A novel bacteriophage for preventing and treating vibrio disease of aquatic animals and application thereof

By developing the broad-spectrum bacteriophage 033B, the problem of various bacterial diseases in aquaculture has been solved, achieving efficient and safe disease prevention and control.

CN115786277BActive Publication Date: 2026-07-07XIAMEN CANCO BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211557697.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-06
Publication Date
2026-07-07
Estimated Expiration
2042-12-06

AI Technical Summary

Technical Problem

In existing technologies, antibiotics are not very effective in preventing and controlling Vibrio diseases in aquatic animals, and they can easily lead to increased drug resistance in pathogens, making it difficult to effectively solve the problem of various bacterial infections in aquaculture.

Method used

A novel bacteriophage, 033B, was developed, which has a broad phage spectrum and can simultaneously lyse six different hosts, including 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, and 17 strains of Vibrio alginolyticus, for use in the preparation of microecological preparations for prevention and control.

Benefits of technology

Bacteriophage O33B significantly reduced the mortality rate of aquatic animals, effectively solved the problem of various bacterial diseases, and was highly safe and did not cause environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The application provides a new bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof, the bacteriophage is preserved in China Center for Type Culture Collection on September 4, 2020, and the preservation number is CCTCC M 2020465. The bacteriophage is a new species of bacteriophage of the Caudovirales class and Queuovirinae subfamily, the whole genome of the bacteriophage is OP331229.1 in the NCBI official website GeneBank. The bacteriophage has a wide phage spectrum, can crack 6 different species and genera of vibrio at the same time, can crack 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, 17 strains of Vibrio alginolyticus, 13 strains of Vibrio vulnificus, 11 strains of Vibrio campbellii and 9 strains of Vibrio cholerae at the same time, can more effectively solve the problem of multiple bacterial disease infections in aquaculture, and can be used as a microecological preparation for preventing and treating vibrio diseases such as Vibrio parahaemolyticus, Vibrio harveyi and Vibrio alginolyticus of aquatic animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of aquatic pest control technology, specifically to a novel bacteriophage for the prevention and control of Vibrio diseases in aquatic animals and its application. Background Technology

[0002] Vibrio parahaemolyticus ( Vibrio parahaemolyticus Vibrio parahaemolyticus (V. parahaemolyticus) belongs to the Vibrioceae family and the Vibrio genus. It is a halophilic, Gram-negative bacterium. Widely distributed in various aquatic environments, such as marine, coastal, and freshwater environments, it is a normal flora in marine aquaculture environments and aquatic animals. It is a significant pathogen causing diseases in farmed animals and a globally prevalent foodborne pathogen. It can cause vibriosis in marine animals, and in humans, consuming food contaminated with Vibrio parahaemolyticus can cause various gastroenteritis symptoms (such as abdominal pain, diarrhea, nausea, vomiting, and fever). Severe cases may lead to dehydration, shock, coma, and even death. It not only seriously threatens human health but also causes enormous economic losses to the aquaculture industry. Currently, the prevention and control of Vibrio parahaemolyticus in my country mainly relies on antibiotics and certain drugs. The overuse of antibiotics is already very serious, leading to environmental pollution and the emergence of "superbugs." With increasing environmental awareness and the implementation of sustainable agricultural development strategies, the search for environmentally friendly, safe, and effective biological control measures is receiving increasing attention.

[0003] Aquatic bacteriophage microecological preparations possess advantages such as environmental friendliness, safety against non-target organisms, and specific bactericidal effects against aquatic diseases. Unlike antibiotics and chemical agents, they are entirely natural, green, and environmentally friendly products, widely used in aquaculture and food safety. Their role in replacing antibiotics for disease prevention and control in aquaculture, and overcoming the problem of antibiotic resistance in pathogens caused by excessive antibiotic use, has become a hot topic in current biotechnology research. Currently, antibiotics and other chemical agents are not very effective in controlling aquatic diseases, exhibiting short-lived effects, poor efficacy, and a tendency to lead to increased pathogen resistance. Bacteriophages are highly specific to their hosts, generally only capable of lysing one host; therefore, narrow-spectrum bacteriophages generally cannot solve the problem of multiple bacterial infections occurring in aquaculture. The bacteriophage 033B of this invention has a broad phage spectrum, capable of simultaneously lysing six different hosts, including 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, 17 strains of Vibrio alginolyticus, 13 strains of Vibrio vulnificus, 11 strains of Vibrio cannibalus, and 9 strains of Vibrio cholerae. This allows for more effective solutions to various bacterial diseases occurring in aquaculture. Furthermore, the bacteriophage cannot grow and reproduce independently after leaving its host microorganisms, nor can it infect other organisms or humans, thus posing no biological hazard or environmental pollution. Therefore, the isolation and screening of novel bacteriophages with high lytic capacity for antibacterial and bactericidal purposes, as described in this invention, is not only effective but also highly safe, holding significant importance for aquatic biological control. Summary of the Invention

[0004] This invention aims to at least partially solve one of the technical problems in related technologies. To this end, this invention provides a novel bacteriophage for the prevention and control of Vibrio diseases in aquatic animals. This bacteriophage has a broad phage spectrum, capable of simultaneously lysing six different hosts, and can lyse 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, and 17 strains of Vibrio alginolyticus. It can more effectively solve the problem of various bacterial diseases in aquaculture and has good application prospects.

[0005] Therefore, in a first aspect, this invention proposes a novel bacteriophage for the prevention and control of Vibrio diseases in aquatic animals. This bacteriophage was deposited on September 4, 2020, at the China Center for Type Culture Collection (CCTCCM2020465), and is classified as follows: Vibrio parahaemolyticus Phage Phage 033B, deposited at Wuhan University, Wuhan, China. The phage 033B isolated and screened according to this invention has a broad phage spectrum, capable of simultaneously lysing six different hosts, including 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, and 17 strains of Vibrio alginolyticus. It can more effectively solve various bacterial disease infections in aquaculture and has promising application prospects.

[0006] Optionally, the bacteriophage is a new species of bacteriophage belonging to the class Tail Phages and the subfamily Queuovirinae, whose complete genome is accessed in GeneBank on the NCBI website with the accession number OP331229.1.

[0007] Optionally, the bacteriophage has two specific gene fragments, the nucleic acid sequences of which are shown in Example 4. Therefore, these two specific gene fragments can serve as typical characteristics for identifying the bacteriophage.

[0008] Optionally, the bacteriophage has two specific PCR amplification primers, as shown in Example 4. Therefore, these two specific PCR amplification primers can serve as typical characteristics for identifying the bacteriophage.

[0009] In a second aspect, the present invention provides a microecological preparation comprising the novel bacteriophage described above for the prevention and control of Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus diseases in aquatic organisms. According to embodiments of the present invention, this microecological preparation can be used to prevent and control Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus diseases in aquatic organisms.

[0010] Optionally, the titer of the bacteriophage is 6.7 × 10⁻⁶. 11 pfu / mL.

[0011] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0012] Figure 1 This is a phage plaque diagram of phage 033B according to an embodiment of the present invention.

[0013] Figure 2 This is a transmission electron microscope image of bacteriophage 033B according to an embodiment of the present invention.

[0014] Figure 3 This is a phylogenetic tree diagram of phage 033B according to an embodiment of the present invention.

[0015] Figure 4 The results of BLAST alignment of phage 033B on NCBI according to an embodiment of the present invention.

[0016] Figure 5 This is an electrophoresis diagram of the PCR amplification products of two specific genes according to an embodiment of the present invention. Detailed Implementation

[0017] The technical solution of the present invention is illustrated below through specific examples. It should be understood that the one or more method steps mentioned in the present invention do not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps; it should also be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or defining the scope of the present invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the present invention.

[0018] To better understand the above technical solutions, exemplary embodiments of the present invention are described in more detail below. While exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the invention to those skilled in the art.

[0019] The present invention will now be described with reference to specific embodiments. It should be noted that these embodiments are merely descriptive and do not limit the present invention in any way.

[0020] Example 1: Screening and purification of phage 033B

[0021] 1. Isolation of Vibrio parahaemolyticus, the pathogen of diseased grass shrimp

[0022] Diseased grass shrimp from Zhangpu, Fujian Province were collected. The heads of the diseased shrimp were cut off and placed in sterile culture dishes. The heads were rinsed clean with 50 mL of 75% alcohol, ground in a mortar, and then dissolved and mixed thoroughly with 4 mL of sterile water. After standing for 30 minutes, 100 μL of the supernatant was transferred to TCBS (Trametes Chloride-Bacillus parahaemolyticus) culture medium and evenly spread. The mixture was incubated at 32°C for 12 hours. Green colonies were picked and streaked for purification on the same selective medium. This purification process was repeated three times. Single colonies of morphologically consistent strains were picked using an inoculation loop and inoculated into LB broth with a 3% NaCl concentration. The mixture was incubated at 32°C for 12 hours. 500 μL of the bacterial culture was mixed with 500 μL of 40% glycerol and stored at -80°C.

[0023] 2. Large-scale culture of Vibrio

[0024] For the expansion culture of the host bacteria, 3% NaCl was added to LB liquid medium, and the mixture was autoclaved at 121°C for 20 min. After cooling to room temperature, two inoculation methods were used: The first method was single-colony inoculation, where a single colony was picked from the preservation plate and inoculated under aseptic conditions. The fermentation temperature was 32°C, the rotation speed was 150 rpm, and the fermentation time was 12 h. The second method was liquid inoculation, where 10% of the culture medium volume was added to achieve a concentration of 10... 8 The cfu / mL Vibrio parahaemolyticus bacterial solution was fermented in LB liquid medium with a concentration of 3% NaCl at a fermentation temperature of 32℃, a rotation speed of 150 rpm, and a fermentation time of 12 h.

[0025] 3. Screening of bacteriophage 033B.

[0026] Water samples were collected from 25 grass shrimp farming ponds in Zhangzhou and Quanzhou, Fujian Province; Zhanjiang, Guangdong Province; and Haikou, Hainan Province. A bacterial culture-water sample enrichment method was used. 1L of cultured Vibrio parahaemolyticus solution and 1L of water sample were mixed together, and then 1L of fresh LB liquid medium with a 3% NaCl concentration was added for enrichment overnight. The enriched liquid was extracted, centrifuged at 12000 rpm for 10 min, and then filtered twice through a 0.22 μm filter membrane. Bacteriophages were obtained by screening using a spread sampling method. The bacteriophages of this invention were obtained from water samples from grass shrimp ponds in Fotan County, Zhangzhou City, Fujian Province.

[0027] 4. Purification of bacteriophage O33B

[0028] Select a single plaque, incubate it overnight in 1 mL of SM buffer (Scientific Phygene), then centrifuge at 12000 rpm for 10 min, filter twice through a 0.22 μm filter membrane, and perform serial dilutions to a final concentration of 10. -6 First, add 100 μL of a solution with a concentration of 4.5 × 10⁻⁶. 8For control, a double-layer plate containing cfu / mL host bacteria was used. For each dilution gradient, 100 μL of host bacteria and phage were mixed in a double-layer plate, incubated overnight at 32°C, and the growth of phage plaques was observed. Single phage plaques were selected and purified three more times.

[0029] 5. Determination of the high-temperature resistance of bacteriophage 033B

[0030] Take 6 containers, each containing 200 mL, with a content of 7.8 × 10⁻⁶. 11 Erlenmeyer flasks containing pfu / mL phage fluid were placed in water baths at 30℃, 40℃, 50℃, 60℃, 70℃, and 80℃ for 12 hours. The thermostability of phage 033B was determined by calculating the phage content after treatment using a double-layer plate test. The results showed that phage 033B remained viable and at a high concentration after 12 hours of treatment at 70℃, while most phages would die significantly or even completely at 60℃. Therefore, phage 033B exhibits strong thermostability.

[0031] Table 1: Determination of the high-temperature resistance of bacteriophage 033B

[0032]

[0033] 6. Determination of acid and alkali resistance of bacteriophage 033B

[0034] Take 7 containers, each containing 200 mL, with a content of 6.6 × 10⁻⁶. 11 Erlenmeyer flasks containing pfu / mL phage fluid were used. The pH of the phage was adjusted to 4, 5, 6, 7, 8, 9, and 10 by adding concentrated sulfuric acid and sodium hydroxide solutions, respectively. After 12 hours of incubation, the acid and alkali resistance of phage 033B was determined by calculating the phage content after treatment using a double-layer plate. The results showed that phage 033B could still survive at pH 5 and 10, and the content remained high. In contrast, most phages would die in large numbers or even completely at pH 5 and 8, indicating that phage 033B has certain acid and alkali resistance.

[0035] Table 2: Determination of acid and alkali resistance of bacteriophage 033B.

[0036]

[0037] 7. Determination of UV tolerance of bacteriophage O33B

[0038] Inside the clean bench, take 12 containers of 10 mL each containing 7.5 × 10⁻⁶ ml of the product. 11Sterile 90mm culture dishes containing pfu / mL phage solution were irradiated under a 20W, 20cm UV lamp for 0, 1h, 2h, 3h, 4h, 5h, 6h, 7h, and 8h. The UV tolerance of phage 033B was determined by calculating the phage content after UV irradiation using a double-layer plate mixing method. The results are shown in Table 3: Phage 033B survived after 8h of UV irradiation with a relatively high content, while most phages died significantly or even completely after 2h of UV irradiation. This indicates that phage 033B has strong UV tolerance.

[0039] Table 3: Determination of UV resistance of phage 033B

[0040]

[0041] 8. Morphological characteristics of bacteriophage 033B

[0042] 20 μL of phage 033B enrichment solution was placed on a copper grid and allowed to stand for 10 min to adsorb. Excess bacterial solution was then blotted away with filter paper. A suitable amount of 3% phosphotungstic acid was then applied for staining for 5 min. After drying, the solution was observed under a transmission electron microscope. The results are as follows: Figure 2 As shown, the selected bacteriophage is a tailed bacteriophage with an icosahedral head, a head length of 66.8±1.5nm, a head width of 66.5±1.2nm, and a tail length of 65.2±1.5nm.

[0043] Example 2

[0044] 1. Determination of the optimal multiple of infection (MOI) of phage O33B against Vibrio parahaemolyticus.

[0045] Take eight 100 mL portions of fresh 3% LB liquid culture medium and treat them separately. Treatment 1 was treated with 1 mL of 10% LB liquid culture medium. 6 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 9 PFU / mL phage solution, treatment 2 simultaneously added 1 mL of solution containing 10 pfu / mL phage. 7 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 9 PFU / mL phage solution, treatment 3, simultaneously added 1mL of solution containing 10 pfu / mL phage. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 9 PFU / mL phage solution, treatment 4, simultaneously added 1mL of solution containing 10 pfu / mL phage. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 8 PFU / mL phage solution, treated for 5 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 7PFU / mL phage solution, treated for 6 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 6 PFU / mL phage solution, treated for 7 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 5 PFU / mL phage solution was added during treatment 8, along with 1 mL of 10 pfu / mL phage solution. 8 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 4 Phage solution containing pfu / mL was cultured at 32℃ and 150 rpm for 12 h before phage titer was measured. The results are shown in Table 4: the highest phage titer was achieved when the optimal multiplicity of infection was 1.

[0046] Table 4: Determination of the optimal multiple of infection (MOI) of phage O33B against Vibrio parahaemolyticus

[0047]

[0048] 2. Large-scale culture of bacteriophage 033B

[0049] The isolated bacteriophages were amplified as follows: 1 L of 3% LB liquid medium was prepared, autoclaved at 121°C for 20 min, cooled to room temperature, and 1 mL of 10% LB liquid medium was added. 9 CFU / mL Vibrio parahaemolyticus solution and 1 mL of solution containing 10 7 The pfu / mL phage fluid was placed in a shaker at 32℃ and 150 rpm for 12 h and then centrifuged at 8000 rpm for 10 min to allow the host bacteria to settle to the bottom. The clear upper layer was collected, and the resulting liquid was the expanded culture of phage 033B.

[0050] 3. Preparation of phage O33B microecological preparation

[0051] Prepare 1 L of 3% LB liquid culture medium, autoclave at 121°C for 20 min, cool to room temperature, and simultaneously add 1 mL of 10% LB liquid culture medium. 9 CFU / mL Vibrio parahaemolyticus bacterial suspension and 1 mL of 10 7Pfu / mL phage fluid was cultured in a shaker at 32℃ and 150 rpm for 12 h as seed culture. This seed culture was first inoculated into a 50L fermenter and cultured at 32℃ and 150 rpm for 12 h. Then, it was inoculated into a 500L fermenter and cultured at 32℃ and 150 rpm for 12 h. The resulting fermentation broth was centrifuged at 8000 rpm for 10 min to allow the host bacteria to settle to the bottom. The clear upper layer was collected, and the supernatant was then filtered through 500 nm and 200 nm ceramic membranes to obtain the phage microecological preparation.

[0052] 4. Determination of phage O33B content

[0053] The bacteriophages were serially diluted to 10-1. -10 First, add only 100 μL of a concentration of 9.1 × 10⁻⁶. 8 A double-layer plate of cfu / mL Vibrio parahaemolyticus was used as a control, starting from 10... -10 Starting with different concentrations, 100 μL of phage dilution and 100 μL of Vibrio parahaemolyticus solution were used to prepare double-layer plates for each concentration. The plates were incubated overnight at 32°C, and the phage content was calculated by observing the number of plaques. The results showed that the phage content was 6.7 × 10⁻⁶. 11 It has a high concentration of pfu / mL and strong ability to infect Vibrio parahaemolyticus.

[0054] Table 5: Determination of phage O33B content

[0055]

[0056]

[0057] 5. Detection test for deletion of virulence genes or harmful genes in phage O33B.

[0058] Bioinformatics analysis of phage 033B yielded results shown in Table 6. Phage 033B did not contain virulence genes or harmful genes.

[0059] Table 6 Open Reading Frames of Phage 033B

[0060]

[0061]

[0062] 6. Phage 033B phylogenetic analysis

[0063] Phylogenetic tree constructed using the whole genome of bacteriophage O33B (e.g.) Figure 3As shown in the figure, phage 033B and the Vibrio phage genome with GeneBank accession number NC_026610 belong to the same branch, but are not in the same branch as other phage genomes.

[0064] Example 3: Lytic ability and preventive effect of bacteriophage O33B

[0065] 1. Determination of the lytic ability of bacteriophage O33B against Vibrio parahaemolyticus

[0066] Bacteriophage 033B was counted and diluted to 1×10⁻⁶. 8 1×10 7 1×10 6 1×10 5 1×10 4 Five concentrations of Pfu / mL were used, with sterile water as a blank control, and each concentration was performed in triplicate. Six tubes of cultured Vibrio parahaemolyticus were taken. Before treatment, the Vibrio parahaemolyticus content was calculated using the dilution plate method. Then, 1 mL of the five concentrations of bacteriophage fluid and sterile water were added to each tube. The tubes were then incubated at 32℃ and 150 rpm for 12 h. The lytic ability of bacteriophage O33B against Vibrio parahaemolyticus was determined by calculating the post-treatment Vibrio parahaemolyticus content using the dilution plate method. The results showed that bacteriophage O33B had a good bactericidal effect against Vibrio parahaemolyticus, and the higher the concentration, the better the effect.

[0067] Table 7: Determination of the lytic activity of phage 033B against Vibrio parahaemolyticus

[0068]

[0069] 2. Host spectrum determination of bacteriophage O33B

[0070] A total of 167 strains of phage host bacteria O33B and other Vibrio species were cultured, including 61 strains of Vibrio parahaemolyticus, 33 strains of Vibrio harveyi, 27 strains of Vibrio alginolyticus, 19 strains of Vibrio vulnificus, 15 strains of Vibrio kansui, and 12 strains of Vibrio cholerae. After incubation at 32℃ and 150 rpm for 12 h, 100 μL of samples with a concentration of 3.8 × 10⁻⁶ were directly spotted. 8 A CFU / mL host bacterial culture was evenly spread on a 3% LB agar plate, and then 20 μL of a 5.3 × 10⁻⁶ concentration was taken. 10 Four drops of pfu / mL phage solution were placed on a plate and incubated overnight at 32°C. The presence of transparent phage plaques was observed, and the lysis ability of phage 033B against 167 strains of Vibrio was determined.

[0071] The results are shown in Table 8: Phage 033B could lyse 117 out of 167 Vibrio strains, including 45 Vibrio parahaemolyticus strains, 22 Vibrio harveyi strains, 17 Vibrio alginolyticus strains, 13 Vibrio vulnificus strains, 11 Vibrio cannii strains, and 9 Vibrio cholerae strains, with a lysis rate of 70.06%, demonstrating strong lysis ability against Vibrio. In Yang Jixia's study, "Screening of Broadly Lysogenic Vibrio Phages Using Vibrio cholerae SWBC-a as Target Bacteria," infection experiments were conducted on 26 Vibrio strains (Vibrio parahaemolyticus, Vibrio cholerae, and Vibrio alginolyticus), and it was found that phage SWBC-a-3 could only lyse 3 of them. In Wang Jingfeng's study, "Phage VB_VpP_BT-1011, Screening Methods, and Applications," phage VB_VpP_BT-1011 was used in lysis experiments on 8 Vibrio parahaemolyticus strains and 16 other bacterial strains, but could only lyse 1 Vibrio parahaemolyticus strain. In Chen Yibao's study, "Isolation, Identification, and Biological Characteristics of Virulent Salmonella Phages," infection experiments were conducted on 15 Salmonella strains, and only 2 strains could be lysed. In Fu Hanqing's study, "Isolation, Identification, and Biological Characteristics of a Broad-Spectrum Lysogenic Vibrio Phage, ФV170," ФV170 could only lyse 7 Vibrio alginolyticus strains. In Zhang Zhihong's study, "Specificity of the Lysis Spectrum and Molecular Classification of a Staphylococcus aureus Phage," infection experiments were conducted on 37 Staphylococcus aureus strains and 74 strains of other species, finding that phage vB_SauH_SAP1 could only lyse 10 Staphylococcus aureus strains. Therefore, it can be seen that bacteriophages have strong specificity, generally only able to lyse one type of host. Furthermore, in practical applications, narrow-spectrum bacteriophages are difficult to be effective against the multiple bacterial diseases that occur in aquaculture. In contrast, the 033B bacteriophage of this invention can simultaneously lyse six different host species, including 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, 17 strains of Vibrio alginolyticus, 13 strains of Vibrio vulnificus, 11 strains of Vibrio cannibalus, and 9 strains of Vibrio cholerae. Therefore, compared to other bacteriophages, the 033B bacteriophage of this invention has stronger lytic ability and a broader host spectrum, enabling it to more effectively solve the problem of multiple bacterial diseases in aquaculture in practical applications.

[0072] Table 8: Host spectrum of bacteriophage 033B

[0073]

[0074] 3. Determination of the control efficacy of broad-spectrum bacteriophage O33B and narrow-spectrum bacteriophage against Vibrio.

[0075] Cultures of Vibrio parahaemolyticus VP033, Vibrio harveyi VH502, and Vibrio alginolyticus VA504 were prepared, with 500 mL of each culture at a concentration of 3.8 × 10⁻⁶. 8 The supernatant was cultured at a concentration of CFU / mL. Phages 033C and 033E, which can only lyse Vibrio parahaemolyticus VP033, were cultured, and 500 mL of each at a concentration of 3.9 × 10⁻⁶ CFU / mL was collected. 10Phage fluid at pfu / mL.

[0076] 150 grass shrimp with an average weight of (24.0±2.2)g were divided into 5 treatment groups, with three replicates in each group and 10 grass shrimp in each replicate. They were placed in a glass aquarium (capacity 60L) and 40L of water was added. Treatment A served as a blank control without any treatment. Treatment B included 100 mL each of the prepared supernatants of Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio harveyi. Treatment C included 100 mL each of the prepared supernatants of Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio harveyi, as well as 100 mL of 033C bacteriophage fluid. Treatment D included 100 mL each of the prepared supernatants of Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio harveyi, as well as 100 mL of 033E bacteriophage fluid. Treatment E included 100 mL each of the prepared supernatants of Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio harveyi, as well as 100 mL of the 033B bacteriophage preparation from Example 2. The growth of the grass shrimp was observed daily, and the number of dead grass shrimp in each treatment group was recorded.

[0077] The control efficacy of broad-spectrum bacteriophage 033B and narrow-spectrum bacteriophages 033C and 033E against Vibrio parahaemolyticus is shown in Table 9. In treatment group A, no shrimp deaths were observed. In treatment group B, 14 shrimp died after 3 days (mortality rate 46.67%), and 29 shrimp died after 7 days (mortality rate as high as 96.67%). In treatment group C, 9 shrimp died after 3 days (mortality rate 30%), and 17 shrimp died after 7 days (mortality rate 56.67%). In treatment group D, 11 shrimp died after 3 days (mortality rate 36.67%), and 19 shrimp died after 7 days (mortality rate 63.33%). In treatment group E, 2 shrimp died after 3 days (mortality rate 6.67%), and 3 shrimp died after 7 days (mortality rate 10%). The comparison showed that after 7 days, the mortality rate of treatment E was 86.67% lower than that of treatment B, 46.67% lower than that of treatment C, and 53.33% lower than that of treatment D. The results showed that, in practical applications, the broad-spectrum phage 033B microecological preparation had significant advantages over the narrow-spectrum phages 033C and 033E. It could significantly reduce the mortality rate of grass shrimp, reduce the harm caused by Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus in aquaculture, and had obvious therapeutic effects.

[0078] Table 9. Determination of the control efficacy of broad-spectrum bacteriophage O33B and narrow-spectrum bacteriophage against Vibrio.

[0079]

[0080] (4) Determination of the preventive and therapeutic effects of phage O33B probiotic preparation on Vibrio parahaemolyticus

[0081] One hundred and fifty grass shrimp with an average weight of (24.0±2.2) g were divided into four treatment groups, with three replicates per group and ten grass shrimp per replicate. They were placed in a 60L glass aquarium with 40L of water. Treatment A served as a blank control without any treatment. Treatment B received 100mL of prepared Vibrio parahaemolyticus supernatant. Treatment C received both 100mL of prepared Vibrio parahaemolyticus supernatant and 100mL of phage preparation 033B from Example 2. Treatment D received 100mL of phage preparation 033B from Example 2 for 3 days, followed by 100mL of prepared Vibrio parahaemolyticus supernatant. Treatment E received 100mL of phage preparation 033B. The growth of the grass shrimp was observed daily, and the number of dead grass shrimp in each treatment group was recorded.

[0082] Table 10 shows the control efficacy of phage preparation 033B against Vibrio parahaemolyticus disease in grass shrimp. No grass shrimp died in treatment groups A and E. In treatment group B, 13 grass shrimp died after 3 days, with a mortality rate of 43.33%, and 28 grass shrimp died after 7 days, with a mortality rate as high as 93.33%. In treatment group C, 1 grass shrimp died after 3 days, with a mortality rate of only 3.33%, and 2 grass shrimp died after 7 days, with a mortality rate of only 6.66%. In treatment group D, 0 grass shrimp died after 3 days, with a mortality rate of 0%, and 1 grass shrimp died after 7 days, with a mortality rate of only 3.33%. Comparative analysis revealed that after 7 days, the mortality rate of grass shrimp in group C was 86.67% lower than that in group B, demonstrating the excellent therapeutic effect of phage 033B microecological preparation against Vibrio parahaemolyticus disease in grass shrimp. Furthermore, after 7 days, the mortality rate of grass shrimp in group D was 90% lower than that in group B, showing a significant preventative effect and proving the excellent preventative effect of phage 033B microecological preparation against Vibrio parahaemolyticus disease in grass shrimp. No grass shrimp deaths were observed in group E, indicating that phage 033B microecological preparation had no impact on grass shrimp growth. Therefore, the results indicate that phage 033B microecological preparation has no effect on grass shrimp growth and has significant preventative and therapeutic effects against Vibrio parahaemolyticus disease in grass shrimp.

[0083] Table 10: Preventive and therapeutic effects of bacteriophage O33B microecological preparation on Vibrio parahaemolyticus disease in grass shrimp

[0084]

[0085] Example 4: Whole genome sequencing and analysis of phage O33B

[0086] 1. Purification of bacteriophage 033B

[0087] Take 2 mL of 033B phage fluid, centrifuge at 8000 rpm for 10 min, take the supernatant, filter it twice through a 0.22 μm filter membrane, and store it in a refrigerator at 4℃.

[0088] 2. Extraction of genomic DNA from bacteriophage O33B

[0089] Phage genomic DNA / RNA extraction kits from isolated and purified phages were used to extract phage genomic DNA, which was then sent to Meiji Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0090] 3. Whole genome sequence analysis of phage 033B

[0091] The full-length genome sequence of phage 033B, selected using third-generation genome sequencing on the PacBio platform, is 55,858 bp and is linear double-stranded DNA. BLAST analysis of the genome sequence on the NCBI website showed an 81% alignment coverage and 92.71% homology with the closest Vibrio parahaemolyticus phage (GeneBank accession number: KM378617.2); followed by a 2% alignment coverage and 72.97% homology with the Vibrio parahaemolyticus phage (GeneBank accession number: MG592667.1). Phage 033B was identified as a new species of phage belonging to the class Caudatephages and the subfamily Queuovirinae through genome alignment. The full genome has been uploaded to the NCBI website and obtained the GeneBank accession number OP331229.1. Phage 033B was deposited at the China Center for Type Culture Collection in Wuhan on September 4, 2020, with accession number CCTCC M 2020465.

[0092] DNAMAN 7 software was used to identify differentially expressed fragments between the phage 033B genome and the genome sequences of two phages with the highest homology, obtaining specific gene fragments D1 and D2. Then, specific PCR amplification primers were designed using Primer Premier 6 software and sent to Boshan Biotechnology (Shanghai) Co., Ltd. for primer synthesis. The results are as follows: Figure 5 As shown.

[0093] The specific PCR amplification primers are:

[0094] D1F:5'-CTTGCTCGGCTTCTCTAAT-3';

[0095] D1R:5'-CGCTGGATTGTGGTGTAA-3';

[0096] D2F:5'-GATAGTGAAGAAGATGGAATGG-3';

[0097] D2R:5'-GTTGAAGACGACGCTGTA-3';

[0098] The specific gene fragments are:

[0099] D1:CTTGCTCGGCTTCTTCAATGAGATGCCATACCAAGTATCAGTCTTCCGTGGGGAGGTCGGCGGTACTAGTT GGGTACTGAACTGGCAAGGGCGCGTCATCTCATCAAAAGCCAATGGCGATATCATCGACGTTGAATGTGAATCGCTTT ACACCACAATCCAGCG

[0100] D2:GATAGTGAAGAAGATGGAATGGACATCGAGGACTTCAGAAAAGATAAGAGACTGCGGCTCTTTAGGCTGAT GGTTTTTAATCACGGGTTACCTCCGTATCGATCAGATTGTAAGAAAAGTGGCGAAGGCATGGAACGCAAACAAAACCCGATTATGTAGTGCACCTTCGCCTAAAAAGGGGAGTCGAAACTCCCCTAAAACCTAGCGACTGTTGTTGTTATACAGCGTCGTCTTCAAC

[0101] In summary, according to embodiments of the present invention, bacteriophage 033B was isolated and screened from water samples of shrimp ponds in Fotan County, Zhangzhou City, Fujian Province. It exhibits high bactericidal activity against Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus, and also possesses a broad phage spectrum. It can simultaneously lyse six different species of Vibrio, including 45 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, 17 strains of Vibrio alginolyticus, 13 strains of Vibrio vulnificus, 11 strains of Vibrio cannabinoides, and 9 strains of Vibrio cholerae. This provides a more effective solution to various bacterial diseases and infections in aquaculture.

[0102] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. The illustrative expressions of the above terms in this specification should not be construed as necessarily referring to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. In addition, those skilled in the art can combine and integrate the different embodiments or examples described in this specification.

[0103] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A bacteriophage for controlling Vibrio diseases in aquatic animals ( Vibrio parahaemolyticus Phage 033B), characterized in that, The phage was deposited at the China Center for Type Culture Collection on September 4, 2020, with accession number CCTCCM 2020465.

2. A microecological preparation, characterized in that, Includes the bacteriophage for preventing and controlling Vibrio diseases in aquatic animals as described in claim 1.

3. The microecological preparation as described in claim 2, characterized in that, The titer of the bacteriophage is 6.7 × 10⁻⁶. 11 pfu / mL.

Citation Information

Patent Citations

  • Vibrio cholerae bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof

    CN115717128A

  • Vibrio canbainii bacteriophage vBVcaSR45Z and application thereof

    CN122012411A