80 results about "RpoB" patented technology

This invention provides oligonucleotide based arrays and methods for speciating and phenotyping organisms, for example, using oligonucleotide sequences based on the Mycobacterium tubercluosis rpoB gene. The groups or species to which an organism belongs may be determined by comparing hybridization patterns of target nucleic acid from the organism to hybridization patterns in a database.

A drug-resistance gene film chip for detecting mycobacterium tuberculosis is prepared by designing 54 probe spotting on a nylon film by aiming at the mutant sites of mycobacterium tuberculosis rpoB, kagG, embB, inhA, ahpC, gyrA, rrs, rpsL and pncA gene; 12 pairs of specific primers with biotin-labeled at 5' end are utilized; a sample DNA is subjected to triple PCR and amplified to form a large amount of gene fragment products with biotin; the amplified products and the probes on the film chip carry out specific hybridization; and then film washing, enzyme-linking and color reaction are carried out, thus preparing the chip. The gene film chip and the detection method thereof can detect the common gene mutations of the mycobacterium tuberculosis on the drug resistance of drugs such as isoniazid, rifampicin, streptomycin, ethambutol, pyrazinamide, quinolone and the like at one step, and are applicable to extracorporeal detection sputum sample, clinical isolation strains and mycobacterium tuberculosis multi-drug resistant gene in the organization sample.

The present invention provides a method for identifying Mycobacterium tuberculosis and non-tuberculosis Mycobacterium (MOTT), and for the determination of drug susceptibility of M. tuberculosis based on detection of mutations in the rpoB gene.

The invention relates to a diagnostic kit for identification of mycobacterium strains and detection of drug resistance and a preparation method thereof. The kit can quickly and accurately distinguish between the identification of mycobacterium strains and the detection of drug resistance in large quantities by using an oligonucleotide chip. Point mutations in the rpoB gene of Mycobacterium tuberculosis associated with drug resistance. The diagnostic kit for the identification of mycobacterium strains and the detection of drug resistance of the present invention contains an oligonucleotide chip, and the chip contains a complex composed of mycobacterium tuberculosis mycobacterium strain identification probes and drug resistance detection probes. Probe, mycobacterium tuberculosis rpoB gene, and fluorescent material, wherein the fluorescent material contains biotin-binding protein, which is used as the label of biotin and the corresponding probe to detect the hybridization of the sample amplification product.

Provided is a composition for detection of M. tuberculosis complex or Mycobacterium genus, comprising (i) a primer and/or probe targeting IS6110 that is an M tuberculosis complex-specific gene, (ii) a primer and/or probe targeting rpoB that is a Mycobacterium genus-specific gene, and optionally (iii) a primer and/or probe targeting a plant-derived gene as an internal control. When multiplex real-time PCR is carried out using the composition of the present invention, it is possible to detect M tuberculosis complex as well as Mycobacterium genus by a single roundPCR assay. Therefore, the present invention enables rapid and easy clinical diagnosis with high reliability.

The invention relates to the technical field of molecular biology and clinical detection, in particular to a primer probe group for detecting a mycobacterium tuberculosis complex and rpoB mutations based on a multi-enzyme isothermal rapid amplification technology and application of the primer probe group. A 1296th-site base mutation of an rpoB gene is used as a molecular marker for identifying a mycobacterium tuberculosis complex strain, and a specific primer probe group is designed aiming at amino acid mutations of the 1296th-site and a 516th site, a 526th site and a 531st site of the rpoB; amethod for detecting the mycobacterium tuberculosis complex strain and the rpoB mutations based on a multi-enzyme isothermal rapid amplification technology is developed. The primer probe group disclosed by the invention is high in detection sensitivity and strong in specificity; the method has the advantages of low dependence on equipment, short detection time, realization of rapid and accurate detection, realization of visual detection in combination with a lateral flow test strip, and important application values for the infection detection of the Mycobacterium tuberculosis complex strain and the drug resistance detection of Mycobacterium tuberculosis.

The invention relates to a method for detecting four tuberculosis rifampicin, isoniazide and fluoroquinolones-resistant genes. The method comprises the following steps: designing primers capable of covering full lengths of GyrA, lnhA, katG and rpoB genes; merging the four gene primers and forming a primer pool; amplifying amplicons capable of covering full lengths of drug-resistance-related genes; establishing complete an SV-MTB library; and detecting and acquiring drug-resistant sites. By the method, multiple mutation sites of a multiple-drug-resistant strain can be detected at one time and tuberculosis patients can be scientifically, safely and accurately guided to take the medicine.

The invention provides a kit for detecting staphylococcus hominis. The kit comprises a guide RNA specifically targeting a staphylococcus hominis rpoB gene, amplification primer pairs, hydrated TwistAmp basic kit reaction drying balls, an LbCas12a protein, a single-stranded DNA probe (ssDNA), a Ribonuclease Inhibitor and a buffer solution. The kit is used for detecting the staphylococcus hominis, the detection specificity is high, and the staphylococcus hominis can be distinguished from other staphylococcocci including staphylococcus aureus, staphylococcus epidermidis, staphylococcus warneri, staphylococcus capitis and staphylococcus haemolyticus. The RNA sequence is used for detection, the consumed time is about 1 hour, no PCR instrument is needed, the requirements for equipment are low and significantly lower than those of a traditional bacterial culture method or PCR sequencing method, and the clinical practical value is high.

The invention discloses a primer for tubercle bacillus rifampicin drug-resistant fast detection and a kit for tubercle bacillus rifampicin drug-resistant fast detection. The primer comprises at least one group of following primers: the first group: rpoBForwarD: CGCCGCGATCAAGGAGTTC and rpoBReverse: GCCCGGCACGCTCATGT; the second group: rpoB-F: AGCCAGCTGAGCCAATTCAT and rpoB-R: GCCCGGCACGCTCACGT; and the third group: rpoB516-F: AGGAGTTCTTCGGCACCAG and rpoB516-R: GCACGCTCACGTGACAGAC.

The invention discloses a diagnostic method for rifampicin resistant mycobacterium tuberculosis. In the principle of the diagnostic method, four specific primers are designed according to the specificity of mutation loci of a mycobacterium tuberculosis rpoB gene, a deoxyribonucleic acid (DNA) template of a sample is amplified at the temperature of between 63 and 65 DEG C by using the four specific primers and DNA polymerase with strand displacement activity, the amplification efficiency can reach 109 to 1,010 copies within a short time, and color change is observed by adding SYBR Green I to determine a result. The diagnostic method has the advantages of high sensitivity, high specificity and the like, is convenient and quick, has relatively high reference value on the diagnosis and clinical administration of the rifampicin resistant mycobacterium tuberculosis, and is suitable for popularization and application.

The invention belongs to the field of microorganisms, and relates to separation and application of pseudomonas with significant antagonism to plant pathogenic bacteria. The strain XQ10 is separated from tobacco rhizosphere. An API 20 NE parenteral gram-negative bacillus identification result shows that XQ10 belongs to pseudomonas; 16S rRNA and multilocus sequence typing analysis based on gyrB, rpoB and rpoD show that the strain XQ10 belongs to pseudomonas but has a large difference from reported strains in pseudomonas, the strain XQ10 is regarded as a new strain which is not reported yet, and thus the strain is named Pseudomonas shandongensis XQ10. An antagonistic experiment shows that the strain has a significant inhibition effect on various plant pathogenic bacteria.

The invention discloses a method for identifying high-homology marine vibrios based on rpoB genes. The method comprises the steps that firstly, marine vibrio rpoB gene specific primers are designed by analyzing an rpoB gene sequence between marine vibrio strains; secondly, genomic DNA of 50 marine vibrios serves as templates, a proper amplification system and proper amplification conditions are selected for PCR amplification with the primers, and marine vibrios are quickly and accurately identified with the combination of the sequencing technique. By means of the method, marine vibrios high in homology can be easily and quickly detected, the accuracy is high, and the problem that the accuracy in 16S rRNA sequencing identification at present is low is solved. The method can be used for monitoring and detecting water body and clinical samples and carrying out epidemiological investigation and evolution analysis on marine vibrios and the like, relates to the fields of clinical diagnosis, aquaculture, food safety and the like, and has profound and lasting social benefits and high economic benefits.

The invention provides a reagent kit for detecting enterobacter aerogenes. The reagent kit contains a guide RNA specifically targeted to an enterobacter aerogenes rpoB gene, an amplification primer pair, a hydration TwistAmp basic kit reaction drying ball, LbCas12a protein, a single-stranded DNA probe (ssDNA), a Ribonuclease inhibitor and a buffer solution. When the reagent kit is used for detecting the enterobacter aerogenes, the detection specificity is high, and the enterobacter aerogenes can be distinguished from other enterobacter bacteria including enterobacter cloacae, enterobacter gergoviae and enterobacter sakazakii. Besides, when the RNA sequence is used for detection, time consumption is about 1 hour, a PCR instrument is not needed, requirements for equipment are low and are notably lower than those by a traditional bacteria culture method or a PCR sequencing method, and the clinical use value is high.

The invention discloses mycobacterium tuberculosis rifampin-resistance mutation visual detection probes and an application thereof. For rifampin-resistant mutation, mycobacterium tuberculosis rifampin-resistant rpoB gene mutation core region 510-524 amino acids are divided into three regions; three detection probe clusters are designed and synthesized based on all mutation sites included in every region; each probe cluster includes several probe sets, each probe set comprises specific mutation detection B probes. Various probe sets and probe clusters designed in the invention have great discrimination performance for synthesized wild-type and mutant-type detection fragments, can accurately detect the specific mutation sites of the rifampin-resistant mycobacterium tuberculosis rpoB gene mutation core region 510-524 amino acids and have a good application prospect.

The present invention is related to rpoB gene fragments and method for the diagnosis and identification of Mycobacterium tuberculosis and non-lubercuolsis Mycobacterial strains using rpoB gene and it's fragments.

The invention discloses an MTB (mycobacterium tuberculosis) rpoB mutant gene and an application thereof. Compared with a normal rpoB gene, the mutant gene has a c.1843G>A mutation site; a candidate gene screening method is adopted to detect 33 rifampicin-resistant tuberculosis strains in China, the gene mutation site is found for the first time, and the rpoB gene c.1843G>A mutation site in the rifampicin-resistant tuberculosis strains has certain occurrence frequency, so that the rpoB gene c.1843G>A mutation site can be taken as diagnostic basis of drug-resistance molecular mechanisms of rifampicin-resistant strains clinically.

The invention provides a mycobacterium tuberculosis rifampicin and isoniazide drug-resistant mutation detection kit and method, and particularly discloses a method and kit for detecting mycobacterium tuberculosis rifampicin and isoniazide drug-resistant mutation based on a fluorescent PCR melting curve method. The method and kit can be used for rapidly and qualitatively detecting drug-resistant mutations of drug-resistant determining regions of rifampicin drug-resistant genes rpoB and isoniazide drug-resistant genes katG, inhA and ahpC in a positive sputum culture sample of a mycobacterium tuberculosis complex of a tuberculosis patient in vitro.