Method for establishing fingerprint map of marine vibrio and fingerprint map of marine vibrio
A fingerprint, marine Vibrio technology, applied in the field of protein molecular fingerprints, can solve problems such as inability to accurately identify marine Vibrio, imperfect standard peptide spectrum of Vibrio, shorten identification time, increase accuracy, eliminate Effects of hazards to people and the environment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] From marine vibrio culture, DNA extraction to identification, and library construction, all bacteria in the library are identified and confirmed by 16SrRNA and rpoB molecular biology methods to ensure that there are no wrong bacteria in the library. The steps of 16SrRNA and rpoB are the same except that the primers used in PCR amplification are different.
[0043] The detection primer sequence of 16SrRNA gene is:
[0044] 27F: 5'-AGAGTTTGATC(C / A)TGGCTCAG-3'
[0045] 1492R:5'-TACGG(C / T)TACCTTGTTACGAC-3'
[0046] The detection primer sequence of RpoB gene is:
[0047] F1:5'AGGCGTGTTCTTCGACAGCGATAA3'
[0048] R1: 5'TCGTCCACTTCGCCTTTACC3'.
[0049] 1) Resuscitate 83 strains of marine Vibrio, and the selected microorganisms are the microorganisms with strain numbers 1-83 in Table 1;
[0050] 2) Extract bacterial genomic DNA: Add 50 μl sterile water to a sterile EP tube, pick a single colony and mix it well, adjust the bacterial solution to 2 turbidity, shake for 15 seco...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com