Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

227 results about "Glyceraldehyde" patented technology

Glyceraldehyde (glyceral) is a triose monosaccharide with chemical formula C₃H₆O₃. It is the simplest of all common aldoses. It is a sweet, colorless, crystalline solid that is an intermediate compound in carbohydrate metabolism. The word comes from combining glycerol and aldehyde, as glyceraldehyde is glycerol with one alcohol group oxidized to an aldehyde.

Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase promoters for gene expression in oleaginous yeast

The promoter regions associated with the Yarrowia lipolytica glyceraldehyde-3-phosphate dehydrogenase (gpd) and phosphoglycerate mutase (gpm) genes have been found to be particularly effective for the expression of heterologous genes in oleaginous yeast. The promoter regions of the invention have been shown to drive high-level expression of genes involved in the production of ω-3 and ω-6 fatty acids.
Owner:EI DU PONT DE NEMOURS & CO

Circulating mRNA as diagnostic markers

Methods and kits are provided for diagnosing, monitoring, or predicting the conditions of pre-eclaimpsia, fetal chromosomal aneuploidy, and pre-term labor in a pregnant woman, as well as for detecting pregnancy in a woman, by quantitatively measuring in the maternal blood the amount of one or more mRNA species encoding human chorionic gonadotropin β subunit (hCG-β), human placental lactogen (hPL), human corticotropin releasing hormone (hCRH), KiSS-1 metastasis-suppressor (KISS1), tissue factor pathway inhibitor 2 (TPFI2), placenta-specific 1 (PLAC1), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and comparing the amount of the mRNA species with a standard control.
Owner:THE CHINESE UNIVERSITY OF HONG KONG

Layered bio-adhesive compositions and uses thereof

The invention generally provides compositions and methods for promoting and enhancing wound closure and healing. Specifically, the invention provides a biologic composition which comprises a support layer which serves as transport scaffold, for example made of gelatin, which is coated or impregnated with a bio-adhesive molecule such as rose bengal or glyceraldehyde. The composition can also comprise an artificial or biological matrix, optionally processed (i.e. cleaned and coated with extracellular matrix proteins) to enhance cell attachment and survival. The composition can further comprise a monolayer of epithelial, endothelial cells or mesenchymal cells. The invention provides methods for using the compositions for treating wounds due to disease, trauma or surgery. Specific methods for treating ocular wounds are provided.
Owner:UNIV OF LOUISVILLE RES FOUND INC

Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase regulatory sequences for gene expression in oleaginous yeast

The regulatory sequences associated with the Yarrowia lipolytica glyceraldehyde-3-phosphate dehydrogenase (gpd) and phosphoglycerate mutase (gpm) genes have been found to be particularly effective for the expression of heterologous genes in oleaginous yeast. The promoter regions of the invention, intron and enhancer have been shown to drive high-level expression of genes involved in the production of ω-3 and ω-6 fatty acids.
Owner:EI DU PONT DE NEMOURS & CO

Method for diagnosing preeclampsia by detecting hCRH mRNA

ActiveUS7235359B2Increased risk of developingIncrease volumeSugar derivativesMicrobiological testing/measurementGlyceraldehydeMetastasis suppressor
Methods and kits are provided for diagnosing, monitoring, or predicting the conditions of pre-eclaimpsia, fetal chromosomal aneuploidy, and pre-term labor in a pregnant woman, as well as for detecting pregnancy in a woman, by quantitatively measuring in the maternal blood the amount of one or more mRNA species encoding human chorionic gonadotropin β subunit (hCG-β), human placental lactogen (hPL), human corticotropin releasing hormone (hCRH), KiSS-1 metastasis-suppressor (KISS1), tissue factor pathway inhibitor 2 (TPFI2), placenta-specific 1 (PLAC1), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and comparing the amount of the mRNA species with a standard control.
Owner:THE CHINESE UNIVERSITY OF HONG KONG

Metabolically engineered microorganism useful for the production of 1,2-propanediol

Microorganism useful for the production of 1,2-propanediol from a carbon source, wherein said microorganism is characterized by:an improved activity of the biosynthesis pathway from dihydroxyacetone phosphate to 1,2-propanediol, andan attenuated activity of the glyceraldehyde 3-phosphate dehydrogenaseThe invention is also related to a method for producing 1,2-propanediol by fermentation with a microorganism according to the invention.
Owner:METABOLIC EXPLORER

Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase regulatory sequences for gene expression in oleaginous yeast

The regulatory sequences associated with the Yarrowia lipolytica glyceraldehyde-3-phosphate dehydrogenase (gpd) and phosphoglycerate mutase (gpm) genes have been found to be particularly effective for the expression of heterologous genes in oleaginous yeast. The promoter regions of the invention, intron and enhancer have been shown to drive high-level expression of genes involved in the production of ω-3 and ω-6 fatty acids.
Owner:EI DU PONT DE NEMOURS & CO

Method of preparing lactic acid and lactate ester by catalyzing sugar to convert

The invention provides a method of preparing lactic acid and lactate ester by catalyzing sugar to convert. The method is characterized in that water, micromolecular alcohol or an aqueous solution of the alcohol is taken as a solvent, a Sn containing compound is taken as a catalyst, and glucose, cane sugar, fructose, xylose, dioxyacetone and glyceraldehyde can be catalyzed to convert in a reaction vessel so as to obtain the lactic acid and lactate ester at high yield. The method has the advantages that the catalyst is low in cost and easy to obtain, reactants have high sugar concentration, reaction time is short, reaction temperature is low, the yield of lactic acid and lactate ester is high, needed equipment is simple, and the method is simple and convenient in operation and environmental-friendly.
Owner:ZHENGZHOU UNIV

Stabilized lyophilized blood platelets

A lyophilized platelet preparation, which is preferably a platelet enhanced plasma preparation, was obtained by stabilizing separated platelets with glyceraldehyde. In contrast to fixed preparations of cells, the platelet preparation is made and provided without toxins. Not fixing the platelets according to the invention provides increases utility and allows for the ability to change volume. The platelets are combined with a glyceraldehyde analog for a few hours at slightly elevated temperatures (about 35° C.) and then freeze dried and on reconstitution with distilled water exhibit morphological and physiological properties similar to that of native platelets, and superior to untreated, lyophilized platelets.
Owner:BAKALTCHEVA IRINA B

Process for producing glycerol having low aldehyde and ketone content and improved storage stability

The invention describes a process for the production of glycerol of providing a vegetable oil or fat as starting material, obtaining crude glycerol from the vegetable oil or fat, and treating the crude glycerol with a reducing agent. The present invention also describes a process for the production of a medicament or pharmaceutical composition, the medicament or composition formed by combining glycerol and at least one pharmaceutically active ingredient. The present invention also describes a pharmaceutical composition or medicament composed of glycerol obtained by way of the invention and a pharmaceutically active ingredient, which compositions forms very little glyceraldehyde and dihydroxyacetone during storage.
Owner:COGNIS IP MANAGEMENT GMBH

Production of clavulanic acid by genetic engineering of Streptomyces clavuligerus

Genetically engineered Streptomyces clavuligerus strains with improved capabilities to produce clavulanic acid are provided. The strains are genetically engineered by disrupting newly identified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes. This results in an increased intracelluar pool of the clavulanic acid precursor D-glyceraldehyde-3-phosphate (D-G3P), and increased clavulanic acid production. Clavulanic acid production may be further increased by supplying arginine to the medium in which the S. clavuligerus is grown.
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE

Trichoderma reesei expression cassette, recombinant strain and application thereof

The invention discloses a Trichoderma reesei expression cassette, a recombinant strain and application thereof. The expression cassette includes Trichoderma reesei glyceraldehyde-3-phosphate dehydrogenase promoter, foreign target genes and Trichoderma reesei CBHI terminator. The expression cassette of the invention adopts the technical scheme that the sequence of the Trichoderma reesei glyceraldehyde-3-phosphate dehydrogenase gene promoter and the sequence of the Trichoderma reesei CBHI terminator form a constitutive promoter, genes of animals, vegetables or epiphyte can be expressed without induction, expression products can be properly modified, the efficient synthesis and exudation capability of the Trichoderma reesei can be utilized for high protein expression, and overmuch foreign proteins can be prevented from being generated in the expression products. The recombinant strain of the invention can efficiently express cellulose-free xylanase which has important using value in the paper manufacturing industry.
Owner:邢苗 +1

Recombinant materials for carotenoid production

The present invention provides recombinant DNA comprising a transcription promoter and a downstream sequence to be expressed, in operable linkage therewith, wherein the transcription promoter comprises a region found upstream of the open reading frame of a highly expressed Phaffia gene, preferably a glycolytic pathway gene, more preferably the gene coding for Glyceraldehyde-3-Phosphate Dehydrogenase. Further preferred recombinant DNAs according to the invention contain promoters of ribosomal protein encoding genes, more preferably wherein the transcription promoter comprises a region found upstream of the open reading frame encoding a protein as represented by one of the amino acid sequences depicted in any one of SEQIDNOs: 24 to 50. According to a further aspect of the invention an isolated DNA sequence coding for an enzyme involved in the carotenoid biosynthetic pathway of Phaffia rhodozyma is provided, preferably wherein said enzyme has an activity selected from isopentenyl pyrophosphate isomerase activity, geranylgeranyl pyrophosphate synthase activity, phytoene synthase activity, phytoene desaturase activity and lycopene cyclase activity, still more preferably those coding for an enzyme having an amino acid sequence selected from the one represented by SEQIDNO: 13, SEQIDNO: 15, SEQIDNO: 17, SEQIDNO: 19, SEQIDNO: 21 or SEQIDNO: 23. Further embodiments concern vectors, transformed host organisms, methods for making proteins and / or carotenoids, such as astaxanthin, and methods for isolating highly expressed promoters from Phaffa.
Owner:DSM IP ASSETS BV

Novel multivalent carrier vaccine for shrimp and application thereof

ActiveCN102895677AHigh temperature resistanceActual production application development valueAntibacterial agentsBacteriaWhite spot syndromeVector vaccine
The invention relates to a novel multivalent carrier vaccine for a shrimp. The vaccine is characterized by comprising a bacillus subtilis recombination strain obtained by a genetic engineering technique, the strain belongs to the category of bacillus subtilis HT5303 and is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO.: M 2012395. When spores are formed by the bacillus subtilis vaccine strain, white spot syndrome virus VP281 protein can be demonstrated on the surfaces of the spores, and fusion protein of cell-penetrating peptides, white spot syndrome virus VP19 and vibrio harveyi 3-glyceraldehyde-phosphate dehydrogenase (GAPDH) can be secreted and expressed when vegetative cells are formed. Compared with other vaccines, the multivalent carrier vaccine has the advantages of cross protection and long protection period. Moreover, the vaccine can be added into feeds and has the advantages of resistance against high-temperature setting of feeds and broad prospects for commercial development.
Owner:马悦 +1

Method for preparing lactic acid from carbohydrates in mild conditions

The invention provides a method for preparing lactic acid from carbohydrates in mild conditions. The involved catalyst is an alkali metal or alkaline-earth metal oxide, including Ba(OH)2, NaOH and KOH; N2, Ar or H2 is a protection gas; the carbohydrates include glucose, fructose, cellobiose, dihydroxy acetone, pyruvic aldehyde, glyceraldehyde and the like; the catalytic reaction system is simple and easy to operate; the reaction is carried out at low-to-medium temperature and under normal pressure; the adopted catalyst and substrate are common and easily available; the substrate conversion rate is over 96%; the lactic acid yield is up to more than 90%; and the lactic acid yield and selectivity are both relatively high. The method provided by the invention has the advantages of relatively high catalytic conversion efficiency, low energy consumption, safe and simple process and the like and has a broad industrial application prospect.
Owner:AGRO ENVIRONMENTAL PROTECTION INST OF MIN OF AGRI

Kit and method for detecting mycoplasma pollution in CHO cultured cells

The invention relates to a kit and a method for detecting mycoplasma pollution in CHO cultured cells, and belongs to the field of biological technology detection. The kit comprises a primer pair of the DNA sequence of a specific amplified CHO cell glyceraldehyde-3-phosphatedehydrogenase and a primer pair of the DNA sequence of a specific amplified mycoplasma 16srRNA conserved domain, and the two above primer pairs are placed in a same PCR system. According to the kit, when mycoplasma pollution is detected by employing the PCR technology, the determination of reliability of a detection result can be finished at the same time. The kit and the method help to substantially improve the reliability of the detection result on mycoplasma pollution in CHO cultured cells, the operation is simple, the detection period is short, and the sample detection operationality is good.
Owner:NCPC NEW DRUG RES & DEV

DNA (Deoxyribose Nucleic Acid) with constitutive promoter activity, application of DNA and pichia pastoris expression vector

The invention discloses a DNA (Deoxyribose Nucleic Acid) with constitutive promoter activity, application of the DNA and a pichia pastoris expression vector. The DNA has a base sequence as shown in SEQ No.1 (Sequence Number); and the application of the DNA relates to the application of the DNA in construction of the pichia pastoris (Pinchia Pastoris) expression vector. The DNA disclosed by the invention has the constitutive promoter activity, and can activate the transcription of a downstream structural gene without an inductor; the transcriptional activity shows little change in four different culture mediums, namely, ethanol, methanol, glucose and glycerol; the promoter activity is efficient, and the efficiency of the initiation transcription is four times more than the pichia pastoris GAPDH (Reduced Glyceraldehyde-phosphate Dehydrogenase) promoter. The pichia pastoris expression vector, constructed by the DNA disclosed by the invention, can efficiently express the extrinsic protein without methanol induction, and the efficiency of expressing the extrinsic protein (Enhanced Green Fluorescent Protein) is about 6 to 8 times that of the expression system of the GAPDH promoter and 1.5 to 2 times that of the expression system of a TEF1 (Transcription Enhancer Factor 1) promoter.
Owner:林影 +1

Fungal micro-organism having an increased ability to carry out biotechnological process(es)

InactiveUS20050106734A1Easy to useDecreasing and eliminating needFungiBiofuelsNucleotideGlyceraldehyde
The present invention relates to fungal microorganism having an increased ability to carry out biotechnological process(es). In particular, the invention relates to improving the regeneration of redox cofactors in biotechnological processes where useful products are produced from biomass containing pentoses. According to the invention, the microorganism is transformed with a DNA sequence encoding an NADP linked glyceraldehyde 3-phosphate dehydrogenase. The invention can be used to provide useful products for mankind from biological materials, including e.g. agricultural and forestry products, municipal waste. Examples of such useful products are ethanol, lactic acid, polyhydroxyalkanoates, amino acids, fats, vitamins, nucleotides and a wide variety of enzymes and pharmaceuticals.
Owner:VALTION TEKNILLINEN TUTKIMUSKESKUS

Corynebacterium glutamicum engineering strain for biosynthesis of rare sugar, and building method and application thereof

The invention discloses a corynebacterium glutamicum engineering strain for biosynthesis of rare sugar, and a building method and application thereof, and discloses a corynebacterium glutamicum recombination strain SY10. An experiment proves that rare ketose and deoxidized ketose can be synthesized by adopting a plurality of hydroxyaldehydes and glucoses as substrates by the strain in a fermentation manner, for example, D-erythrulose can be synthesized by adopting formaldehyde and glucose as substrates, L-xylulose can be synthesized by adopting glycolaldehyde and glucose as substrates, D-sorbose and D-psicose can be synthesized by adopting D-glyceraldehyde and glucose as substrates, L-fructose can be synthesized by adopting L-glyceraldehyde and glucose as substrates, and 3R, 4S, 5R, 6R-heptose and 3R, 4R, 5R, 6R-heptose can be synthesized by adopting D-erythrose and glucose as substrates. Therefore, the corynebacterium glutamicum recombination strain SY10 disclosed by the invention can be applied to the field of production of the rare ketose and the deoxidized ketose by whole-cell fermentation; the produced rare ketose and deoxidized ketose have broad application prospects in the industries such as a food, a medicine and the like.
Owner:天工生物科技(天津)有限公司

Method for synthesis of D-psicose by aldolase whole cell

The invention discloses a method for synthesis of D-psicose by microbiological fermentation, specifically a method for synthesis of D-psicose by aldolase whole cell. The method includes: firstly constructing recombinant corynebacterium glutamicum SY12 carrying L-fucose-1-phosphate aldolase gene and fructose-1-phosphorylase gene (i.e. with aldehyde condensation approach), then adding glucose and D-glyceraldehyde into a basic salt medium, synthesizing dihydroxyacetone phosphate from glucose by means of intracellular glycolysis, synthesizing a single product D-psicose from D-glyceraldehyde and dihydroxyacetone phosphate (DHAP) under the action of the L-fucose-1-phosphate aldolase and fructose-1-phosphorylase carried by the corynebacterium glutamicum recombinant strain SY12, with the conversion rate of D-glyceraldehyde being 53%. Therefore, compared with the existing method for in vitro synthesis of D-psicose by ketose3-epimerase, the biosynthesis method of D-psicose provided by the invention has the advantages of high conversion rate, single product, easy separation and the like, and lays certain foundation for mass production of D-psicose.
Owner:天津怡和生物科技有限责任公司

Enhancement of alcohol metabolism

D-glyceric acid has been found to enhance alcohol metabolism and thereby prevent adverse effects of alcohol consumption. D-glyceric acid is administered concurrently with alcohol, to accelerate the elimination of the alcohol from the body. D-glyceric acid is converted into D-glyceraldehyde and further into glycerol in reactions catalysed by NADH-aldehyde dehydrogenase and NADH-alcohol dehydrogenase complexes, which are produced in excess during alcohol oxidation, in the cells of alcohol-metabolising tissues. In these reactions, the NADH complexes become NAD-aldehyde dehydrogenase and NAD-alcohol dehydrogenase complexes. These complexes in turn accelerate the oxidation of alcohol, which is paralleled by enhancement of acetaldehyde oxidation to metabolically harmless acetic acid. D-glyceric acid or its salt or ester is used for the manufacture of a pharmaceutical preparation for enhancing the metabolism of alcohol. A method of enhancing the metabolism of alcohol in a subject by administering said compounds an effective amount of D-glyceric acid or its salt or ester is disclosed. An oral or parenteral preparation comprising said compounds is also disclosed.
Owner:HEINO PEKKA

Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.
Owner:FUZHOU ADICON CLINICAL LAB INC

Salt algae NADP glyceral dehyde-3-phosdehydrogenase gene clone and protein expression method

InactiveCN1904051AOxidoreductasesFermentationGlyceraldehyde-3-Phosphate Dehydrogenase GenePhosphate
The present invention relates to a kind of saline alga photosynthetic metabolic pathway key enzyme NADP-glyceraldehyde-3-phosphate dehydrogenase gene, coded protein and its clone and protein expression method. The invented saline alga photosynthetic metabolic pathway key enzyme NADP-glyceraldehyde-3-phosphate dehydrogenase gene has the base sequence showed by SEQ NO 5, and its coded protein has the amino acid sequence showed by SEQ NO 6. Said invention uses homologous fragment of glyceraldehydes-3-phosphate dehydrogenase gene originated from chlamydomonas as probe and firstly clones a glyceraldehydes-3 phosphate dehydrogenase specialized by saline alga. Besides, said invention makes primary analysis for its sequence and coded protein sequence, at the same time makes primary function analysis for said gene.
Owner:SHANGHAI UNIV

Paeonia ostii reference gene under drought stress, and special primer and application thereof

The invention relates to a paeonia ostii reference gene under drought stress, and a special primer and application thereof. The reference gene is a TATA box binding protein TBP gene, an actin ACT1 gene, an actin ACT2 gene, a glyceraldehyde-3-phosphate dehydrogenase GAPDH gene, an eukaryote translation initiation factor eIF1 gene, a eukaryote translation initiation factor eIF2 gene, a tubulin alpha-TUB gene, a tubulin beta-TUB gene, an RNA polymerase II RNA Pol II gene or an RNA polymerase II transcription factor RP II gene. The nucleotide sequence of the gene is disclosed as the sequence table. The invention aims to provide a gene which can be stably expressed in the paeonia ostii gene expression profile under drought stress, and the gene is used as a paeonia ostii drought stress referencegene.
Owner:YANGZHOU UNIV

LAMP (loop mediated isothermal amplification) detection primer combination and kit for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene

The invention provides a detection primer combination and kit for a GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene. The primer combination is designed in the sequence shown as SEQ ID No.1 as a target sequence and comprises F3, B3, FIP, BIP, LF and LB. When the primer combination is applied to an LAMP (loop mediated isothermal amplification) detection kit, results show that nonspecific amplification in primers and nonspecific binding amplification between the primers and a template are avoided for the primer combination, An LAMP amplified internal reference quality control system for a humanized sample is established successfully, and preliminary foundation is laid for widespread clinical use of the LAMP method in future.
Owner:曹国君

Truncated glyceraldehyde-3-phosphate dehydrogenase promoter

The invention found that partial deletion of the glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter can enhance gene expression (even heterologous gene expression) in basidiomycetous fungi. With the discovery of these gpd promoters, an expression system can be constructed for the expression of a heterologous gene in mushroom. Accordingly, the invention provides a truncated glyceraldehyde-3-phosphate dehydrogenase promoter and a construct comprising the promoter of the invention operably linked to a heterologous transcribable polynucleotide molecule and a mushroom comprising the construct.
Owner:MYCOMAGIC BIOTECH

Broad-spectrum, efficient and economical PCR (Polymerase Chain Reaction) detection method for high-risk human papilloma virus

InactiveCN103409560AMicrobiological testing/measurementDeoxyuridine TriphosphatePolymerase chain reaction
The invention discloses a broad-spectrum, efficient and economical PCR (Polymerase Chain Reaction) detection method for high-risk human papilloma virus. The detection method comprises the following steps of (1) designing primers aiming at 12 high-risk HPV (human papilloma virus) subtype L1 genes, wherein the melt points of the all genes are 60 DEG C, and the gas chromatography (GC) percents are 50%, so that the primers can amplify virus gene sequences in the same PCR tube under the same temperature, so as to save time and money; (2) taking glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a positive contrast, so as to avoid a false negative result; (3) avoiding a false positive result by utilizing an anti-pollution warm-start PCR system containing deoxyuridine triphosphate (dUTP) and uracil-N-glycosylase (UNG). According to the detection method, a PCR system is optimized based on the embodiment, and the specificity and the accuracy of a result are guaranteed, and according to the detection method, time saving and economy are realized, efficient and low-cost screening work is carried out on HPV viruses easily by a base hygiene department, and a purpose of preventing the cervical cancer is achieved.
Owner:潘晓静

Hydrogel for repairing endometrium injury and preparation method thereof

The invention provides hydrogel for repairing endometrium injury. The hydrogel is prepared from amination aloe polysaccharide-glyceraldehyde gel, heparin-poloxamer gel containing heparin high-affinitycytokines, and an endometrial acellular matrix, and the mechanical strength and the degradation rate of the hydrogel for repairing endometrium injury are controlled by changing the component ratio. The hydrogel for repairing endometrium injury has low immunogenicity and multiple advantages such as rapid endometrium repair, provides the optimal physicochemical and biological microenvironments forendometrium repair, effectively guides cell directional arrangement, has good mechanical properties, and rapidly repairs endometrium injury.
Owner:WENZHOU MEDICAL UNIV