Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
174 results about "Vibrio vulnificus" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Vibrio vulnificus is a species of Gram-negative, motile, curved rod-shaped (bacillus), pathogenic bacteria of the genus Vibrio. Present in marine environments such as estuaries, brackish ponds, or coastal areas, V. vulnificus is related to V. cholerae, the causative agent of cholera.
Nanosilver-containing antibacterial and antifungal granules and methods for preparing and using the same
InactiveUS6379712B1Improve solubilityPreventing mold build-upPowder deliveryOrganic active ingredientsEscherichia coliDisease
The present invention relates to nanosilver-containing antibacterial and antifungal granules ("NAGs"). The NAGs have longlasting inhibitory effect on a broad-spectrum of bacteria and fungi, which include, but are not limited to, Escherichia coli, Methicillin resistant Staphylococcus aureus, Chlamydia trachomatis, Providencia stuartii, Vibrio vulnificus, Pneumobacillus, Nitrate-negative bacillus, Staphylococcus aureus, Candida albicans, Bacillus cloacae, Bacillus allantoides, Morgan's bacillus (Salmonella morgani), Pseudomonas maltophila, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Bacillus subtilis, Bacillus foecalis alkaligenes, Streptococcus hemolyticus B, Citrobacter, and Salmonella paratyphi C. The NAGs contain ground stalk marrow of the plant Juncus effusus L. which has been dispersed with nanosilver particles. The nanosilver particles are about 1-100 nm in diameter. Each of the nanosilver particles contain a metallic silver core which is surrounded by silver oxide. The present invention also provides a process for making the NAGs. The NAGs can be used in a variety of healthcare and industrial products. Examples of the healthcare products include, but are not limited to, ointments or lotions to treat skin trauma, soaking solutions or cleansing solutions for dental or women hygiene, medications for treating gastrointestinal bacteria infections, sexual related diseases, and eye diseases. Examples of industrial products include, but are not limited to, food preservatives, water disinfectants, paper disinfectants, construction filling materials (to prevent mold formation).
Owner:LEGEND WIN FINANCE
Nanosilver-containing antibacterial and antifungal granules and methods for preparing and using the same
Owner:LEGEND WIN FINANCE
Lactobacillus plantarum and application thereof
ActiveCN105132322AIncrease production capacityGood for healthBacteriaMicroorganism based processesEscherichia coliFeed conversion ratio
The invention discloses lactobacillus plantarum GLM101 and an application thereof in preparing a feed additive. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) with the preservation number CGMCC No. 11156. The lactobacillus plantarum GLM101 has very strong inhibiting ability for escherichia coli, staphylococcus aureus, salmonella typhi, vibrio vulnificus and aeromonas hydrophila, and also has excellent acid-resisting and cholate-resisting abilities. The lactobacillus plantarum GLM101 can be used for adjusting the microecological balance inside the intestines of animals, has the action of enhancing the nonspecific immunity function to prevent diseases, and also can provide trophic factors, promote digestive absorption of nutrients, promote growth of animals, and improve the feed conversion ratio.
Owner:GUANGZHOU GLAM BIOTECH
LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and detection method using same
InactiveCN103160604AHigh detection sensitivityShort reaction timeMicrobiological testing/measurementFluorescence/phosphorescenceVibrio vulnificusTrue positive rate
The invention discloses a LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and a detection method using the same, and particularly relates to a group of primers for detecting Vibrio vulnificus, a kit containing the primers and a detection method using the same. The primers have oligonucleotide sequences shown as SEQ ID NOs.1-6 in a sequence table. The kit disclosed by the invention is high in sensitivity and specificity, low in cost and simple to operate.
Owner:BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU INSPECTION & QUARANTINE TECH CENT
Primers for loop-mediated isothermal amplification-lateral flow dipstick (LAMP-LFD) detection of vibrio vulnificus and probe sequences
ActiveCN103614466AHigh detection sensitivityHigh sensitivityMicrobiological testing/measurementMicroorganism based processesVibrio vulnificusMicrobiology
The invention discloses primers for loop-mediated isothermal amplification-lateral flow dipstick (LAMP-LFD) detection of a vibrio vulnificus and probe sequences. The primers are characterized by including three pairs of LAMP primers, namely TolC-F3, TolC-B3, TolC-FIP, TolC-BIP, TolC-LF and TolC-LB, and a probe TolC--HP, wherein the Van-FIP is a biotin labeling primer at 5' terminal; the probe TolC-HP is a fluorescein isothiocyanate FITC labeled probe at the 5' terminal; concrete sequences are shown in SEQ NO1-NO7 in a sequence table. The primer has the advantages of good quickness, specificity and sensitivity and simple demands on instruments; early diagnosis and detection of the vibrio vulnificus are facilitated; the demands of a basic-level detection mechanism and field epidemic focus detection can be met.
Owner:NINGBO UNIV
Bacillus amyloliquefaciens and its bacterial depressant and use
ActiveCN106318880AGrowth inhibitionInhibition of reproductionBiocideBacteriaAquatic animalMicrobial agent
The invention relates to Bacillus amyloliquefaciens V4. The Bacillus amyloliquefaciens V4 is preserved in the China general microbiological culture collection center and has a preservation number of CGMCC NO. 10149. The Bacillus amyloliquefaciens V4 strain and / or microbial agent can produce bacteriocin for antagonizing vibrio pathogens and pathogenic aeromonas at seedling growing and culture temperatures of common culture water, inhibit vibrio vulnificus, vibrio natriegen, vibrio harveyi, black sea vibrio, aeromonas hydrophila and aeromonas salmonicida growth and breeding, effectively control aquatic animal infectious disease generation and propagating caused by vibrio pathogens and pathogenic aeromonas, reduce aquatic animal mortality and a forage coefficient and promote aquatic animal weight gain.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Reagent kit and process for detecting Vibrio vulnificus in circular mediated constant temperature amplification method
InactiveCN101020927AGuaranteed reliabilityStrong specificityMicrobiological testing/measurementFermentationVibrio vulnificusBiology
The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Mucosal vaccine adjuvants containing bacterial flegellins as an active component
ActiveCN1909924ABacterial antigen ingredientsAntiinfectivesListerella paradoxaListeria monocytogenes
Owner:李浚行 +1
Microbial preparation, aquatic feed and aquaculture method
InactiveCN109566919AIncrease food intakeIncrease growth rateFood processingClimate change adaptationVibrio parahaemolyticusPseudomonas
The invention discloses a microbial preparation, an aquatic feed and an aquaculture method and relates to the technical field of aquaculture. The microbial preparation comprises bdellovibrio and probiotic. Optimally, the probiotic is selected from any one of lactobacillus bulgaricus, lactobacillus delbrueckii, enterococcus faecalis, lactobacillus casei, lactobacillus acidophilus, rhodopseudomonaspalustris, clostridium butyricum, bacillus laterosporus, bacillus pumilus, bacillus coagulans, bacillus licheniformis, bacillus subtilis and lactobacillus plantarum. The microbial preparation has thecharacteristics of capability of increasing food intake of aquaculture animals, capability of promoting growth rate, survival rate and immunity of organisms, and the like. Besides, the microbial preparation is capable of effectively preventing and treating the problems of diseases caused by pathogenic bacteria, such as vibrio parahaemolyticus, vibrio harveyi, luminous vibrio, vibrio alginolyticus,vibrio campbellii, vibrio fluvialis, vibrio vulnificus, aeromonas, vibrio cholerae, pseudomonas and salmonella.
Owner:SHANGHAI LYUAO BIOTECH CO LTD
Gene chip for detecting 11 types of common infectious diarrheal disease pathogen and application thereof
InactiveCN103911443AHigh detection throughputStrong specificityMicrobiological testing/measurementAgainst vector-borne diseasesEscherichia coliAeromonas
The invention relates to a gene chip and an application, which belongs to the biological detection field. The invention designs a set of detection probes by aiming at 11 types of common infectious diarrheal disease pathogen microorganism in clinic, and the gene chip containing the set of the probe. The detection probes comprises a vibrio parahaemolyticus probe, a vibrio vulnificus, a vibrio cholera probe, a vibrio alginolyticus probe, a vibrio furnissii probe, a shigella probe, an escherichia coli probe, an aeromonas probe, a salmonella probe, a campylobacteria probe, and a proteusbacillus vulgaris probe; the above mentioned probe sequence is shown as SEQ ID No: 1-117. The gene chip and probe can detect 11 types of common infectious diarrheal disease pathogen, the detection flux is high, the specialty is strong, the sensitivity is high, and the detection is rapid and effective.
Owner:YANTAI YUHUANGDING HOSPITAL
Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method.
InactiveCN102816840AEfficient enrichmentDetection speedMicrobiological testing/measurementFluorescence/phosphorescenceVibrio vulnificusSpecific detection
The invention discloses a quadruple fluorescent PCR kit for detection of pathogenic vibrios in a water body and a detection method. According to the method, innovative bacterium enrichment reagent technology, DNA extraction reagent technology, specific fluorescent probe hybridization PCR detection technology and multiplex PCR technology are employed, bacterium enrichment culture of a sample is not needed, false positive interference is minimized as much as possible on the premise that high sensitivity is maintained, and four kinds of vibrios can be detected at one time. The invention mainly has the following beneficial effects: no need for bacterium enrichment of the sample in advance; high sensitivity and good specificity in detection of bacteria; reduction of the false positive incidence in conventional PCR amplification; and realization of rapid, accurate and specific detection of vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio flurialis at one time.
Owner:NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Gene chip for detecting ten types of pathogenic bacteria in sea areas
InactiveCN103540668AReduce dosageImprove throughputMicrobiological testing/measurementAgainst vector-borne diseasesVibrio anguillarumVibrio parahaemolyticus
The invention discloses a gene chip for detecting ten types of pathogenic bacteria in sea areas. The gene chip comprises a solid phase slide on which a quality control probe and a detection probe are arranged, wherein the nucleotide sequence components of the detection probe are shown in SEQ ID NO.1-SEQ ID NO.27. The gene chip is capable of simultaneously detecting enterobacter cloacae, edwardsiella tarda, streptococcus faecalis, vibrio fortis, vibrio harveyi, vibrio parahaemolyticus, vibrio splendidus, vibrio vulnificus, vibrio anguillarum and shewanella smarisflavi just in the presence of DNA (deoxyribose Nucleic Acid) without need of live bacteria. The gene chip has remarkable advantages of high throughput, parallelism, miniaturization, automation, rapidness, sensitiveness, quantification, small use amount, and the like.
Owner:NINGBO UNIV
Prepn and usage of outer membrane protein subunit vaccine of seawater fish morbid vibrio
InactiveCN101020051AChemical properties determinedImmunospecific stabilityAntibacterial agentsPharmaceutical non-active ingredientsDiseaseBacteroides
The present invention is preparation and usage of outer membrane protein subunit morbid vibrio vaccine for seawater fish. The vaccine is prepared through extracting two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc, and adding immunostimulating complex. The vaccine preparing process includes culturing vibrio, extracting outer membrane protein and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.
Owner:GUANGDONG OCEAN UNIVERSITY
Gene chip for detecting nine pathogenicity vibrios in marine products
InactiveCN103820558AImprove accuracyGood repeatabilityMicrobiological testing/measurementAgainst vector-borne diseasesMicrobiologyComplementary DNA
The invention relates to a gene chip for detecting nine pathogenicity vibrios in marine products and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe includes one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of a vibrio hollisae, a vibrio vulnificus, a vibrio cholera, a vibrio parahemolyticus, a vibrio harveyi, a vibrio alginolyticus, a vibrio furnissi, a vibrio mimicus and a vibrio damsel, 2) complementary DNA sequences of the DNA sequences selected in the DNA sequences in 1), 3) complementary RNA sequences of the selected DNA sequences in 1) or 2). The kit comprises the gene chips. The gene chip for detecting nine pathogenicity vibrios in marine products and the kit thereof provided by the invention are used for detecting the nine pathogenicity vibrios in marine products, and have the advantages of simplicity in operation, good sensitivity and strong repeatability.
Owner:ZHOUSHAN INST OF CALIBRATION & TESTING FOR QUALITY & TECHNICAL SUPERVISION
Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique
InactiveCN101113473AStrong specificityAccurate identificationMicrobiological testing/measurementAgainst vector-borne diseasesBiotechnologyMicroorganism
The invention discloses a method by using composite fluorescence PCR technique to detect food-borne pathogenic vibrio and pertains to bacteria detection technical field. The main technic proposal is to design a primer group sequence. The pathogenic vibrio is common pathogenic bacteria in food and has a serious effect on human health. The quick and accurate detection of pathogenic vibrio in food is a main premise condition for effective prevention and control of pathogen bacteria infection. The food-borne pathogenic vibrio required detection mainly comprises parahemolytic vibrio, vibrio cholerae and vibrio vulnificus. The invention overcomes technical shortage in the prior art aiming at the object bacteria and provides the quick and low-cost detection method by using composite fluorescence PCR technique to detect parahemolytic vibrio, vibrio cholerae and vibrio vulnificus. The method can use one-diode PCR reaction and primarily screen parahemolytic vibrio, vibrio cholerae and vibrio vulnificus.
Owner:ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology
InactiveCN101348835AAccurate identificationRapid identificationMicrobiological testing/measurementAgainst vector-borne diseasesVirulent characteristicsVibrio vulnificus
The invention relates to a reagent kit and a method for detecting Vibrio vulnificus by means of a loop-mediated isothermal amplification (LAMP) technology, belonging to the pathogen diagnosis field. The main technical proposal comprises the following steps that by means of the LAMP technology, four high-specificity primers are designed according to six zones of virulence-correlated gene of Vibrio vulnificus, thereby realizing specific detection of Vibrio vulnificus. Compared with the prior method, the method requires simple equipment and operation steps, and has the advantages of quickness, high specificity, strong stability, high sensitivity and the like; moreover, the method has lower detection cost, and is suitable for common clinic and field detection.
Owner:NANKAI UNIV
Gene chip detecting marine pathogenic vibrios, and preparation method and detection method thereof
ActiveCN105133040AQuick checkSensitive detectionNucleotide librariesMicrobiological testing/measurementVibrio anguillarumArcobacter
The invention discloses a gene chip detecting marine pathogenic vibrios, and a preparation method and a detection method thereof. The gene chip comprises a solid-phase carrier and detection probes fixedly disposed on the solid-phase carrier, and the detection probes comprise vibrio vulnificus gyrB gene probe, vibrio vulnificus virulence gene hemA probe, vibrio splendidus gyrB gene probe, vibrio splendidus virulence gene toxR probe, vibrio harveyi gyrB gene probe, vibrio harveyi virulence gene hemA probe, vibrio parahaemolyticus gyrB gene probe, vibrio parahaemolyticus virulence gene toxS probe, vibrio anguillarum gyrB gene probe and vibrio anguillarum virulence gene hem probe which are respectively shown as SEQ NO 1-10. The gene chip is firstly applied to detection on marine pathogenic vibrios. The gene chip is capable of rapidly sensitively detecting target bacterium infectio, also is good in repeatability and strong in signal, and does not easily cause a nonspecific signal.
Owner:浙江正合谷生物科技有限公司
Non-diagnostic method for detecting Vibrio vulnificus through TaqMan probe fluorescence RT-PCR
InactiveCN102827925AReduce pollutionReduced Pollution ChancesMicrobiological testing/measurementMicroorganism based processesConserved sequencePollution
The invention discloses a non-diagnostic method for detecting Vibrio vulnificus through TaqMan probe fluorescence RT-PCR. The method comprises the following steps: comparing through adopting the DNA sequence of a Vibrio vulnificus hemolysin A (vvhA) gene as a target sequence, selecting a conserved region, determining the conserved sequence of the vvhA gene, and designing the real time PCR primers and the probes of the Vibrio vulnificus. The Vibrio vulnificus RT-PCR detection method which utilizes the specific fluorescence probes to implement a completely-closed tube type operation enables the amplified product pollution opportunity to be substantially reduced, the experiment steps, the experiment time and the reagent consumption to be reduced, the PCR in the invention to be different from routine PCR, electrophoretic identification to be not needed, and the appearance of a false positive result to be difficult because of difficult environmental protection. The method which can rapidly detect pathogenic bacteria has the advantages of high sensitivity, high specific degree and high lower limit of detection, can be applied to the detection of the Vibrio vulnificus in frontier port environment water, aquatic products and night soil of diarrhoea patients, and has a very high application value.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE
Gene chip for detecting important pathogenic bacteria in aquatic product and kit thereof
InactiveCN102311993AImprove accuracyGood repeatabilityMicrobiological testing/measurementAgainst vector-borne diseasesBacillus cereusStaphylococcus aureus
The invention relates to a gene chip for detecting important pathogenic bacteria in an aquatic product and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe; the oligonucleotide probe comprises one or more of the following nucleotide sequences: (1) DNA (Deoxyribonucleic Acid) sequences selected from proteus mirabilis 1, proteus vulgaris, salmonella, vibrio parahaemolyticus, vibrio cholerae, Listeria monocytogenes, staphylococcus aureus, streptococcus pyogenes, vibrio vulnificus, bacillus cereus cluster, Shigella and pathogenic Y. enterocolitica ail gene; (2) complementary DNA sequences of the DNA sequences selected in the (1); (3) complementary RNA (Ribonucleic Acid) sequences of the DNA sequences in the (1) or (2). The kit comprises the gene chip. The gene chip and the kit can be used for detecting the important pathogenic bacteria in an aquatic product, are convenient to operate, high in precision and strong in repeatability.
Owner:TIANJIN BIOCHIP TECH CO LTD
Alginate lyase gene algp and its preparation method and expression
ActiveCN105296454AFermentationVector-based foreign material introductionVibrio vulnificusAlginate lyase
The invention relates to alginate lyase gene algp and its preparation method and expression and discloses alginate lyase of Vibrio vulnificus origin, which has good protein stability and high bioactivity. The invention also discloses alginate lyase gene algp, a carrier and a host cell containing the alginate lyase gene algp, and a method of recombinant expression of the alginate lyase. The technical scheme enables large-scale production of recombinant alginate lyase at lower cost.
Owner:EAST CHINA UNIV OF SCI & TECH
Method for producing and using trauma vibrio fast detection kit
InactiveCN101245375AGuaranteed reliabilityStrong specificityMicrobiological testing/measurementMicroorganism based processesVibrio vulnificusBetaine
Owner:INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Double-LAMP (loop-mediated isothermal amplification) method for simultaneously detecting vibrio parahaemolyticus and vibrio vulnificus
ActiveCN105219845AMicrobiological testing/measurementMicroorganism based processesMetalloprotease GeneLoop-mediated isothermal amplification
The invention discloses a double-LAMP (loop-mediated isothermal amplification) detecting method, and belongs to the technical field of molecular biology. By the aid of the method, vibrio parahaemolyticus and vibrio vulnificus can be simultaneously detected. An LAMP detection system comprises primer groups for detecting vibrio parahaemolyticus genes OmpA and vibrio vulnificus metalloprotease genes, and each primer group contains a pair of outer primers F3 and B3 for the OmpA genes and the metalloprotease genes and a pair of inner primers FIP and BIP; PstI and BamHI restriction enzyme cutting sites are respectively arranged on the inner primers BIP. The double-LAMP method has the advantages of high sensitivity and detection speeds, good specificity, simplicity in operation and visual and clear result observation.
Owner:QINGDAO AGRI UNIV
An antibiotic peptide and its coded sequence and use
The present invention provides one kind of antibiotic peptide and its coding polynucleotides and use. The antibiotic peptide contains the amino acid sequence from site 1 to site 25 in the sequence table <400>2 of the sequence table. The polynucleotides coding the antibiotic peptide include the nucleotide sequence of amino acid sequence form site 1 to site 25, from site 1 to site 45 or from -22 site to site 45 in the sequence table <400>2 of the sequence table or their complementary sequences. The antibiotic peptide has obvious killing effect on several kinds of bacteria, and has lowest killing concentration smaller than 10 micro mol / L to algae dissolving vibrio, vibrio vulnificus, parahemolytic vibrio, Pasteuvella multocida, etc. and may be used in preparing antibiotic, especially that for preventing and treating bacterial diseases of aquatics.
Owner:SUN YAT SEN UNIV
Vibrio vulnificus flagellin monoclonal antibody and antigen capture ELISA (Enzyme Linked Immunosorbent Assay) kit
ActiveCN103044545AImprove featuresImprove stabilityImmunoglobulins against bacteriaTissue cultureProtein.monoclonalVibrio vulnificus
The invention discloses a vibrio vulnificus flagellin monoclonal antibody and an antigen capture ELISA (Enzyme Linked Immunosorbent Assay) kit. The vibrio vulnificus flagellin monoclonal antibody is generated and secreted by a hybridoma cell strain with the preservation number of CGMCC No.6755. The vibrio vulnificus flagellin monoclonal antibody disclosed by the invention can be used for detecting the vibrio vulnificus. The invention also discloses a vibrio vulnificus flagellin capture ELISA kit.
Owner:BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU INSPECTION & QUARANTINE TECH CENT
Screening and application of fish-derived enterococcus faecium R8
ActiveCN108660097AHigh activityIncrease weight gainAntibacterial agentsBacteriaStaphylococcus haemolyticusVibrio parahaemolyticus
The invention provides enterococcus faecium R8 that is screened and separated from a crucian intestinal tract and has safe and prebiotic characteristics. The enterococcus faecium is collected in ChinaGeneral Microbiological Culture Collection Center (CGMCC) of China Committee for Culture Collection of Microorganisms on January 17, 2018 and has a collection number of CGMCC NO. 15229. The enterococcus faecium is high in heat resistance, acid-base resistance and stress resistance and more significant in probiotic performance, has a relatively obvious inhibiting effect on common aquatic pathogenic bacteria such as aeromonas veronii, staphylococcus haemolyticus, vibrio parahaemolyticus and vibrio vulnificus and can be widely applied to aquaculture as a feed additive.
Owner:TIANJIN AGRICULTURE COLLEGE
Immunomagnetic bead containing OmpU antibody, preparation of immunomagnetic bead and method for capturing pathogenic vibrios and detecting pathogenic vibrios through multiplex PCR by utilizing immunomagentic bead
InactiveCN105859883AQuick checkFast, accurate and efficient detectionMicrobiological testing/measurementImmunoglobulins against bacteriaAntigenMultiplex pcrs
The invention relates to an immunomagnetic bead containing an OmpU antibody, preparation of the immunomagnetic bead and a method for capturing pathogenic vibrios and detecting the pathogenic vibrios through multiplex PCR by utilizing the immunomagnetic bead. PCR amplification of an OmpU gene is conducted by taking genomes of the vibrios as templates, pure OmpU recombinant protein is obtained to serve as an antigen to prepare the antibody, and the immunomagnetic bead containing the OmpU antibody is prepared through the coupling-washing process; the immunomagnetic bead can capture multiple vibrios, and then the vibrios are identified by multiplex PCR specific primers which are designed on the basis of a danJ gene. The immuomagnetic bead can simultaneously detect the vibrio parahaemolyticus, the vibrio cholera, the vibrio alginolyticus, the vibrio vulnificus and the vibrio mimicus at most and can be widely applied to environment and import and export food inspection. The immuomagnetic bead combines the specificity of immune separation and the high efficiency of PCR amplification, has the capacities of separation, concentration and enrichment, can efficiently separate and enrich the low-concentration pathogenic bacteria in a sample, reduces or eliminates inhibition and influences of the sample to PCR, improves detection limitation and has the very good application prospect.
Owner:SHANTOU UNIV
Multiplex-polymerase chain reaction (PCR) detection method capable of simultaneously detecting vibrio parahaemolyticus, vibrio vulnificus and vibrio alginolyticus
InactiveCN103103266ASimple methodShort timeMicrobiological testing/measurementAgainst vector-borne diseasesVibrio vulnificusVibrio parahemolyticus
The invention discloses a multiplex-polymerase chain reaction (PCR) detection method capable of simultaneously detecting vibrio parahaemolyticus, vibrio vulnificus and vibrio alginolyticus. The detection method comprises the steps of firstly, preparing a deoxyribonucleic acid (DNA) template of a detected object to put into a reaction tube; putting three vibrio primers into the reaction tube in step a to carry out multiplex-PCR reaction, wherein the primer concentrations are 1-20pmol / mu l, 1-20pmol / mu l and 1-30pmol / mu l in sequence; the primer sequences of the vibrio parahaemolyticus are 5'-GCAGCTGATCAAAACGTTGAGT-3', and 5'-ATTATCGATCGTGCCACTCAC-3'; the primer sequences of the vibrio vulnificus are 5'-TTCCAACTTCAAACCGAACTATGAC-3', and 5'-ATTCCAGTCGATGCGAATACCGAATACGTTG-3'; and the primer sequences of the vibrio alginolyticus are 5'-CGAGTACAGTCACTTGAAAGCC-3', and 5'-CACAACAGAACTCGCGTTACC-3'.
Owner:DALIAN OCEAN UNIV
Mutant blue fluorescent protein and method of using the same for fluorescence resonance energy transfer and blue fluorescent fish
InactiveUS20120238726A1High fluorescence quantum yieldHigh fluorescence intensityBacteriaSugar derivativesWild typeA-DNA
The present invention discloses a mutant blue fluorescent protein (BFP), mutated by an error-prone PCR method or a DNA shuffling method with using a BFPvv D7 of SEQ ID NO:2 as parents, obtained from a wild type blue fluorescent protein BfgV of SEQ ID NO:1, obtained from Vibrio vulnificus, wherein a set of mutation positions of the mutant BFP corresponding to SEQ ID NO:2 comprises position 176 and position 178. In a preferred embodiment, the set of mutation positions of the mutant BFP corresponding to SEQ ID NO:2 comprises a S176R mutation or a V178I mutation. Moreover, methods of using the blue fluorescent proteins from Vibrio vulnificus for fluorescence resonance energy transfer (FRET) and a blue fluorescent fish are also provided.
Owner:NAT CHENG KUNG UNIV
Bacillus capable of resisting various aquaculture pathogenic bacteria and application thereof
ActiveCN107964517AGrowth temperatureSuitable salt for growthBacteriaAnimal feeding stuffBacteroidesShewanella putrefaciens
The invention discloses a bacterial strain capable of resisting various aquaculture pathogenic bacteria and application thereof. The antagonistic bacterium is Bacillus amyloliquefaciens InAD-160, andthe microbial collection number is CGMCC No.14030. The Bacillus amyloliquefaciens InAD-160 is obtained by separating deep seawater of the Indian Ocean, can inhibit growth of various aquaculture pathogenic bacteria like Edwardsiella tarda, Aeromonas hydrophila, Shewanella putrefaciens and Vibrio vulnificus and can be used for preventing and controlling aquaculture diseases caused by the same. The Bacillus amyloliquefaciens InAD-160 obtained from deep sea is a biological prevention and control potential strain which is high in prevention and control efficiency and wide in prevention and controlrange and has great application and development prospect.
Owner:THE FIRST INST OF OCEANOGRAPHY SOA
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com