Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio

A fingerprint, marine Vibrio technology, applied in the field of protein molecular fingerprints, can solve problems such as inability to accurately identify marine Vibrio, imperfect standard peptide spectrum of Vibrio, shorten identification time, increase accuracy, eliminate Effects of hazards to people and the environment

Inactive Publication Date: 2016-07-13
胡成进
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the standard peptide spectra of Vibrio in these two sets of commercial databases are not perfect, especially the marine Vibrio is rare, and it is impossible to accurately identify the marine Vibrio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio
  • Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio
  • Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] From marine vibrio culture, DNA extraction to identification, and library construction, all bacteria in the library are identified and confirmed by 16SrRNA and rpoB molecular biology methods to ensure that there are no wrong bacteria in the library. The steps of 16SrRNA and rpoB are the same except that the primers used in PCR amplification are different.

[0043] The detection primer sequence of 16SrRNA gene is:

[0044] 27F: 5'-AGAGTTTGATC(C / A)TGGCTCAG-3'

[0045] 1492R:5'-TACGG(C / T)TACCTTGTTACGAC-3'

[0046] The detection primer sequence of RpoB gene is:

[0047] F1:5'AGGCGTGTTCTTCGACAGCGATAA3'

[0048] R1: 5'TCGTCCACTTCGCCTTTACC3'.

[0049] 1) Resuscitate 83 strains of marine Vibrio, and the selected microorganisms are the microorganisms with strain numbers 1-83 in Table 1;

[0050] 2) Extract bacterial genomic DNA: Add 50 μl sterile water to a sterile EP tube, pick a single colony and mix it well, adjust the bacterial solution to 2 turbidity, shake for 15 seco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for establishing a fingerprint map of a marine vibrio. Particularly, according to the method for establishing the fingerprint map of the marine vibrio, one marine vibrio in 83 marine vibrioes of vibrio harveyi and the like is used for preparing a protein sample, and a protein fingerprint map is obtained by utilizing MALDI-TOF / TOF MS (Matrix-Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry). By using the method for establishing the fingerprint map of the marine vibrio, the protein fingerprint maps of the 83 marine vibrioes are constructed; a database for identifying the marine vibrioes is established, so that the accuracy of identifying the marine vibrioes is increased, and the time of identifying the marine vibrioes is shortened greatly.

Description

technical field [0001] The invention relates to the technical field of protein molecular fingerprints, in particular to a method for establishing fingerprints for detecting 83 strains of marine vibrio and standard fingerprints thereof. Background technique [0002] The epidemiological survey in the United States shows that marine vibrio infection has become increasingly serious in recent years. Most human marine vibrio infections are acquired through eating aquatic products infected by vibrio or contacting water or other carriers containing marine vibrio through wounds. The infection of fish and other aquatic animals in aquaculture and the infection of aquaculture workers affect the economic development of aquaculture and the health of aquaculture workers. Vibrio identification involves food safety, aquatic products, marine pollution, water quality inspection, etc., so the rapid identification of marine Vibrio is particularly important. [0003] The gold standard for diagno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N27/62G01N1/28
CPCG01N1/28G01N27/62
Inventor 胡成进武静周月霞刘晓斐陈英剑
Owner 胡成进
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap