Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

46 results about "NdeI" patented technology

NdeI is an endonuclease isolated from Neisseria denitrificans. In molecular biology, it is commonly used as a restriction enzyme.

Method for preparing rebaudioside M2 by catalyzing rebaudioside A through recombinant bacterium

The invention discloses a recombinant bacterium and application of the recombinant bacterium to preparation of rebaudioside M2 by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-based glycosyltransferase UGTSL2 gene and a potato-based sucrose synthase StSUS1 gene at the same time; the tomato-based glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2; then the potato-based sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induced expression, crude enzyme liquid is taken and is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside M2; in a reaction process, the crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder is also not needed and substrates including rebaudioside D and UDP or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added, so that the environmental friendliness is better. The yield of the rebaudioside M2 reaches 11.09g / L.
Owner:NANJING UNIV OF TECH

Vibrio harveyi secretory type vaccine and structure and application thereof

The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI/XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI/XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturing on an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

PPK2 protein, and application of PPK2 protein as polyacrylamide gel electrophoresis 35kd standard substance

The invention discloses a PPK2 protein, and an application of the PPK2 protein as a polyacrylamide gel electrophoresis 35kd standard substance. A ppk2 gene is inserted into a prokaryotic expression vector pET30a by using NdeI and Hind III, the obtained recombinant expression vector is transferred into an Escherichia coli BL21 (DE3) strain through a physical method, IPTG is used to induce trial expression of the target protein PPK2 at 37 DEG C, 25 DEG C and 16 DEG C, and the obtained expression product is identified and analyzed through SDS-PAGE electrophoresis and Western blotting; and finally, amplification culture is carried out by utilizing 3 L of an expression bacterial liquid, and the expression product is separated and purified through a Ni-IDA affinity chromatographic column, an anion exchange chromatographic column and a gel filtration chromatographic column in sequence. Results show that a large intestine prokaryotic expression system can be stably and efficiently expressed under the induction of the IPTG with the temperature of 16 DEG C and the final concentration of 0.2 mM.L<-1>, and the PPK2 protein has the advantages of specific charged property, existence in a monomerform in a solution, stable properties, non-degradability and long half-life period, and has an application prospect as the polyacrylamide gel electrophoresis 35 kd standard substance.
Owner:TIANJIN VOCATIONAL INST

Method for catalytically synthesizing curcumin glycoside compounds by biological method

The invention discloses a method for catalytically synthesizing curcumin glycoside compounds by a biological method. A glycosyl transferase gene CaUGT2 and a sucrose synthase gene AtSUS1 are constructed on an expression vector and are introduced into escherichia coli to obtain a recombinant strain, the soluble expression quantity of the recombinant strain after induced expression is improved compared with that of glycosyl transferase from other plants, and a substrate curcumin can be efficiently catalyzed. A recombinant plasmid is pRSF-CaUGT2-AtSUS1, a sucrose synthase AtSUS1 gene is inserted into Nco I and EcoR I, glycosyl transferase CaUGT2 is inserted into Xho I and NdeI, a co-expression recombinant plasmid pRSF-CaUGT2-AtSUS1 is formed, the recombinant plasmid is transformed into escherichia coli BL21 (DE3) competent cells, and a recombinant strain CaUGT2-AtSUS1 is obtained. After the recombinant strain is subjected to induced expression, the soluble expression quantity of the glycosyl transferase CaUGT2 is increased compared with that of glycosyl transferase from other plants, the conversion rate of catalytic synthesis of curcumin glycoside compounds reaches 98%, curcumin is catalyzed to generate curcumin monoglucoside and curcumin diglucoside, the water solubility of the curcumin monoglucoside and curcumin diglucoside is superior to that of curcumin, and the problem that curcumin is poor in water solubility is solved. The concentration of the substrate curcumin is 75 mM, the concentration of a catalytic substrate is relatively high, and the method is more suitable for food and medicine industries in industrialization.
Owner:NANJING UNIV OF TECH

DC (Dendritic Cell) vaccine as well as preparation method and application thereof

The invention relates to a DC (Dendritic Cell) vaccine of a gastric cancer or a breast cancer as well as a preparation method and application thereof. A recombinant overlapped peptide fusion protein is constructed according to an amino acid sequence of a tumor antigen; the overlapped peptide fusion protein consists of polypeptides consisting of 15 amino acids in one series; two adjacent polypeptides have 11 amino acids which are completely overlapped and are the same; overlapped peptides are connected by the same enzyme cutting sites 1i-key; genes of the recombinant overlapped peptide fusion protein are cloned to a pET28 carrier through NdeI and BamH enzyme cutting sites; the recombinant overlapped peptide fusion protein is separated and purified after being expressed through escherichia coli; a PBMC (Peripheral Blood Mononuclear Cell) which is in-vitro separated from human blood, a GM-CSF (Granulocyte-Macrophage Colony-Stimulating Factor) and the recombinant overlapped peptide fusion protein are co-cultured; the recombinant overlapped peptide fusion protein generates a series of uncertain overlapped peptides after DC endocytosis and intracellular digestion, wherein the uncertain overlapped peptides include peptides of CTL (Cytotoxic Lymphocyte) phenotype and/or Th phenotype and are combined into MHC (Major Histocompatibility Complex) I and MHC II molecules of the DC, so that DC is matured to obtain the DC vaccine. Compared with a method for in-vitro synthesizing each peptide stimulating DC, the preparation method disclosed by the invention has quick stimulating DC benefits and low cost.
Owner:常州牛津石松生物科技有限公司

PPK2 protein and application thereof as 30kd standard substance for polyacrylamide gel electrophoresis

The invention discloses a PPK2 protein and application thereof as a 30kd standard substance for polyacrylamide gel electrophoresis. Ppk2 genes are inserted into a prokaryotic expression vector pET30aby virtue of NdeI and HindIII, a recombinant expression vector is transferred into an escherichia coli BL21(DE3) strain by virtue of a physical method, a target protein PPK2 is induced to realize trial expression at 37 DEG C, 25 DEG C and 16 DEG C by virtue of IPTG, and an expression product is authenticated and expressed by virtue of SDS-PAGE electrophoresis and Western Blotting; and finally, amplification culture is carried out by virtue of 3.2L of expression bacteria liquid, and the expression product is sequentially separated and purified by virtue of Ni-IDA affinity chromatography, cation-exchange chromatography and gel filtration chromatography. A result shows that a large intestine prokaryotic expression system can be induced to realize stable and efficient expression by virtue of the IPTG with a final concentration of 0.2mM.L<-1> at 16 DEG C, the PPK2 protein has an exclusive charging property, stable performance and a long half-life period, exists in a solution in a monomer manner, is unlikely to degrade and has an application prospect as the 30kd standard substance for the polyacrylamide gel electrophoresis.
Owner:TIANJIN VOCATIONAL INST

A kind of method that recombinant bacterium catalyzes rebaudioside a to prepare rebaudioside m2

The invention discloses a recombinant bacterium and application of the recombinant bacterium to preparation of rebaudioside M2 by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-based glycosyltransferase UGTSL2 gene and a potato-based sucrose synthase StSUS1 gene at the same time; the tomato-based glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2; then the potato-based sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induced expression, crude enzyme liquid is taken and is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside M2; in a reaction process, the crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder is also not needed and substrates including rebaudioside D and UDP or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added, so that the environmental friendliness is better. The yield of the rebaudioside M2 reaches 11.09g / L.
Owner:NANJING TECH UNIV

Vibrio harveyi secretory type vaccine and construction method thereof

InactiveCN101780273BEasy to makeNo need for inactivationAntibacterial agentsBacteriaAdjuvantRoom temperature
The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI / XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI / XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturingon an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Expression vector of membrane protein YddG and expression and purification method of membrane protein YddG

The invention discloses an expression vector of membrane protein YddG and an expression and purification method of the membrane protein YddG. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein YddG sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein YddG stabilize the conformation of the nitrogen-terminal membrane protein YddG. The expression vector constructed by the invention can realize mass expression of the membrane protein YddG, and can be used for high-throughput screening of subsequent novel antibiotics.
Owner:NANJING UNIV OF SCI & TECH

Enhanced polysaccharide antigen immunogenic protein carrier as well as preparation method and application thereof

The invention discloses an enhanced polysaccharide antigen immunogenic protein carrier as well as a preparation method and application thereof. A CRM197A gene sequence and a Hin47 gene sequence are taken as templates, and a fusion gene is obtained by over-lap PCR (polymerase chain reaction) amplification; after being subjected to double-enzyme digestion of BamHI and NdeI, the fusion gene and a pET 9a expression carrier are connected by T4 ligase; after successful connection is confirmed by enzyme digestion, CRM197A-Hin47 fusion protein is obtained by means of IPTG inducible expression and purification. Haemophilus influenzae type b capsular polysaccharide PRP and the fusion protein are coupled by a CDAP/CNBr or reduction amine method, and a prepared conjugate of the PRP and the fusion protein can be used for preparing a conjugate vaccine for preventing haemophilus influenzae type b. Experiments prove that when the fusion protein is taken as a protein carrier of a polysaccharide conjugate vaccine, the immunogenicity of polysaccharide antigen can be remarkably enhanced; furthermore, vaccines which are developed based on the protein carrier provided by the invention can effectively reduce the immune interference caused by currently using a great deal of same protein carriers, so that the development of combined vaccines and polyvalent vaccines is facilitated.
Owner:CANSINO BIOLOGICS INC

Expression vector of membrane protein AmtB and expression and purification method of membrane protein AmtB

The invention discloses an expression vector of a membrane protein AmtB and an expression and purification method of the membrane protein AmtB. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein AmtB sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein AmtB stabilize the conformation. The expression vector constructed by the invention can realize mass expression of the membrane protein AmtB, and can be used for high-throughput screening of subsequent novel antibiotics.
Owner:NANJING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products