14 results about "DNA barcoding" patented technology

This invention relates to a rapid identification method Lactobacillus plantarum The method for identifying strains, belonging to the field of species and strain identification, is based on the differences in three DNA barcode sequences. Lactobacillus plantarum CGMCC NO: 26171 strain from Lactobacillusplantarum This method allows for rapid identification from other strains of the same species. Compared to traditional morphological identification methods, the standard gene sequence obtained is beneficial for the molecular identification of *Lactobacillus plantarum* strains, effectively shortening the identification time. Three pairs of DNA barcoding primers enable specific amplification of the test strain, allowing for rapid identification. Lactobacillus plantarum strains.

The invention relates to a method for rapidly identifying a Lactobacillus plantarum strain, and belongs to the field of species and strain identification, the Lactobacillus plantarum CGMCC NO: 26171 strain is rapidly identified from other strains of the same species of Lactobacillus plantarum based on the sequence difference of three DNA bar codes, and compared with a traditional morphological identification method, the method has the advantages that the identification efficiency is high, and the identification cost is low. The standard gene series obtained by the method is beneficial to molecular identification of lactobacillus plantarum target strains, and the identification time can be effectively shortened. The three pairs of DNA bar code primers can be used for realizing the specific amplification of the strain to be detected, and the Lactobacillus plantarum strain can be quickly identified. The method overcomes the defect that the traditional morphology of the Lactobacillus plantarum intraspecific strain is difficult to identify, and has the characteristics of universality, easiness in amplification and easiness in comparison.

The application provides a fat sea base gene and adulteration identification method based on multi-gene joint DNA barcoding, four gene joint barcode combinations are formed by adopting nuclear gene ITS2 and chloroplast genes matK, rbcL and psbA-trnH, at least two pairs of optimized alternative primers for each target gene and fat sea genus specific preliminary screening primer Ster-1 are matched, genus level rapid preliminary screening is realized to exclude non-fat sea genus samples and shorten the identification process, and the efficient amplification success rate of multi-gene fragments is ensured through the flexible use of alternative primers; fat sea and round fat sea, Sterculia and mixed adulterants can be accurately distinguished, the problems that traditional identification methods are subjective and species with close genetic relationship are difficult to distinguish are effectively solved; the method is not limited by sample morphology and fragmentation degree, can be widely applied to the true and false identification, quality control and traceability of traditional Chinese medicinal materials fat sea and its products, and provides technical support for standardizing market order and ensuring the safety and effectiveness of clinical medication.

This invention discloses primers for identifying animal-derived components based on third-generation sequencing technology. The primers are primer F (SEQ ID No. 1): GTATGACCGCGGTGGCTGGCAC, and primer R (SEQ ID No. 2): CCAAACTGGGATTAGATACCC. Compared to conventional DNA barcoding or quantitative real-time PCR methods, the primers designed in this invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, enabling the identification of animal-derived components through a single primer pair, thus improving the detection efficiency of counterfeit animal-derived components in the public security, food, drug, and environmental protection fields. The primer pairs designed in this invention amplify all mitochondrial loci, including D-LOOP, COX1, COX2, COX3, and CYTB, providing higher species resolution compared to shorter fragments.

The invention discloses a design method and application of a universal primer for bird identification based on machine learning optimization, the method is based on a DNA bar code technology, and the method judges conservative bases through multiple comparison in combination with Shannon entropy, so that the accuracy of obtaining conservative sequences is improved; establishing a multi-dimensional primer scoring system covering a coverage degree, a Tm value, an interaction degree, a degenerate base number and a poly structure; training a random forest machine learning model by using known primer sequences and score data, and optimizing model parameters through grid search and cross validation; and finally, quickly evaluating and screening a large number of candidate primers by using the trained model to obtain a high-performance primer combination. Traditional manual screening is replaced with a machine learning algorithm, the primer design efficiency and screening precision are remarkably improved, the designed universal primer is wide in coverage, high in specificity and high in amplification stability and can be widely applied to bird species identification, and reliable technical support is provided for ecological monitoring, species protection and law enforcement detection.

The present application relates to a kind of yunnan ganoderma strain L4741 and its cultivation method, belong to the field of microbial technology.The yunnan ganoderma strain L4741 has been preserved in Guangdong Provincial Microbial Culture Collection Center on December 27, 2021, and the preservation number is GDMCC No:62108.Through collecting and separating wild ganoderma strain L4741 and combining morphological and DNA barcoding technology to determine its taxonomic status, strain culture, biological characteristics and artificial domestication cultivation are carried out, and mature fruiting bodies are obtained after bag material covering soil cultivation.The yunnan ganoderma strain L4741 of the present application has excellent agronomic traits, high and stable yield, bag yield is 61.6g / bag, equivalent to 308kg per mu.Moreover, the content of active substance is higher than that of widely cultivated ganoderma lucidum, the mushroom is neat and has good stress resistance, the genetic traits are stable, and it is easy to popularize and apply.

The application discloses a detection method of adulterated Limnatis humilis in wide-body Limnatis humilis medicinal materials, decoction pieces and Chinese patent medicines. With the characteristic chemical component Bdelline B of the adulterated Limnatis humilis as an index, whether Limnatis humilis is adulterated in the wide-body Limnatis humilis medicinal materials, decoction pieces and Chinese patent medicines is quickly and accurately detected through liquid chromatography-mass spectrometry. The method is simple in operation, fast in detection speed, good in specificity, not affected by the complex process of samples, effectively fills the technical blank that DNA barcoding cannot detect Chinese patent medicines, is a technology for detecting wide-body Limnatis humilis adulterated Limnatis humilis based on chemical components, and provides a new method for quality control of Limnatis humilis.

The invention relates to the field of biological identification, and particularly discloses a method for identifying sambucus williamsii seedlings based on DNA barcodes, the DNA barcodes comprise ITS2 barcodes, universal primer sequences are SF2: 5 '-ATGCGATACTTGGTGTGAAT-3' and S3R: 5 '-GACGCTTCTCAGACTACAAT-3', the ITS2 barcodes are used for specifically amplifying ITS2 fragments, and the universal primer sequences are used for specifically amplifying the ITS2 fragments. The identification method comprises the following steps: extracting DNA of a sample, carrying out PCR amplification by using the primer, sequencing the product, comparing the obtained sequence with a database, and carrying out phylogenetic analysis, so as to determine the species. The method has the advantages of rapidness, accuracy and good repeatability, solves the problem that the flower-free and fruit-free period of elderberry is difficult to identify, and can be widely applied to the fields of elderberry seedling authenticity detection, Chinese herbal medicine source tracing, variety right protection, germplasm resource management and the like.

The invention provides a high-fidelity time sequence fluorescent DNA bar code and application thereof. The high-fidelity time sequence fluorescent DNA bar code comprises a coding chain and a reading chain, the coding chain is formed by connecting three sections of coding areas and four sections of positioning areas in series; the reading chain comprises a reading chain 1, a reading chain 2 and a reading chain 3; after the reading chain 1 is specifically combined with the coding chain, a signal carried on the reading chain 1 is generated; the reading chain 2 replaces and releases the reading chain 1 combined on the bar code through a toehold-mediated chain replacement reaction, and generates a signal carried by the reading chain 2; the reading chain 3 replaces and releases the reading chain 2 combined on the bar code through a toehold-mediated chain replacement reaction, and generates a signal carried by the reading chain 3; therefore, a time sequence change signal which can be detected is generated and is used for identifying the target molecule. The DNA bar code can exponentially expand the coding capability of the DNA bar code, and in-situ multiple imaging and analysis of various proteins, nucleic acids or polysaccharides can be easily realized.

1. The name of the design product: DNA bar code identification instrument. 2. The use of the design product: the design product is used for identifying DNA bar code. 3. The design points of the design product: in shape. 4. The picture or photo that best indicates the design points: perspective view.

The invention discloses a detection method for distinguishing human genetic materials based on a nanopore sequencing technology and a DNA bar code technology. The detection method is characterized by comprising the following steps: (1) extracting total nucleic acid of a sample to be detected; (2) carrying out PCR (Polymerase Chain Reaction) amplification on a sample to be detected by adopting the degenerate primer; and (3) sequencing the PCR product based on a nanopore sequencing technology, and determining whether the to-be-detected sample contains the human genetic material based on a sequencing result. Primer design and optimization are carried out according to the COI gene of human mtDNA, compared with a general identification primer for mammals, the capture capacity of the human COI gene is improved, meanwhile, a sequencing experiment process suitable for on-site rapid detection is developed, enough data can be obtained by computer sequencing for 10 minutes, and then comparison with a known sequence is carried out.

This invention discloses a rapid method for extracting DNA from turmeric, belonging to the fields of plant molecular biology and nucleic acid extraction technology. The method includes: taking a turmeric sample, grinding, crushing, or homogenizing it, adding nucleic acid lysis buffer and Chelex 100 resin filler, mixing thoroughly, and then heating to lyse the sample, causing the turmeric tissue cells to release DNA; subsequently, removing tissue debris, resin particles, polysaccharides, pigments, and other insoluble impurities by filtration or centrifugation, and collecting the filtrate or supernatant to obtain the initial extracted turmeric DNA. This method is simple to operate, fast in extraction, and low in cost. It does not require organic reagents such as phenol and chloroform, and the obtained DNA can be directly used for PCR amplification, DNA barcoding detection, molecular marker analysis, and identification of the authenticity of turmeric medicinal materials. It is suitable for rapid detection and batch processing of turmeric samples.

This invention discloses a DNA barcode, primers, and their applications for screening high-quality Tibetan brown mushrooms. The DNA barcode for screening high-quality Tibetan brown mushrooms comprises one or more of the 17 DNA fragments with nucleotide sequences as shown in SEQ ID NO: 1-17; the DNA barcode amplification primers for screening high-quality Tibetan brown mushrooms comprise one or more pairs of the 17 primer pairs with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 18-51. Compared with traditional breeding methods and other existing DNA barcoding technologies, this invention has the advantages of being time-saving, labor-saving, cost-effective, accurate, and efficient, playing a positive role in the genetic breeding of high-quality Tibetan brown mushrooms, and also providing an effective method for the identification and protection of germplasm resources.

The application belongs to the technical field of plant species identification, and particularly relates to a DNA barcode sequence for Ulmus prunifolia identification, primers and an application and identification method thereof. The DNA barcode sequence is composed of rps16-trnQ-UUG, trnS-GCU-trnG-GCC and ITS three fragments in turn. The DNA barcode sequence has good primer universality and rich site variation, is easy to operate, can stably and accurately identify Ulmus prunifolia, and can obviously distinguish Ulmus prunifolia from its closely related species distributed in the same region. In addition, the application has important significance in the researches of Ulmus plant germplasm resource classification and evolution, protection and utilization by using the DNA barcode molecular marker technology.