216 results about "Glyceraldehyde" patented technology

The promoter regions associated with the Yarrowia lipolytica glyceraldehyde-3-phosphate dehydrogenase (gpd) and phosphoglycerate mutase (gpm) genes have been found to be particularly effective for the expression of heterologous genes in oleaginous yeast. The promoter regions of the invention have been shown to drive high-level expression of genes involved in the production of ω-3 and ω-6 fatty acids.

The invention generally provides compositions and methods for promoting and enhancing wound closure and healing. Specifically, the invention provides a biologic composition which comprises a support layer which serves as transport scaffold, for example made of gelatin, which is coated or impregnated with a bio-adhesive molecule such as rose bengal or glyceraldehyde. The composition can also comprise an artificial or biological matrix, optionally processed (i.e. cleaned and coated with extracellular matrix proteins) to enhance cell attachment and survival. The composition can further comprise a monolayer of epithelial, endothelial cells or mesenchymal cells. The invention provides methods for using the compositions for treating wounds due to disease, trauma or surgery. Specific methods for treating ocular wounds are provided.

Methods and kits are provided for diagnosing, monitoring, or predicting the conditions of pre-eclaimpsia, fetal chromosomal aneuploidy, and pre-term labor in a pregnant woman, as well as for detecting pregnancy in a woman, by quantitatively measuring in the maternal blood the amount of one or more mRNA species encoding human chorionic gonadotropin β subunit (hCG-β), human placental lactogen (hPL), human corticotropin releasing hormone (hCRH), KiSS-1 metastasis-suppressor (KISS1), tissue factor pathway inhibitor 2 (TPFI2), placenta-specific 1 (PLAC1), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and comparing the amount of the mRNA species with a standard control.

Microorganism useful for the production of 1,2-propanediol from a carbon source, wherein said microorganism is characterized by:

• • an improved activity of the biosynthesis pathway from dihydroxyacetone phosphate to 1,2-propanediol, and
  • an attenuated activity of the glyceraldehyde 3-phosphate dehydrogenase
  • The invention is also related to a method for producing 1,2-propanediol by fermentation with a microorganism according to the invention.

The invention provides a method of preparing lactic acid and lactate ester by catalyzing sugar to convert. The method is characterized in that water, micromolecular alcohol or an aqueous solution of the alcohol is taken as a solvent, a Sn containing compound is taken as a catalyst, and glucose, cane sugar, fructose, xylose, dioxyacetone and glyceraldehyde can be catalyzed to convert in a reaction vessel so as to obtain the lactic acid and lactate ester at high yield. The method has the advantages that the catalyst is low in cost and easy to obtain, reactants have high sugar concentration, reaction time is short, reaction temperature is low, the yield of lactic acid and lactate ester is high, needed equipment is simple, and the method is simple and convenient in operation and environmental-friendly.

A lyophilized platelet preparation, which is preferably a platelet enhanced plasma preparation, was obtained by stabilizing separated platelets with glyceraldehyde. In contrast to fixed preparations of cells, the platelet preparation is made and provided without toxins. Not fixing the platelets according to the invention provides increases utility and allows for the ability to change volume. The platelets are combined with a glyceraldehyde analog for a few hours at slightly elevated temperatures (about 35° C.) and then freeze dried and on reconstitution with distilled water exhibit morphological and physiological properties similar to that of native platelets, and superior to untreated, lyophilized platelets.

The invention describes a process for the production of glycerol of providing a vegetable oil or fat as starting material, obtaining crude glycerol from the vegetable oil or fat, and treating the crude glycerol with a reducing agent. The present invention also describes a process for the production of a medicament or pharmaceutical composition, the medicament or composition formed by combining glycerol and at least one pharmaceutically active ingredient. The present invention also describes a pharmaceutical composition or medicament composed of glycerol obtained by way of the invention and a pharmaceutically active ingredient, which compositions forms very little glyceraldehyde and dihydroxyacetone during storage.

The invention provides a method for preparing lactic acid from carbohydrates in mild conditions. The involved catalyst is an alkali metal or alkaline-earth metal oxide, including Ba(OH)2, NaOH and KOH; N2, Ar or H2 is a protection gas; the carbohydrates include glucose, fructose, cellobiose, dihydroxy acetone, pyruvic aldehyde, glyceraldehyde and the like; the catalytic reaction system is simple and easy to operate; the reaction is carried out at low-to-medium temperature and under normal pressure; the adopted catalyst and substrate are common and easily available; the substrate conversion rate is over 96%; the lactic acid yield is up to more than 90%; and the lactic acid yield and selectivity are both relatively high. The method provided by the invention has the advantages of relatively high catalytic conversion efficiency, low energy consumption, safe and simple process and the like and has a broad industrial application prospect.

The invention relates to a kit and a method for detecting mycoplasma pollution in CHO cultured cells, and belongs to the field of biological technology detection. The kit comprises a primer pair of the DNA sequence of a specific amplified CHO cell glyceraldehyde-3-phosphatedehydrogenase and a primer pair of the DNA sequence of a specific amplified mycoplasma 16srRNA conserved domain, and the two above primer pairs are placed in a same PCR system. According to the kit, when mycoplasma pollution is detected by employing the PCR technology, the determination of reliability of a detection result can be finished at the same time. The kit and the method help to substantially improve the reliability of the detection result on mycoplasma pollution in CHO cultured cells, the operation is simple, the detection period is short, and the sample detection operationality is good.

The invention discloses a DNA (Deoxyribose Nucleic Acid) with constitutive promoter activity, application of the DNA and a pichia pastoris expression vector. The DNA has a base sequence as shown in SEQ No.1 (Sequence Number); and the application of the DNA relates to the application of the DNA in construction of the pichia pastoris (Pinchia Pastoris) expression vector. The DNA disclosed by the invention has the constitutive promoter activity, and can activate the transcription of a downstream structural gene without an inductor; the transcriptional activity shows little change in four different culture mediums, namely, ethanol, methanol, glucose and glycerol; the promoter activity is efficient, and the efficiency of the initiation transcription is four times more than the pichia pastoris GAPDH (Reduced Glyceraldehyde-phosphate Dehydrogenase) promoter. The pichia pastoris expression vector, constructed by the DNA disclosed by the invention, can efficiently express the extrinsic protein without methanol induction, and the efficiency of expressing the extrinsic protein (Enhanced Green Fluorescent Protein) is about 6 to 8 times that of the expression system of the GAPDH promoter and 1.5 to 2 times that of the expression system of a TEF1 (Transcription Enhancer Factor 1) promoter.

The present invention relates to fungal microorganism having an increased ability to carry out biotechnological process(es). In particular, the invention relates to improving the regeneration of redox cofactors in biotechnological processes where useful products are produced from biomass containing pentoses. According to the invention, the microorganism is transformed with a DNA sequence encoding an NADP linked glyceraldehyde 3-phosphate dehydrogenase. The invention can be used to provide useful products for mankind from biological materials, including e.g. agricultural and forestry products, municipal waste. Examples of such useful products are ethanol, lactic acid, polyhydroxyalkanoates, amino acids, fats, vitamins, nucleotides and a wide variety of enzymes and pharmaceuticals.

The invention discloses a corynebacterium glutamicum engineering strain for biosynthesis of rare sugar, and a building method and application thereof, and discloses a corynebacterium glutamicum recombination strain SY10. An experiment proves that rare ketose and deoxidized ketose can be synthesized by adopting a plurality of hydroxyaldehydes and glucoses as substrates by the strain in a fermentation manner, for example, D-erythrulose can be synthesized by adopting formaldehyde and glucose as substrates, L-xylulose can be synthesized by adopting glycolaldehyde and glucose as substrates, D-sorbose and D-psicose can be synthesized by adopting D-glyceraldehyde and glucose as substrates, L-fructose can be synthesized by adopting L-glyceraldehyde and glucose as substrates, and 3R, 4S, 5R, 6R-heptose and 3R, 4R, 5R, 6R-heptose can be synthesized by adopting D-erythrose and glucose as substrates. Therefore, the corynebacterium glutamicum recombination strain SY10 disclosed by the invention can be applied to the field of production of the rare ketose and the deoxidized ketose by whole-cell fermentation; the produced rare ketose and deoxidized ketose have broad application prospects in the industries such as a food, a medicine and the like.

The invention relates to a method for identifying sex of buffalo embryo by using PCR. It designs three pairs of primers according to the buffalo SRY gene sequence result: SRY-HMG box specific nest primer and reference gene GAPDH primer, and the GAPDH primer is used to amplify the common GAPDH gene for male and female buffalo (glyceraldehyde dehydrogenase gene) to check if the embryo sample is lost; SRY-HMG box primer is used to amplify the specific SRY conservative gene for male bufflalo to identify embryo sex. The designed specific primer can amplify relevant gene sequence steadily on basis of sequencing for buffalo SRY full sequence, and it can dramatically increase the sensitivity and feasibility for check.

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.

The present invention relates to a kind of saline alga photosynthetic metabolic pathway key enzyme NADP-glyceraldehyde-3-phosphate dehydrogenase gene, coded protein and its clone and protein expression method. The invented saline alga photosynthetic metabolic pathway key enzyme NADP-glyceraldehyde-3-phosphate dehydrogenase gene has the base sequence showed by SEQ NO 5, and its coded protein has the amino acid sequence showed by SEQ NO 6. Said invention uses homologous fragment of glyceraldehydes-3-phosphate dehydrogenase gene originated from chlamydomonas as probe and firstly clones a glyceraldehydes-3 phosphate dehydrogenase specialized by saline alga. Besides, said invention makes primary analysis for its sequence and coded protein sequence, at the same time makes primary function analysis for said gene.

The invention relates to a paeonia ostii reference gene under drought stress, and a special primer and application thereof. The reference gene is a TATA box binding protein TBP gene, an actin ACT1 gene, an actin ACT2 gene, a glyceraldehyde-3-phosphate dehydrogenase GAPDH gene, an eukaryote translation initiation factor eIF1 gene, a eukaryote translation initiation factor eIF2 gene, a tubulin alpha-TUB gene, a tubulin beta-TUB gene, an RNA polymerase II RNA Pol II gene or an RNA polymerase II transcription factor RP II gene. The nucleotide sequence of the gene is disclosed as the sequence table. The invention aims to provide a gene which can be stably expressed in the paeonia ostii gene expression profile under drought stress, and the gene is used as a paeonia ostii drought stress referencegene.

The invention provides a detection primer combination and kit for a GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene. The primer combination is designed in the sequence shown as SEQ ID No.1 as a target sequence and comprises F3, B3, FIP, BIP, LF and LB. When the primer combination is applied to an LAMP (loop mediated isothermal amplification) detection kit, results show that nonspecific amplification in primers and nonspecific binding amplification between the primers and a template are avoided for the primer combination, An LAMP amplified internal reference quality control system for a humanized sample is established successfully, and preliminary foundation is laid for widespread clinical use of the LAMP method in future.

The invention provides hydrogel for repairing endometrium injury. The hydrogel is prepared from amination aloe polysaccharide-glyceraldehyde gel, heparin-poloxamer gel containing heparin high-affinitycytokines, and an endometrial acellular matrix, and the mechanical strength and the degradation rate of the hydrogel for repairing endometrium injury are controlled by changing the component ratio. The hydrogel for repairing endometrium injury has low immunogenicity and multiple advantages such as rapid endometrium repair, provides the optimal physicochemical and biological microenvironments forendometrium repair, effectively guides cell directional arrangement, has good mechanical properties, and rapidly repairs endometrium injury.

The invention discloses a blood cfDNA (cell free DNA) preservative and a vacuum blood collection tube constituted by the blood cfDNA preservative, wherein the preservative consists of the following components in parts by weight: 1-200 parts of EDTA, 1-500 parts of imidazole, 1-200 parts of glyceraldehyde, 1-1000 parts of sodium chloride, 1-500 parts of guanidine hydrochloride, 1-1000 parts of SDSand 5000-7000 parts of purified water. The blood cfDNA vacuum blood collection tube is the vacuum blood collection tube containing the preservative. With the application of the blood cfDNA preservative provided by the invention, RNase enzyme activity can be effectively inhibited and free DNA in blood can be protected. The blood cfDNA vacuum blood collection tube is capable of inhibiting the RNaseenzyme activity and protecting the free DNA in the blood, and the vacuum blood collection tube is also capable of effectively immobilizing leukocyte and preventing the leukocyte from getting cracked,so that the circumstance that the free DNA is contaminated by the cracked leukocyte is prevented; the preservation duration of a blood sample at room temperature is effectively prolonged, and the vacuum blood collection tube is quite conducive to the long-distance transportation of a plasma sample; therefore, an effective preservation method is provided for collection, storage and transportation of tumor early screening samples or fetus prenatal screening and diagnosis samples.

Provided are an Escherichia species microorganism and Corynebacterium species microorganism that are transformed with a foreign NADP dependent glyceraldehydes-3-phosphate dehydrogenase gene and have the ability to produce L-lysine and a method of producing L-lysine using the microorganisms.