Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

168 results about "Vibrio harveyi" patented technology

Vibrio harveyi is a Gram-negative, bioluminescent, marine bacterium in the genus Vibrio. V. harveyi is rod-shaped, motile (via polar flagella), facultatively anaerobic, halophilic, and competent for both fermentative and respiratory metabolism. It does not grow below 4 °C ( optimum growth: 30° to 35 °C). V. harveyi can be found free-swimming in tropical marine waters, commensally in the gut microflora of marine animals, and as both a primary and opportunistic pathogen of marine animals, including Gorgonian corals, oysters, prawns, lobsters, the common snook, barramundi, turbot, milkfish, and seahorses. It is responsible for luminous vibriosis, a disease that affects commercially farmed penaeid prawns. Additionally, based on samples taken by ocean-going ships, V. harveyi is thought to be the cause of the milky seas effect, in which, during the night, a uniform blue glow is emitted from the seawater. Some glows can cover nearly 6,000 sq mi (16,000 km²).

Vibrio bacteriophage and bactericidal composition preparation method and application thereof

The invention relates to a Vibrio bacteriophage and a bactericidal composition preparation method and application thereof, belonging to the field of biotechnology. The bacteriophage composition comprises Vibrio alginolyticus bacteriophage vB_ValS_PcR-1 (accession number being CCTCC NO: M 2018391), Vibrio harveyi vB_VhaM_PcB-1G (accession number being CCTCC NO: M 2018392) and Vibrio parahaemolyticus phage vB_VhaP_OW (accession number being CCTCC NO: M 2015577). A high-potency culture product can be obtained after host actions, the composition is good in stability at room temperature, has a widehost splitting range, can efficiently inhibit growth of main pathogenic vibrios such as vibrio alginolyticus, vibrio harveyi, vibrio parahaemolyticus, can be applied as a biological antimicrobial agent for vibrio contamination control in food and aquaculture.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Chip for gene detection of multiple vibrios at the same time, and detection and use thereof

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Gene chip of aquatic product cultivation pathogenic bacterium

The invention discloses a gene chip of aquatic product cultivation pathogenic bacterium, comprising a solid phase carrier which is modified chemically, a detection probe and a quality control probe are distributed on the solid phase carrier in a dot matrix way; the detection probe comprises specificity 16S rDNA sequences and / or gyrB gene sequences of vibrio, comma bacillus, vibrio harveyi, vibrio alginolyicus, vibrio anguillarum, vibrio parahemolyticus, nocardia, nacardia seriolea, aeromonas, hydrophilic aeromonas, streptococcus and dolphin streptococcus, which are to be detected, the quality control probe includes PCR positive, chip fixed positive control, chip hybridizing negative control, chip hybridizing positive control and chip hybridizing blank control; the gene chip has the advantages of small volume and high flux, can detect known and unknown germs of the vibrio, the nocardia, the aeromonas and the streptococcus, and can detect specific germs with multiple kinds, and the simpleness and rapidness and specificity of the germs can be detected, and automatic detection can be carried out after detection software is additionally arranged.
Owner:NINGBO UNIV +2

Bacillus amyloliquefaciens and its bacterial depressant and use

The invention relates to Bacillus amyloliquefaciens V4. The Bacillus amyloliquefaciens V4 is preserved in the China general microbiological culture collection center and has a preservation number of CGMCC NO. 10149. The Bacillus amyloliquefaciens V4 strain and / or microbial agent can produce bacteriocin for antagonizing vibrio pathogens and pathogenic aeromonas at seedling growing and culture temperatures of common culture water, inhibit vibrio vulnificus, vibrio natriegen, vibrio harveyi, black sea vibrio, aeromonas hydrophila and aeromonas salmonicida growth and breeding, effectively control aquatic animal infectious disease generation and propagating caused by vibrio pathogens and pathogenic aeromonas, reduce aquatic animal mortality and a forage coefficient and promote aquatic animal weight gain.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI

A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences

The invention discloses a group of oligonucleotide sequences capable of synchronous identification of Vibrio harveyi and Vibrio alginolyticus and a preparation method of the oligonucleotide sequences, and relates to identification and detection of Vibrio harveyi and Vibrio alginolyticus. The oligonucleotide sequences comprise SEQ ID No.1-4. The preparation method comprises the following steps: synthesizing an ssDNA (single-stranded deoxyribonucleic acid) oligonucleotide library (5'-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3') for screening; separately mixing the oligonucleotide library with Vibrio harveyi and Vibrio alginolyticus, and carrying out SELEX (systematic evolution of ligands by exponential enrichment) screening; cloning and sequencing the aptamer-rich library; and selecting high-copy ssDNA in the sequencing result, verifying specificity of affinity, and obtaining the corresponding aptamers.
Owner:JIMEI UNIV

Novel multivalent carrier vaccine for shrimp and application thereof

ActiveCN102895677AHigh temperature resistanceActual production application development valueAntibacterial agentsBacteriaWhite spot syndromeVector vaccine
The invention relates to a novel multivalent carrier vaccine for a shrimp. The vaccine is characterized by comprising a bacillus subtilis recombination strain obtained by a genetic engineering technique, the strain belongs to the category of bacillus subtilis HT5303 and is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO.: M 2012395. When spores are formed by the bacillus subtilis vaccine strain, white spot syndrome virus VP281 protein can be demonstrated on the surfaces of the spores, and fusion protein of cell-penetrating peptides, white spot syndrome virus VP19 and vibrio harveyi 3-glyceraldehyde-phosphate dehydrogenase (GAPDH) can be secreted and expressed when vegetative cells are formed. Compared with other vaccines, the multivalent carrier vaccine has the advantages of cross protection and long protection period. Moreover, the vaccine can be added into feeds and has the advantages of resistance against high-temperature setting of feeds and broad prospects for commercial development.
Owner:马悦 +1

Gene chip for detecting ten types of pathogenic bacteria in sea areas

The invention discloses a gene chip for detecting ten types of pathogenic bacteria in sea areas. The gene chip comprises a solid phase slide on which a quality control probe and a detection probe are arranged, wherein the nucleotide sequence components of the detection probe are shown in SEQ ID NO.1-SEQ ID NO.27. The gene chip is capable of simultaneously detecting enterobacter cloacae, edwardsiella tarda, streptococcus faecalis, vibrio fortis, vibrio harveyi, vibrio parahaemolyticus, vibrio splendidus, vibrio vulnificus, vibrio anguillarum and shewanella smarisflavi just in the presence of DNA (deoxyribose Nucleic Acid) without need of live bacteria. The gene chip has remarkable advantages of high throughput, parallelism, miniaturization, automation, rapidness, sensitiveness, quantification, small use amount, and the like.
Owner:NINGBO UNIV

Preparation of two lytic vibrio harveyi bacteriophage preparations, and application thereof

The present invention relates to preparation of two lytic vibrio harveyi bacteriophage preparations, and an application thereof. A purpose of the present invention is to reduce the number of target pathogenic bacteria in the stichopus japonicus body, the stichopus japonicus culture environment and the stichopus japonicus processing products. Host bacteria of the bacteriophage are vibrio harveyi. The two separated bacteriophages of vp-1 and vp-2 provide strong lysis for the vibrio harveyi, and provide protection effects for the stichopus japonicus and the stichopus japonicus products. The preparation of the present invention is a novel green biological disinfection preparation. According to the present invention, the bacteriophage is purified, amplified, cultured and further enriched on a large-scale; because the lytic bacteriophage specifically kills the drug-resistant vibrio harveyi, the problems of the antibiotics resistance due to abuse of antibiotics, antibiotics residue in animal bodies, and the like are prevented; the preparation of the present invention can be prepared into a spray solution or an eluting solution, and provides purification and protection effects for the sick stichopus japonicus, and the aquaculture water environment; the preparation of the present invention does not have any toxic and side-effects, such that the food-derived pollution is reduced, the security effect is provided for the food safety.
Owner:DALIAN UNIV OF TECH

Vibrio harveyi recombined outer-membrane protein Ompk microspheres vaccine and preparation method thereof

The invention discloses a microsphere vaccine and a preparation method thereof. The vaccine is the microsphere vaccine which is prepared from recombinant outer-membrane protein Ompk of vibrio harveyi as a common mariculture fish pathogen, as well as biodegradable polymer materials through emulsification and drying. The microsphere vaccine is simple in preparation process, convenient for factory production, stable and reliable in production, safe and convenient to use, and the product yield reaches more than 80 percent. The microsphere vaccine has the advantages of high antigen content, long sustained release time, few toxic-side effects, convenience for large-scale application and the like. The prepared microsphere vaccine which is orally taken for immunization can stimulate an immune system to produce immune response in a long period of time, has high relative protection ratio to tested fishes, and can effectively prevent mariculture fish vibriosis.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Small RNAs and bacterial strains involved in quorum sensing

Quorum-sensing bacteria communicate with extracellular signal molecules called autoinducers to allow community-wide synchronization of gene expression. The present invention relates to the identification the Vibrio harveyi and Vibrio cholerae protein Hfq as mediating interactions between small, regulatory RNAs (sRNAs) and specific messenger RNA (mRNA) targets. Accordingly, the present invention provides nucleic acids encoding the Vibrio sRNAs, strains having various deletions and mutations of one or more qrr genes encoding these sRNA as well as methods of identifying quorum-sensing regulators. Additionally, the invention relates to an isolated V. harveyi Hfq protein and conservative amino acid substitutions thereof as well as nucleic acids encoding those proteins, recombinant methods of producing those proteins and antibodies against those proteins.
Owner:THE TRUSTEES FOR PRINCETON UNIV

Gene chip for detecting nine pathogenicity vibrios in marine products

The invention relates to a gene chip for detecting nine pathogenicity vibrios in marine products and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe includes one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of a vibrio hollisae, a vibrio vulnificus, a vibrio cholera, a vibrio parahemolyticus, a vibrio harveyi, a vibrio alginolyticus, a vibrio furnissi, a vibrio mimicus and a vibrio damsel, 2) complementary DNA sequences of the DNA sequences selected in the DNA sequences in 1), 3) complementary RNA sequences of the selected DNA sequences in 1) or 2). The kit comprises the gene chips. The gene chip for detecting nine pathogenicity vibrios in marine products and the kit thereof provided by the invention are used for detecting the nine pathogenicity vibrios in marine products, and have the advantages of simplicity in operation, good sensitivity and strong repeatability.
Owner:ZHOUSHAN INST OF CALIBRATION & TESTING FOR QUALITY & TECHNICAL SUPERVISION

Method for preparing questin by utilizing ocean aspergillus flavipes HN4-13 bacterial strain and application of questin

The invention discloses a method for preparing questin by utilizing an ocean aspergillus flavipes HN4-13 bacterial strain. The method comprises the following steps: conducting separation and purification on antibacterial active substances generated through fermentation of the aspergillus flavipes HN4-13 bacterial strain according to silica-gel column chromatography, Sephadex LH-20 column chromatography, preparation of high performance liquid chromatography (PHPLC) and the like by taking vibrio harveyi as an indicator bacterium, so as to obtain a vibrio harveyi-preventing active compound HY2; indentifying the structure of the active compound HY2 according to spectra data such as ESI-MS, 1H-NMR and 13C-NMR, so as to determine that the active compound HY2 is questin. The questin is obtained through separation of a metabolic product of aspergillus flavipes HN4-13; experiments show that the questin can perform a certain inhibiting function of the pathogenic bacteria, such as vibrio harveyi, vibrio anguillarum, vibrio parahaemolyticus and vibrio cholerae, of aquatic products, and can be used for preparation of medicine preventing pathogenic vibrio of the aquatic products.
Owner:JIANGSU MARINE RESOURCES DEV RES INST LIAN YUNGANG

Gene chip detecting marine pathogenic vibrios, and preparation method and detection method thereof

The invention discloses a gene chip detecting marine pathogenic vibrios, and a preparation method and a detection method thereof. The gene chip comprises a solid-phase carrier and detection probes fixedly disposed on the solid-phase carrier, and the detection probes comprise vibrio vulnificus gyrB gene probe, vibrio vulnificus virulence gene hemA probe, vibrio splendidus gyrB gene probe, vibrio splendidus virulence gene toxR probe, vibrio harveyi gyrB gene probe, vibrio harveyi virulence gene hemA probe, vibrio parahaemolyticus gyrB gene probe, vibrio parahaemolyticus virulence gene toxS probe, vibrio anguillarum gyrB gene probe and vibrio anguillarum virulence gene hem probe which are respectively shown as SEQ NO 1-10. The gene chip is firstly applied to detection on marine pathogenic vibrios. The gene chip is capable of rapidly sensitively detecting target bacterium infectio, also is good in repeatability and strong in signal, and does not easily cause a nonspecific signal.
Owner:浙江正合谷生物科技有限公司

Stichopus japonicas BPI gene, encoded protein, cloning method of stichopus japonicas BPI gene, and method for constructing recombinant stichopus japonicas BPI genetically engineered bacterium

The invention discloses a stichopus japonicas BPI gene, an encoded protein, a cloning method of the stichopus japonicas BPI gene, and a method for constructing a recombinant stichopus japonicas BPI genetically engineered bacterium. The stichopus japonicas BPI gene is characterized in that a stichopus japonicas BPI gene sequence is as shown in SEQ ID NO.1; the cloning method comprises the step of designing a nested primer of RACE according to an expressed sequence tag EST sequence which is homologous to the BPI gene; a full-length gene is expanded by employing an RACE technique; a stichopus japonicas BPI protein sequence is as shown in SEQ ID NO.2; an N-terminal protein structure domain sequence is as shown in SEQ ID NO.3; an N-terminal structure domain of the stichopus japonicas BPI protein is amplified by employing primers which respectively comprise BamH I sites and Not I sites; the cloned target gene is inserted into a vector to obtain recombinant plasmids; and the recombinant plasmids are subjected to induced expression, and purification and renaturation, so as to obtain the genetically engineered bacterium. The stichopus japonicas BPI gene has the advantage of having obvious sterilization effect on vibrio parahaemolyticus, vibrio harveyi and micrococcus luteus.
Owner:NINGBO UNIV

Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio

The invention provides a method for establishing a fingerprint map of a marine vibrio. Particularly, according to the method for establishing the fingerprint map of the marine vibrio, one marine vibrio in 83 marine vibrioes of vibrio harveyi and the like is used for preparing a protein sample, and a protein fingerprint map is obtained by utilizing MALDI-TOF / TOF MS (Matrix-Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry). By using the method for establishing the fingerprint map of the marine vibrio, the protein fingerprint maps of the 83 marine vibrioes are constructed; a database for identifying the marine vibrioes is established, so that the accuracy of identifying the marine vibrioes is increased, and the time of identifying the marine vibrioes is shortened greatly.
Owner:胡成进

Antibacterial peptide VK-21 and application

The invention discloses an antibacterial peptide VK-21 in the technical field of biology. The amino acid sequence of the antibacterial peptide is Val-Lys-Arg-Lys-Lys-Lys-Pro-Gln-Ser-Trp-Lys-Thr-Trp-Trp-Thr-Lys-Trp-Trp-Thr-Lys-Lys. The antibacterial peptide has an obvious inhibiting effect on Escherichia coli, pseudomonas aeruginosa, staphylococcus aureus and four methicillin-resistant staphylococcus aureus, has an excellent antibacterial effect on vibrio parahaemolyticus and vibrio harveyi frequently existing in aquatic products, has low hemolytic activity, good stability, strong antibacterial activity and efficient broad-spectrum bacteriostasis functions, and can be used as an antibiotic substitute.
Owner:ZUNYI MEDICAL UNIVERSITY

Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith

PCT No. PCT / JP97 / 00991 Sec. 371 Date Jan. 6, 1999 Sec. 102(e) Date Jan. 6, 1999 PCT Filed Mar. 25, 1997 PCT Pub. No. WO97 / 35970 PCT Pub. Date Oct. 2, 1997An oligonucleotide is provided which has a nucleotide sequence derived from SEQ ID NO:1, characterized in that it contains at least one site capable of amplifying a nucleotide sequence characteristic of Vibrio parahaemolyticus. The oligonucleotide may have a nucleotide sequence not derived from SEQ ID NO:3, or incapable of amplifying nucleotide sequences originating in Vibrio alginolyticus and Vibrio harveyi, and may be represented by SEQ ID NO:5 or SEQ ID NO:6. A method of detecting Vibrio parahaemolyticus in a specimen is also provided which comprises preparing a primer set comprising two of the above oligonucleotides, selectively amplifying therewith a DNA gyrase subunit B gene sequence contained in the specimen as a target, and determining whether or not there is a gyrB unit specific for Vibrio parahaemolyticus in the specimen. Also provided is a primer which reacts specifically with a gyrB gene of Vibrio parahaemolyticus to thereby differentiate and identify the same among other Vibrios and strains other than the genus Vibrio. The Vibrio parahaemolyticus-specific primer serves to detect 285-bp gyrB gene fragments specific for this Vibrio by the PCR method without the necessity for DNA extraction or like operations from bacterial cells.
Owner:NIPPON SUISAN KAISHA LTD

Kit for fast test of vibrio harveyi and the test method thereof

The present invention is kit for fast test of vibrio Harveyi and the test method thereof. The kit includes DNA extracting reagent comprising buffering reagent A and cell cracking reagent B; PCR reagent comprising reaction pre-mixing reagent C and reaction primer reagent D with specific primer pair of VP01 5'-GCACCATGGGTTAAAAGCCGCT and VP02 5'-AGAGAACTGACGCACAACGTGGTTC; and electrophoresis and development reagent comprising reagent E and reagent F. The test method includes: sample processing, DNA extraction, PCR proliferation, electrophoresis and development test. Under ultraviolet light test, one tested 480 nucleotide pair stripe corresponding to the infection or pollution of vibrio Harveyi, or else no infection or pollution of vibrio Harveyi. The present invention has the advantages of fast detection and high sensitivity.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Bacillus subtilis and feed additive containing same

The invention relates to the technical field of function microorganism screening and particularly provides novel bacillus subtilis SY12 with the preservation number being CCTCC No: M2015483. The bacillus subtilis SY12 has the advantages that the bacillus subtilis SY12 is capable of effectively inhibiting pathogenic bacteria such as vibrio harveyi and vibrio anguillarum, improving immunity of aquaculture animals and reducing diseases; the bacillus subtilis SY12 with high proteinase-producing and amylase producing capabilities can serve as a feed additive, so that digestive ability of the aquaculture animals is improved remarkably, feed use ratio is increased remarkably, and animal growth is promoted.
Owner:青岛玛斯特生物技术有限公司 +1

Gene chip for detecting vibrio harveyi colony and using method of gene chip

The invention discloses a gene chip for detecting a vibrio harveyi colony and a using method of the gene chip. The gene chip is characterized in that nucleotide probes for detecting vibrio alginolyticus, V. campbellii, V. harveyi, V. natriegens, V. parahaemolyticus and V. rotiferianus are immobilized on a chip carrier; the probes of various vibrios use a toxR gene as a target gene; the gene sequences of the various probes are as shown in SEQ ID NO: 11-14; and in a step of PCR amplification on a sample, the gene sequences of a PCR amplification forward primer designed for the toxR gene of various strains of the vibrio harveyi colony and a reverse primer with a digoxin marker are as shown in SEQ ID NO. 15-26. The gene chip disclosed by the invention has the advantage that the gene chip is capable of rapidly and effectively detecting 6 pathogenic vibrios of the pathogenic vibrio harveyi colony in a parallel mode, and the gene chip is high in accuracy and sensitivity and is strong in specificity.
Owner:NINGBO UNIV

Cross-protection vaccine and building method thereof

The invention relates to the field of gene engineering and immunology, in particular to a method for constructing and applying a cross-protective vaccine of Vibrio harveyi and Edwardsiella tarda, and an antigen expression vector thereof. The cross-protective vaccine has a base sequence in a sequence table SEQ ID No.1, and is constructed by the following steps: constructing plasmids pPT6 and pT6VH; and on the basis, constructing a plasmid pT6VH18 containing the antigen of the cross-protective vaccine of Vibrio harveyi and Edwardsiella tarda. The pT6VH18 is converted into colibacillus to be cultured under a conventional condition so as to obtain the protective vaccine. The vaccine not only has cross-protection effect, but also does not need any purifying process.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Vibrio harveyi secretory type vaccine and structure and application thereof

The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI / XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI / XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturing on an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Probiotic with bacteriostatic ability and application thereof

The invention relates to the field of microbial disease control and in particular relates to a probiotic with bacteriostatic ability. The probiotic is Enterobacter ludwigii-PC88, is collected in China General Microbiological Culture Collection Center (CGMCC) on June 24, 2013, and has a collection number of CGMCC No.7814. The probiotic is separated from intestinal tracts of healthy flounders. The pure culture of the probiotic has relatively strong inhibitory effects on aquatic pathogens such as vibrio splendidus, vibrio harveyi, vibrio parahaemolyticus, pseudomonas aeruginosa and vibrio anguillarum, also can inhibit growth of known human pathogens such as tritirachium album, staphylococcus aureus and klebsiella pneumoniae, and has resistance to ampicillin. The pure culture or composition of the probiotic can be used for control of aquaculture diseases and development of novel antibacterial materials, and has good application prospects.
Owner:YANTAI INST OF COASTAL ZONE RES CHINESE ACAD OF SCI

Probiotic separated from intestinal tracts and application thereof

The invention relates to the field of microbial disease control and in particular relates to a probiotic separated from intestinal tracts of turbots and an application thereof. The probiotic is Leclercia adecarboxylata P115, is collected in China General Microbiological Culture Collection Center (CGMCC) on June 24, 2013, and has a collection number of CGMCCNo.7813. The probiotic is separated from the intestinal tracts of healthy turbots. The probiotic and the pure culture thereof have obvious bacteriostatic effects on tritirachium album, klebsiella pneumoniae, staphylococcus aureus, vibrio parahaemolyticus, vibrio harveyi and vibrio anguillarum. The pure culture or composition of the probiotic can be used for control of aquaculture diseases and development of novel antibacterial materials, and has good application prospects.
Owner:YANTAI INST OF COASTAL ZONE RES CHINESE ACAD OF SCI

Thermal shock-based vibrio harveyi homologous recombinant gene knockout method

ActiveCN107904228AConjugate conversion efficiency from scratchFunctional analysis is accurateBacteriaHybrid cell preparationMicrobiologyThermal shock
The invention discloses a thermal shock-based vibrio harveyi homologous recombinant gene knockout method. The method comprises the following steps: performing thermal shock treatment on vibrio harveyirecipient bacteria which are cultured to an early logarithmic phase, and uniformly mixing equal volume of the vibrio harveyi recipient bacteria which are cultured to the early logarithmic phase and vibrio harveyi donor bacteria which are cultured to early logarithmic phase; centrifuging at room temperature, removing a supernatant liquid, re-suspending after bacteria are precipitated, dibbling toa fixed flat plate and performing bacterial conjugation overnight; performing the thermal shock treatment on the vibrio harveyi conjugation recipient bacteria to develop the conjugation conversion rate of the vibrio harveyi from nothing, so as to perform gene knockout on the vibrio harveyi. According to the method, the conjugation conversion rate of the vibrio harveyi is developed from nothing byperforming the thermal shock treatment on the vibrio harveyi conjugation recipient bacteria on the technical basis of the conventional conjugational transferring method, so that the vibrio harveyi issubjected to the gene knockout successfully.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Detection primer group, detection kit, and detection method used for simultaneous detection of three pathogenic bacteria of marine fishes

The invention discloses a detection primer group, a detection kit, and a detection method of nocardia seriolae, vibrio harveyi, and streptococcus iniae. The detection primer group comprises a primer pair Ns-mce, a primer pair Vh-tox, and a primer pair Si-its; the nucleotide sequences of the primer pairs are represented by SEQ ID NO.1-6. The detection kit comprises above detection primer group. According to the detection method, the detection kit is used for detection; samples are subjected to pretreatment, genome DNA is extracted as sample group DNA, and PCR is adopted to detect the samples. A triplex PCR detection method is established for tracking measurement of nocardia seriolae, vibrio harveyi, and streptococcus iniae at different periods, avoiding transmission of pathogenic bacteria, and improving rapid inspection and quarantine of pathogenic bacteria in aquatic products; and the invention belongs to the field of aquatic cultured animal pathogenic bacteria detection.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Intersecting protective vaccine antigen, preparation method and application thereof

The invention relates to the fields of molecular biology and genetic engineering, in particular to an intersecting protective vaccine antigen, a preparation method and an application thereof. The intersecting protective vaccine antigen is provided with a base sequence in a sequence table of SEQ ID NO. 1. The preparation method comprises the following steps of: establishing pET258 plasmid and then taking Vibrio Harveyi T4 as a moulding board; using primer VHQF5 and VHQR5 to carry out PCR augmentation and obtaining plasmid pBTQ connection established by products; transferring colon bacterium and obtaining plasmid pEVQ; and then carrying out inducement and obtaining antigen VhdQ. The intersecting protective vaccine antigen and B187-PBS culture fluid are mixed as the intersecting protective vaccine antigen of Vibrio Harveyi and vibrio parahaemolyticus. The vaccine antigen obtained by the preparation method exists in a plurality of pathogenicity vibrios, and has high conservative property, thus having intersecting protective effect. A highly active procaryon expression system obtained by the intersecting protective vaccine antigen can be used for expressing the intersecting protective vaccine antigen in large quantity; and the prepared antigen protein is guaranteed to have native immunity activity, and can be directly used for immune prophylaxis and treatment.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Method and kit for identifying Vibrio harveyi quickly by means of strong vibrio harveyi phage

The invention provides a method and a kit for identifying Vibrio harveyi quickly by means of strong vibrio harveyi phage and belongs to the technical field of identification of cultures of Vibrio harveyi. The method comprises the following steps: 1) coating 10<7>-10<9>cfu / mL to-be-detected culture to a LB agar plate, leaving the LB agar plate to stand for 15-20min to obtain a to-be-detected plate;2) dropwise adding a strong vibrio harveyi phage mixed liquid to the to-be-detected plate to obtain an identification system; and 3) leaving the identification system obtained in the step 2) to standfor 8-16h at 28-35 DEG C, observing whether bacteriophage plaques appear or not in the identification system, and identifying the to-be-detected culture as the Vibrio harveyi. The method is low in cost and time- and labor-saving, the time needed is only 16-18h, and the method is particularly suitable for initially screening a lot of Vibrio harveyi.
Owner:XIAMEN CANCO BIOTECH CO LTD

Kit and detection method for detecting vibrio harveyi

The invention relates to a kit and detection method for detecting vibrio harveyi by using the loop-mediated isothermal amplification technique. The kit comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA (deoxyribonucleic acid) polymerase and a color-developing agent, wherein the reaction solution contains a reaction buffering solution Thernopol, dNTP (deoxyribonucleotide triphosphate), MgSO4, a forward inter primer (Vh-FIP) TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, a reverse inter primer (Vh-BIP) ACGCAGAATCAAGCAGTGTGCCGATTTATTCGCCACGACA, a forward outer primer (Vh-F3) CAAAACGGTTCCGAAACGC, a reverse outer primer (Vh-B3) TCGATTCCCCAAGTTTGGAG, a betaine, and sterile distilled water. The detection method comprises the following steps: extracting bacterium DNAs, carrying out loop-mediated isothermal amplification, carrying out color-developing detection and the like. By designing the primers according to the vibrio harveyi toxR gene conservation area and detecting by using the LAMP (loop-mediated isothermal amplification) technique, the invention achieves high specificity and high sensitivity; the kit has the advantages of high detection speed, high accuracy, excellent sensitivity, convenient on-site application and the like; and the defects of long cycle, low sensitivity, high cost, difficult on-site application and the like in the prior art are solved.
Owner:陈吉刚

Bacillus pumilus E14, culturing method thereof and application

The invention relates to a bacillus pumilus E14 numbered 6682 in China General Microbiological Culture Collection Center (CGMCC). The invention further discloses a culturing method of the bacillus pumilus E14. The method comprises the following steps of: inoculating the bacillus pumilus E14 with a 2216 E liquid medium, and culturing at 28 DEG C and 150 rpm for 20h so as to obtain a bacterial liquid. The bacillus pumilus E14 or the bacterial liquid obtained by the culturing method has a Vibrio harveyi inhibition application, and can be used for preparing shrimp and crab cultivation medicines or is added into shrimp and crab cultivation feeds as the bacterial inhabitation medicine.
Owner:HUAIHAI INST OF TECH