240 results about "Reverse primer" patented technology

The invention belongs to the technical field of genetic breeding, and particularly relates to a KASP primer group for detecting the typing of a rice flowering time regulation gene OsMYB8 and application of the KASP primer group. The KASP primer group comprises a first forward primer, a second forward primer and a reverse primer; the nucleotide sequence of the first forward primer is as shown in SEQ ID NO. 10; the nucleotide sequence of the second forward primer is as shown in SEQ ID NO. 11; the nucleotide sequence of the reverse primer is as shown in SEQ ID NO. 12. The primer group disclosed by the invention can be used for rapidly and accurately identifying the genotype of the rice OsMYB8 gene, and can be applied to molecular marker-assisted breeding of OsMYB8 gene plants.

The invention is suitable for the technical field of soybean breeding, and provides a KASP molecular marker for soybean plant height identification and application of the KASP molecular marker. The KASP molecular marker is based on an SNP variation site of a Glyma. 19G206100 gene between two parents of Chinese flat stem soybean and F02, the mutation position of the Glyma. 19G206100 gene is the 312th basic group on a CDS sequence, C of a reference genome is mutated into G, the 104th amino acid on a protein sequence is mutated into lysine from asparagine, and the 104th amino acid on the protein sequence is mutated into lysine from asparagine. The primer of the KASP molecular marker comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.1-2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. The invention further discloses a kit for detecting the KASP molecular marker. The KASP molecular marker is developed on the basis of the polymorphic site of Gm19G206100 in germplasm resources, the marker has the advantages of being high in resolution ratio and easy to detect, can be applied to plant height selection of early generations of soybean cross breeding, has the effects of reducing the breeding scale, reducing the workload and improving the breeding efficiency, and has important application value in production.

The invention relates to a primer group, a kit and a method for detecting an ATXN3 gene (CAG) n trinucleotide repetition number, and belongs to the technical field of gene detection. The technical problem to be solved by the invention is to provide the primer group for detecting the n trinucleotide repetition number of the ATXN3 gene (CAG). The primer group comprises a first primer pair and a second primer pair, a forward primer sequence of the first primer pair is as shown in SEQ ID NO. 1, and a reverse primer sequence of the first primer pair is as shown in SEQ ID NO. 2; a forward primer sequence of the second primer pair is as shown in SEQ ID NO. 3, and a reverse primer sequence of the second primer pair is as shown in SEQ ID NO. 4. Through the design of the two pairs of primers, complementary verification is achieved, the detection result is comprehensive and reliable, the technical defects of first-generation sequencing and second-generation sequencing on long-fragment and high-GC-content repetitive sequence detection are overcome, the detection cost is low, the detection period is short, and the primer pair is suitable for clinical detection service.

The invention discloses an amplification primer of a KASP marker on a D03 chromosome for cotton high lint breed breeding, which comprises a forward primer F1 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, and a reverse primer F2 with an FAM fluorescent marker, the sequence of the forward primer F2 is shown as SEQ ID No. 2; and the sequence of the reverse primer is shown as SEQ ID No.3. The method can effectively distinguish genotypes with obvious lint content difference, and provides a useful tool for molecular marker-assisted selection in cotton breeding.

Compositions and methods for detecting structural variations (SVs) in target genes or for genetic mapping of movable transposable elements are disclosed, the target genes relating to disease pathologies commonly found in large Mendelian genomics projects, and the movable transposable elements relating to genetic diseases, cancer, and aging. The method comprises: (i) contacting a sample containing genomic DNA with a DNA endonuclease for an effective amount of time to cleave the genomic DNA into fragments, the genomic DNA being uncrosslinked; (ii) subjecting the fragments obtained from step (b) to a DNA ligase to obtain circularized DNA; (iii) subjecting the circularized DNA to reverse PCR amplification containing a reverse primer, wherein the reverse primer is designed to match a expected wild-type sequence near a suspected mutant locus in the gene; and (iv) sequencing the amplified products. Exemplary conditions include Bardet-Biedel syndrome; severe upper and lower limb defects; retinitis pigmentosa; syndromic microcephaly; spastic paraplegia; and atypical hemolytic uremic syndrome.

This invention relates to the field of plant molecular breeding technology, specifically to a KASP molecular marker PH5-KASP based on the SNP site of the maize Zm00001eb259660 gene and its application. It provides a KASP molecular marker targeting the SNP site at 226029364 bp on maize chromosome 5, which is a functional missense mutation c.485C>T in the coding region of the Zm00001eb259660 gene. The marker consists of two allele-specific forward primers carrying different fluorescent tags and one universal reverse primer, stably distinguishing between C:C and T:T homozygous genotypes, where C:C corresponds to higher plant height and T:T corresponds to lower plant height. This invention offers high marker genotyping accuracy, simple and low-cost detection, and is suitable for large-scale breeding sample detection. It can be used for early identification of maize plant height traits, germplasm screening, and assisted breeding, significantly improving the efficiency of ideal maize plant architecture improvement.

The invention provides an Indel molecular marker closely related to the soluble sugar content of pepper fruits and application of the Indel molecular marker, and belongs to the technical field of nucleic acid-containing determination methods. The nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO. 1 in a sequence table; the Indel molecular marker is located at the 5274716 to 5274727 sites of a full-length sequence of a No.3 chromosome of a pepper reference genome. Primers for amplifying the Indel molecular marker comprise a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2 in a sequence table, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3 in the sequence table. The molecular marker can be directly applied to early generation of breeding, destructive sampling of chemical detection is avoided, the breeding cost is remarkably reduced, the breeding period is effectively shortened, and the selection efficiency of pepper molecular marker assisted breeding is greatly improved.

The invention relates to a primer-probe set, comprising a forward primer having the nucleotide sequence of SEQ ID NO:1 and a reverse primer having the nucleotide sequence of SEQ ID NO:2, and a peptide nucleic acid (PNA) probe having the sequence of HEX-OO-(SEQ ID NO:3)-Lysine-BHQ1, which are used for differentiating the Peste des Petits Ruminants (PPR) virus vaccine and field strains and for preventing false positive results arising from the PPR vaccine, as well as to their operating temperatures. Said primer-probe set can differentiate between the vaccine strain containing the nucleotide sequence of SEQ ID NO:4 and the field strain containing the nucleotide sequence of SEQ ID NO:5. Thus, by means of said primer-probe set, false positive results arising from the PPR vaccine are prevented, and accordingly, unnecessary quarantine measures are also avoided.

The invention relates to the technical field of plant molecular breeding, in particular to a Kasp marker EL-5-KASP-387 closely linked with the ear length of corn and application of the Kasp marker EL-5-KASP-387, an Indel functional site corresponding to the Kasp marker is located at the position 184049387 of the fifth chromosome of corn, the polymorphism is- / TGA, and a matched specific primer group is composed of two forward primers and a reverse primer. The major site of the ear length is located through whole genome association analysis, the developed KASP marker can accurately distinguish three genotypes, ear length character identification can be completed in the seedling stage, and the multi-environment weighted matching degree of the genotypes and phenotypes reaches 99.2%. The method does not need gel electrophoresis, has the advantages of high flux and high precision, can greatly shorten the breeding period of the long-ear corn, improves the breeding selection accuracy, and provides efficient technical support for high-yield molecular directional breeding of the corn.

The invention relates to the technical field of biological analysis and detection, and particularly discloses a streptococcus mutans detection kit based on an anchored CRISPR-Cas12a enhanced paper-based micro-fluidic chip and a detection method. The detection kit comprises an RAA solution or RAA freeze-dried powder, magnesium acetate or a magnesium acetate solution, TMB or a TMB solution, an RAA forward primer, an RAA reverse primer, a cell lysis buffer, a buffer system and a paper-based micro-fluidic chip. The detection method comprises the following steps: establishing a standard curve and detecting a sample. The detection kit is used for detecting the content of streptococcus mutans and has the characteristics of high efficiency, rapidness, specificity, sensitivity, portability and the like, and the method is simple and convenient to operate, low in detection cost and capable of being applied to on-site detection of streptococcus mutans.

The invention discloses a dCAPS molecular marker primer linked with a brassica napus saline-alkaline tolerance gene BnaC03.RBGB3 and application of the dCAPS molecular marker primer. The primer comprises a forward primer and a reverse primer, and through PCR amplification and specific restriction enzyme digestion treatment, two genotypes of high resistance and high sensitivity of brassica napus saline-alkaline tolerance can be distinguished on agarose gel electrophoresis; the high-resistance genotype is represented by two electrophoretic bands (195bp and 23bp), and the high-sensitivity genotype is a band which cannot be digested by enzyme. The method disclosed by the invention is simple and convenient to operate and reliable in result, can be used for rapidly screening and identifying the saline-alkaline-tolerant variety of the brassica napus, and provides a powerful tool for breeding the saline-alkaline-tolerant variety of the brassica napus. By implementing the technology, not only is the breeding efficiency improved, but also a new thought and strategy are provided for molecular marker-assisted breeding of saline-alkaline tolerance of crops, and development and application of a saline-alkaline tolerance breeding technology of brassica napus and even other crops are promoted.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

The present application relates to the field of agricultural biotechnology, and particularly relates to a molecular marker capable of identifying allelic variations of a soluble acid invertase gene AcoInv-1 in pineapple fruits and application thereof. The molecular marker is amplified by using the following primers: forward primer 5-CTGCGAAATGAACTAGTCAACTC-3 and reverse primer 5-TAGAGAACCGTTCTTGG AATGG-3. The primers can identify allelic variations of the soluble acid invertase gene AcoInv-1 in pineapple fruits, i.e. AcoInv-1a and AcoInv-1b. It is found through research that the two allelic variations are extremely significantly related to the total sugar content of the pineapple fruits. It is proved through verification that the pineapple material of the AcoInv-1a type is related to high sugar content, and the pineapple material of the AcoInv-1a and AcoInv-1b types is related to low sugar content. The application of the molecular marker obtained by the present application in selecting pineapple varieties with high sugar content potential will help to accelerate the breeding selection cycle.

The invention belongs to the technical field of biological detection, and relates to a Chikungunya virus detection kit and a detection method. The kit is based on the principle of PCR detection and comprises a primer pair, the sequence of a forward primer of the primer pair is shown as SEQ ID NO: 1, and the sequence of a reverse primer of the primer pair is shown as SEQ ID NO: 2. The chikungunya virus detection kit and the detection method can realize rapid, sensitive and specific detection of chikungunya virus based on the principle of PCR detection, and are especially suitable for various application scenes such as clinical samples, human or animal samples, environmental samples, scientific research samples and the like.

An in vitro approach for detecting Enterovirus-D68 (EV-D68) is disclosed. In one aspect, two or more EV-D68 genomic regions are amplified with primers that each include a 5' universal tail and an EV-D68-specific sequence (SEQ ID NOs: 47-92). The tails enable indexing and sequencing of tiled amplicons to confirm EV-D68 presence and permit lineage or subclade assignment. In another aspect, a type-specific RT-qPCR assay employs a forward primer (SEQ ID NO: 95), a reverse primer (SEQ ID NO: 96), and a fluorescent probe (SEQ ID NO:97) for rapid detection. Primer sets and kits comprising the primers, probe, and optional reagents are provided for environmental, clinical, or research testing performed outside the body, including wastewater-based surveillance. The universal tails are selected to avoid sequence overlap with any target amplicon. The methods, uses, and kits support sensitive EV-D68 detection across circulating variants and facilitate scalable sequencing and public-health monitoring.

The invention discloses a nucleic acid extraction-free direct RT-qPCR (reverse transcription-quantitative polymerase chain reaction) quantitative analysis method for RNA (Ribonucleic Acid) in tissue, which comprises the following steps: S1, preparing a tissue nucleic acid extraction-free lysis solution, mixing the tissue nucleic acid extraction-free lysis solution with a tissue sample, performing homogeneous crushing treatment, performing gradient centrifugation, and taking supernatant as a reverse transcription template; s2, designing a specific primer probe combination for RNA to be detected, performing reverse transcription on the reverse transcription template obtained in the S1, adding a reverse primer into a reverse transcription system during reverse transcription, and performing reverse transcription to obtain cDNA (complementary deoxyribonucleic acid); and S3, carrying out quantitative analysis on a tissue sample by taking the cDNA obtained in S2 as a template. According to the method provided by the invention, a nucleic acid extraction step is not needed, the detection time is remarkably shortened, the cost is reduced, meanwhile, target RNA is prevented from being lost, the accuracy and the stability of a quantitative result are improved, and the method is suitable for efficient detection of RNA in various tissues.

This invention provides an Indel molecular marker closely related to the soluble sugar content of pepper fruit and its application, belonging to the technical field of nucleic acid-based assay methods. The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.1 of the sequence listing; the Indel molecular marker is located at positions 5274716-5274727 of the full-length sequence of chromosome 3 of the pepper reference genome. Primers for amplifying the Indel molecular marker include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2 of the sequence listing, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3 of the sequence listing. This molecular marker can be directly applied in early generations of breeding, avoiding the destructive sampling of chemical detection, significantly reducing breeding costs, effectively shortening the breeding cycle, and greatly improving the selection efficiency of molecular marker-assisted breeding in peppers.

The invention discloses a preparation method of an FLT3-ITD specific hairpin primer, a detection system and application of the FLT3-ITD specific hairpin primer, and belongs to the technical field of molecular diagnosis. The 3 '-end of the hairpin primer is located at the upstream 4-12bp position of the FLT3-ITD junction point, the 5'-end of the hairpin primer extends to the downstream region of the junction point, a section of double-chain stem region exists at the 5 '-end of the hairpin primer, and the sequence of the double-chain stem region is completely complementary with the sequence of the 3'-end of the primer, so that the hairpin primer spontaneously forms a hairpin structure; the primer is used for specific detection of FLT3-ITD mutation. Through the mode, the detection sensitivity of FLT3-ITD mutation is as low as 0.001%, and the FLT3-ITD mutation detection kit can be used for clinical AML MRD detection to assist clinical precise diagnosis and treatment.

The application discloses a primer probe composition which is composed of a forward primer, a reverse primer and a probe primer. The sequence of the forward primer is shown as SEQ ID No. 1, the sequence of the reverse primer is shown as SEQ ID No. 2, and the sequence of the probe is shown as SEQ ID No. 3. The application establishes a detection method for Pseudomonas syringae pv. actidii, which comprises the following steps: extracting genomic DNA of a sample to be detected, taking the genomic DNA as a template, and performing RAA detection by using the primer composition; and determining whether the sample to be detected contains Pseudomonas syringae pv. actidii according to a strip of a LFD test paper. The detection method provided by the application has a minimum detection sensitivity of 1 pg / µL for Pseudomonas syringae pv. actidii DNA, and has a minimum detection limit of 1×10 3 cfu / mL for a bacterial suspension, and can provide a new technical means for early diagnosis and disease prevention and control of bacterial canker disease of kiwifruit.

The invention discloses a primer and a kit for rapidly detecting yersinia rouxii through RPA-CRISPR / Cas12a and application of the primer and the kit, and relates to the technical field of disease prevention and control in aquaculture. The invention aims to solve the problems that the existing detection method is time-consuming and labor-consuming, is easy to cause pollution and needs to be matched with professional detection equipment. According to the present invention, the RPA amplification primer is composed of a forward primer yrp1-RPA-F2 and a reverse primer yrp1-RPA-R2, the crRNA is yrp1-crRNA-R1, and the kit for rapid detection of yersinia rouxii contains the RPA amplification primer and the crRNA. The method for rapidly detecting yersinia rouxii comprises a fluorescence method and a test paper method. The method disclosed by the invention has the advantages of good inclusiveness, strong specificity, high sensitivity and the like, detection is carried out based on the RPA primer and the crRNA, and the obtained RPA product is detected by using a lateral flow chromatography test strip and fluorescence, so that the purpose of portable visual rapid detection on site or in a breeding base is achieved, and the method is suitable for large-scale popularization and application. The method has very high clinical application value in the aspects of early discovery of diseases, epidemiological investigation and comprehensive prevention and control.

The present disclosure provides for methods of generating a single stranded primer from an oligonucleotide probe. For instance, the present disclosure is directed to a method of preparing oligonucleotide primers from oligonucleotide probes, such as oligonucleotide probes which have been amplified, and which include a target specific primer sequence, a forward primer binding site, and a reverse primer binding site. It is believed that the presently disclosed method permits the synthesis of thousands to hundreds of thousands and even a million primers in a cost-effective manner, with good yield, in high quantities and at high purity levels.

The present invention relates to methods for determination of vector copy number. In particular, there is provided a method of determining a vector copy number in a biological sample that has undergone transduction with two or more vectors, the method comprising: (a) extracting genomic DNA (gDNA) from the biological sample; (b) performing digital droplet PCR (ddPCR) on the extracted gDNA using one or more pairs of forward and reverse primers to amplify a transgene of interest on each vector and to amplify a reference gene, together with one or more probes for detection of the amplification products; and (c) determining vector copy number for each vector in the biological sample.

The invention relates to the technical field of gene detection, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of root rot of Chinese chives, which comprises forward primers JBLB-F, FPLB-F and CCLB-F, reverse primers JBLB-R, FPLB-R and CCLB-R, and probes JBLB-P, FPLB-P and CCLB-P. The invention also provides a fluorescent quantitative PCR-based leek root rot pathogenic microorganism detection kit, which comprises the primer probe group. Meanwhile, the invention also provides a fluorescent quantitative PCR-based method for detecting pathogenic microorganisms of root rot of Chinese chives. Based on a probe method fluorescent quantitative PCR technology, in combination with high-sensitivity design of a specific primer probe group, accurate detection of low-copy pathogen nucleic acid can be realized, existence and quantity of pathogens can be determined in the early stage of the pathogens of the leek root rot, and early intervention and early warning of the root rot are facilitated.

The present disclosure provides a MNP marker primer combination for macadamia variety identification, a kit and its application. The primer combination comprises: 1st-446th primer pairs, forward primer of 1st primer pair, reverse primer of 1st primer pair to forward primer of 446th primer pair and reverse primer of 446th primer pair, which are sequentially shown in SEQ ID NO: 1-SEQ ID NO: 892 in the sequence listing. Using the MNP marker primer combination, DNA fingerprint data of the sample to be tested can be obtained by multiplex PCR amplification and high-throughput sequencing, and then compared with the control sample to obtain the genetic similarity coefficient, and finally obtain the variety identification conclusion of the sample to be tested and the control sample, and the accuracy and digitization degree are both high. A sequence analysis software can be used to compare hundreds of samples to be tested at one time, and the variety identification conclusion can be quickly obtained, which can significantly improve the accuracy and efficiency of macadamia variety identification.

The application relates to a primer of a MEP1B gene molecular marker related to a pig average daily weight gain trait and application thereof, and belongs to the technical field of biology. The MEP1B gene molecular marker of the application is located at the 116042900th base of chromosome No. 6 of a pig reference genome Sscrofa11.1 version 6, and has C / T polymorphism; the average daily weight gain of a pig with a TT genotype at the site is significantly higher than that of a pig with a CC genotype. The application uses forward and reverse primers to amplify a segment containing the above-mentioned molecular marker site, and Sanger sequencing is performed on the amplification product, so that the genotype of an individual can be quickly and accurately identified; the molecular marker can be used as a genetic marker for pig breeding, and pigs of a proper weight can be selected and bred; the pig average daily weight gain trait can be efficiently and accurately detected, and the pig average daily weight gain trait has important value for pig breeding and production.

This invention provides a primer-probe combination, reagents, methods, and applications for detecting Brucella vaccine strain RB51, belonging to the field of pathogen detection technology. The primer-probe combination for detecting Brucella vaccine strain RB51 of this invention includes a forward primer RB51-F, a reverse primer RB51-R, and a probe RB51-P; the forward primer RB51-F is shown in SEQ ID NO:1, the reverse primer RB51-R is shown in SEQ ID NO:2, and the probe RB51-P is shown in SEQ ID NO:3. The fluorescent PCR and digital PCR detection methods established based on the primer-probe combination of this invention have high sensitivity, good specificity, fast detection speed, and high throughput, enabling rapid detection of Brucella vaccine strain RB51, making differential diagnosis more accurate, economical, efficient, and convenient.

The invention discloses a soybean cyst nematode No.5 physiological race resistance associated KASP molecular marker, a primer and application, and relates to the technical field of gene engineering. The soybean cyst nematode 5 physiological race resistance associated KASP molecular markers are SNP molecular markers SCN2.1, SCN2.2 and SCN2.3, the SCN2.1 has a pair of primers including a forward primer and a reverse primer, the SCN2.2 has a pair of primers including a forward primer and a reverse primer, the SCN2.3 has a pair of primers including a forward primer and a reverse primer, and the kit contains the primers of the KASP molecular markers. The KASP molecular marker is applied to the breeding of the soybean cyst nematode No.5 physiological race. The invention provides a set of complete technical solution which comprises a KASP molecular marker directly associated with resistance, a matched specific detection primer combination and a rapid detection and application method, early-stage, high-throughput and accurate identification of soybean anti-soybean cyst nematode 5 physiological race traits is realized, and the disease-resistant breeding efficiency is remarkably improved.

An object of the present invention is to provide a design method, a manufacturing method, a design device, a design program, and a recording medium of a primer for amplicon methylation sequence analysis, which can improve a design success rate of the primer while suppressing the formation rate of a primer dimer extremely low.The present invention is a primer design method for amplicon methylation sequence analysis, including a primer sequence determination step of selecting one or more primer candidate sequence pairs related to a predetermined target site from one or more primer candidate sequences, calculating a local alignment score between predetermined primer sequences, and adopting and determining a primer candidate sequence pair having a score equal to or less than a predetermined threshold value as a forward primer sequence and a reverse primer sequence for amplifying a region including the predetermined target site.

This invention provides a KASP molecular marker tightly linked to the S66 hybrid sterility site in temperate and tropical japonica rice, comprising KASP9-28 and KASP9-29. The primer set for molecular marker KASP9-28 includes KASP9-28 forward primer 1, KASP9-28 forward primer 2, and a shared reverse primer, with nucleotide sequences of SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. The primer set for molecular marker KASP9-29 includes KASP9-29 forward primer 1, KASP9-29 forward primer 2, and a shared reverse primer, with nucleotide sequences of SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively. This invention also provides a method for detecting this molecular marker and its application in identifying the S66 hybrid sterility site in temperate and tropical japonica rice. The KASP molecular marker of this invention can improve the accuracy and efficiency of detecting the S66 sterility locus in temperate and tropical japonica hybrids.

The invention discloses a specific primer pair for detecting a swine edema disease. The specific primer pair comprises a forward primer Stx2eF and a reverse primer Stx2eR, wherein the nucleotide sequence of the forward primer Stx2eF is as shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer Stx2eR is as shown in SEQ ID NO: 2. Data show that the detection result of a sample inoculated with Shiga toxin-producing escherichia coli containing the Stx2e gene by using the primer pair disclosed by the invention is highly consistent with the actual infection degree, and the pathogenic bacterium load can be dynamically quantified through a standard curve. By means of the advantage, early warning of the pig edema disease can be achieved, and a key time window is provided for early prevention and control.