooncogene, and obtaining a second reference sequence according to at least one target intron sequence corresponding to the protooncogene; comparing the sequencing data of the to-be-detected sample to the second reference sequence to obtain a first comparison result, extracting an uncompared sequence from the sequencing data according to the first comparison result, and comparing the uncompared sequence to the first reference sequence to obtain a second comparison result; and determining a first detection result according to the second comparison result and a first reference sequence, and performing false positive filtering on the first detection result to obtain a second detection result. According to the invention, false positive can be reduced so as to ensure the accuracy and reliability of subsequent analysis.

The invention relates to a probe design of a high-throughput single cell space transcriptome based on multi-round imaging coding. The invention provides a design method of a readout probe for a high-throughput single-cell space transcriptome, which is simultaneously suitable for more than two species tissues, and comprises the following steps: generating a candidate DNA sequence library with a sequence length of n, filtering out a sequence capable of being compared to a genome of a target species, filtering out a candidate DNA probe containing a short sequence appearing on the genome for more than one time, and obtaining a read-out probe for the high-throughput single-cell space transcriptome. The method comprises the steps of filtering candidate DNA probes capable of being compared to transcriptomes of target species through local BLAST, repeating the steps S20-S40 for all target species, performing probe internal mutual binding screening through the local BLAST, performing probe secondary structure inspection and probe internal mutual binding inspection through two-sequence comparison, performing online BLAST inspection on the probes, and determining the target species according to the BLAST. The final DNA probe sequence is obtained.

The invention discloses a molecular marker combination for analyzing goat varieties and application, relates to the technical field of biology, and provides 13947 molecular markers capable of analyzing goats, and the physical position information of the molecular markers is determined based on genome sequence comparison of a goat reference genome ARS1.2. A molecular probe combination, a gene chip and a kit prepared from 13947 SNP molecular markers can be used for carrying out genetic evaluation on goat individuals, carrying out individual selection on goat varieties which are difficult to determine in the early stage, shortening the generation interval and accelerating the breeding process, so that a large amount of breeding cost is saved.

Provided are a Medicago sativa SNP molecular marker combination and a use thereof. The SNP molecular marker combination consists of 61351 SNP molecular markers. The physical positions of the 61351 SNP molecular markers are determined by sequence alignment on the basis of the Medicago sativa reference genome ZM-4 alfalfa genome. The SNP molecular markers have good site specificity, strong versatility, and high polymorphism and can effectively discriminate Medicago sativa germplasms from different sources. A Medicago sativa genome-wide liquid-phase gene chip is prepared from the SNP molecular markers, and can be used for genetic diversity assessment of Medicago sativa germplasm resources, genetic map construction and functional gene mapping, genome-wide association study, etc., providing an important tool and technical support for Medicago sativa molecular design breeding and variety authenticity identification, and achieving important significance for high-quality development of the alfalfa seed industry in China.

The present invention discloses a SNP molecular marker combination of poplar, a whole-genome liquid chip prepared therefrom, and applications thereof. The SNP molecular marker combination of poplar includes 60,944 SNP molecular markers, and the physical positions of the 60,944 SNP molecular markers are determined by sequence alignment based on the poplar reference genome GCA_015852605.2. The SNP molecular markers of poplar in the present invention can be used for specific identification of five major sections of poplar species. Using the SNP molecular markers of poplar to prepare a whole-genome liquid chip for poplar tree species can achieve efficient, accurate genotyping detection of low-cost poplar germplasm resource populations, and is specific to the sections of Populus, such as Leuce, Aigeiros, Tacamahaca, Leucoides, and Turanga, and has important application values in multiple fields of poplar biological breeding.

The invention provides a disease marker epitope prediction and antibody screening method, which belongs to the technical field of disease markers, and comprises the following steps: firstly, establishing a training data set containing a known antigen-antibody compound structure and disease tissue expression data; and obtaining target protein sequence information through liquid chromatography-mass spectrometry analysis and carrying out sequence comparison. And then a deep convolutional neural network is utilized to extract sequence features, and surface exposure sites are identified by combining secondary structure prediction and solvent accessibility analysis. After the features are integrated with sequence evolution conservative properties, a prediction model is constructed by using a random forest classifier. The method comprises the following steps: carrying out molecular dynamics simulation on a prediction result, screening first 10% of candidate sequences through a comprehensive scoring function and K-means clustering, and finally determining an antigen epitope sequence with the strongest binding activity through verification of an antigen chip and a fluorescence labeled antibody system, so that the technical problem that specific antigen epitopes are difficult to accurately predict and recognize in the prior art is solved.

The invention belongs to the technical field of bioinformatics, and particularly relates to a method for screening cross-species HGT. The method comprises the steps of constructing a background database, inferring a homologous group, constructing a gene phylogenetic tree, inferring HGT based on the gene tree, inferring verification of candidate HGTs based on the gene tree, distributing the HGTs to a timeline and the like. According to the method, high-throughput and automatic screening of HGT events in a large number of gene datasets is realized by integrating a plurality of steps of phylogenetic analysis, sequence alignment, gene function annotation, statistical verification and the like. The method disclosed by the invention is particularly suitable for the HGT research of an ultra-long time length and an ultra-long evolution distance crossing a biological boundary, and an important scientific tool can be provided for understanding gene flow and function enhancement in a biological evolution process.

The invention relates to the technical field of molecular detection, and particularly discloses a saline-alkaline tolerant soybean liquid phase chip and a design method and application thereof, and genetic typing sites of the saline-alkaline tolerant soybean liquid phase chip comprise 232 SNP sites and 2 Indel sites; the physical positions of the 232 SNP loci and the two Indel loci are determined based on the comparison of the whole genome sequence of the soybean reference genome, and the version number of the whole genome sequence of the soybean reference genome is Glycine max Wm82. A2. V1; wherein the 232 SNP loci and the 2 Indel loci are as shown in a table 1. The screened 232 SNP loci and 2 Indel loci can realize genetic typing of the saline-alkaline tolerant soybeans so as to realize saline-alkaline tolerant character identification of the soybeans, and can be used for soybean molecule assisted breeding to breed the saline-alkaline tolerant soybeans.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to disease resistance of ricefield eel and application of the SNP molecular marker, and relates to the technical field of molecular biology. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.3, and SNP sites, namely G / A mutation and A / C mutation, exist at the 143rd and 413th basic groups of the SNP molecular marker. According to the invention, SNP loci in LamR genes in a ricefield eel group are screened out through sequence alignment, and genotyping is carried out on the SNP loci; and comparing the differences of the disease resistance of the genotypes, and screening to obtain the genotype with the strongest disease resistance, thereby providing an effective molecular marker for detecting the disease resistance of the ricefield eel. The SNP molecular marker provided by the invention is associated with the disease resistance of the ricefield eel, and provides effective technical support for breeding of disease-resistant ricefield eel varieties.

A protein multi-conformation prediction method based on flexible residue probability distribution comprises the following steps: firstly, expanding a self-constructed protein data set by utilizing an ATLAS molecular dynamics simulation database so as to enhance the capturing capability of a model on protein dynamic information; secondly, extracting multi-sequence comparison features and structural features of the protein, and inputting the features into a deep learning network based on a residual network module for training; on this basis, a protein flexible residue probability graph is further generated, dynamic behaviors and conformation change information of the protein are fully mined, then the flexible residue probability graph is used for guiding multi-sequence alignment MSA mask operation, MSA of masks in different areas at different depths is constructed and input into an AlphaFold2 model, and finally the protein multi-conformation structure is generated. According to the method, the efficiency and precision of protein multi-conformation prediction are remarkably improved, and a more efficient and accurate solution is provided for protein multi-conformation prediction.

The invention relates to an eDNA method for identifying bumblebee honeycombs in permafrost regions of Qinghai-Tibet Plateau. The eDNA method comprises the following steps: S1, positioning observation sample belts and arranging sampling points on the basis of multi-source data in combination with a Bayesian hierarchical model; s2, performing deep freezing and complete excavation on matrixes around and inside all the sampling points; s3, stratified sampling and anti-degradation treatment are carried out, and a spatial attribute database is established; s4, extracting and purifying eDNA (enhanced deoxyribonucleic acid); s5, determining a nest host based on PCR amplification, high-throughput sequencing and sequence comparative analysis; and S6, constructing a Bayesian hierarchical model in combination with biological information, and judging honeycomb characteristics. The method is simple, rapid and low in cost, not only is suitable for Qinghai-Tibet Plateau permafrost regions, has the core advantages of non-destructiveness and high sensitivity, but also is also suitable for underground insect nest identification research in other environment sensitive regions or regions difficult to physically explore in principle, and has wide application prospects. The method is especially suitable for monitoring rare, secret or difficult-to-approach organisms.

The invention relates to a KASP molecular marker of a wheat quality related gene TaSF3B4 and application of the KASP molecular marker. The KASP molecular marker is KASP-TaSF3B4, and an SNP (Single Nucleotide Polymorphism) site (A / G) is detected at 248421161bp of a wheat 3B chromosome, namely, the distance between a TaSF3B4 promoter region and an initiation codon is 1127bp. According to the marker, a TaSF3B4 gene influencing the wheat quality character is obtained according to a way that differentially expressed genes in 15d transcriptome data of a grain extreme material are extremely remarkably enriched to a spliceosome, and regular SNP loci exist through sequence comparison and analysis of the TaSF3B4 genes in different varieties and upstream and downstream sequences of the TaSF3B4 genes. The functional KASP molecular marker of the wheat poly (adenylic acid binding protein) gene TaSF3B4 provided by the invention can be used for identifying whether TaSF3B4 excellent alleles exist in wheat varieties / strains or not, and can be applied to assisted selective breeding and pyramiding breeding of other genes related to known quality.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

Various techniques for detecting visual similarity between DNS fully qualified domain names (FQDNs) are disclosed. In some embodiments, a system, process, and / or computer program product for detecting visual similarity between DNS FQDNs includes receiving a DNS data stream, wherein the DNS data stream includes a DNS query and a DNS response for resolution of the DNS query; performing extended sequence alignment for each of the set of FQDNs to identify potential malware FQDNs for one or more target FQDNs based on a visual similarity for each domain in the DNS data stream; and classifying the set of domains as malware FQDNs or benign FQDNs based on results of the extended sequence alignment.

The invention discloses a molecular marker combination for analyzing varieties of milk goats and application of the molecular marker combination, relates to the technical field of biology, and provides 2014 molecular markers capable of analyzing the features of the varieties of the milk goats, and the physical position information of the molecular markers is compared and determined based on the genome sequence of a goat reference genome ARS1. A molecular probe combination, a gene chip and a kit prepared from the 2014 SNP molecular markers can be used for carrying out genetic evaluation on goat individuals, individual selection is carried out on milk goat varieties which are difficult to measure in the early stage, the generation interval is shortened, the breeding process is accelerated, and therefore a large amount of breeding cost is saved.

The invention discloses a primer for diagnosis of early pregnancy of sows. The nucleotide sequence of the primer is shown as follows: SRY-O-F: 5 '-CAGCAAAATATTCTCGCCTTGG-3', and the nucleotide sequence of the primer is shown as follows. And SRY-O-R: 5 '-CATCCTCTCTCTACGC-3', and SRY-O-R: 5 '- SRY-I-F: 5 '-ATATTCTCGCCTTGGGG-3', SRY-I-F: 5 '- And SRY-I-R is 5 '-GCTTTCGGCTTCTGTA-3', and the formula is shown in the description. Two pairs of primers with high sensitivity and strong specificity are designed through comparative analysis of pig SRY gene sequences, fetal free DNA in peripheral blood of sows is used as a template, and the specificity and sensitivity of PCR are enhanced through amplification of the two pairs of primers. Through two rounds of PCR amplification, whether the sow is pregnant or not can be detected on the 18th day of pregnancy, and the accuracy of the detection result is extremely high and reaches 100%. Compared with the prior art that the ZFY gene is used for detecting the sows on the twentieth breeding day, the method has the advantages that the detection time can be advanced to the eighteenth breeding day, and the detection accuracy is greatly improved (100% vs 10%). According to the method, powerful technical support is provided for early and accurate identification of the non-pregnant sows, reduction of non-production days and feeding cost and smooth execution of a production plan.

The application relates to the technical field of gene chips, in particular to a SNP molecular marker combination of Pinus massoniana and application thereof. The SNP molecular marker combination is composed of 113,709 SNP molecular markers, wherein the physical position of the SNP molecular markers is determined by sequence alignment based on a reference genome Pinus.tabuliformis V1.0 of Pinus tabulaeformis. The application provides a whole genome chip of Pinus massoniana containing 113,709 SNP sites for the first time, and the chip has the advantages of high efficiency, low cost, good genetic stability and the like, and can be widely applied to different application scenarios such as identification of Pinus massoniana germplasm resources, genetic background analysis of breeding materials, gene positioning, whole genome association analysis, whole genome selection breeding and intelligent design breeding.

The invention provides a construction method, system and product of a false positive judgment model of a mutation site obtained by sequencing after enzyme digestion fragmentation and related application. Specifically, the false positive judgment model is constructed on the basis of a plurality of characteristic parameters associated with mutation sites obtained by enzyme digestion fragmentation sequencing; the characteristic parameters comprise scores obtained by performing reverse complementary sequence alignment on the front and back extension 30bp of the mutation site, the sequence proportion of 15 basic groups at the tail end of the mutation site, the Bayesian conditional probability of the extracted mutation site, and the KS test statistic of the extracted mutation site. Furthermore, the invention also provides a method for constructing the model by utilizing the crowd detection rate and the corresponding false positive. According to the method, the data characteristics of the false positive mutation sites are introduced by utilizing digestion fragmentation, so that the reliability of the digestion false positive mutation sites is objectively evaluated under the condition that high depth and large data volume are not needed, and the detection accuracy of the mutation sites can be remarkably improved.

The invention discloses a gene feature extraction method in gene data based on sequence search, and relates to the technical field of biological information. The problems that gene data is wide in source and diversified in format, data processing is extremely complex, data of different formats are difficult to integrate and analyze, and the accuracy and efficiency of feature extraction are affected are solved. According to the method, gene data are comprehensively preprocessed, low-quality and redundant parts are removed, reliable data quality is ensured, data distribution and data conversion are performed at the same time, high-similarity gene feature regions are accurately screened through sequence comparison, importance weights of gene features are determined by using clustering group features, key features are reasonably screened, and the accuracy of gene feature extraction is improved. Data dimensions are effectively reduced, the feature extraction efficiency and accuracy are improved, local and global features are fused to construct a comprehensive feature vector, the feature expression ability is enhanced, a screening result is verified by constructing a test data set, and the accuracy and reliability of the gene feature extraction method are continuously improved.

Disclosed herein are methods and systems for aligning sequence reads based on reduced sequence representations. The methods and systems may include receiving sequence reads generated from nucleic acids; encoding sequence reads with a reduced sequence representation, thereby generating transformed sequence reads; generating seeds from the transformed sequence reads; and matching the seeds, thereby aligning the transformed sequence reads. The methods and systems may improve alignment efficiency and accuracy, for example when used with sequence reads which include mutations or sequencing errors, such as in sequencing aided by mutagenesis (SAM) or long-read sequencing applications.