Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

45 results about "Vibrio mimicus" patented technology

Vibrio mimicus is a Vibrio species that mimics V. cholerae. V. mimicus has been recognized as a cause of gastroenteritis transmitted by raw oysters, fish, turtle eggs, prawns, squid, and crayfish. V. mimicus, when carrying genes that encode cholera toxin, can cause severe watery diarrhea. Consumers and physicians should be aware that improperly handled marine and aquatic animal products can be a source of V. mimicus infections. Consumers should avoid cross-contamination of cooked seafood and other foods with raw seafood and juices from raw seafood and should follow FDA recommendations for selecting seafood and preparing it safely.

Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method.

The invention discloses a quadruple fluorescent PCR kit for detection of pathogenic vibrios in a water body and a detection method. According to the method, innovative bacterium enrichment reagent technology, DNA extraction reagent technology, specific fluorescent probe hybridization PCR detection technology and multiplex PCR technology are employed, bacterium enrichment culture of a sample is not needed, false positive interference is minimized as much as possible on the premise that high sensitivity is maintained, and four kinds of vibrios can be detected at one time. The invention mainly has the following beneficial effects: no need for bacterium enrichment of the sample in advance; high sensitivity and good specificity in detection of bacteria; reduction of the false positive incidence in conventional PCR amplification; and realization of rapid, accurate and specific detection of vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio flurialis at one time.
Owner:NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE

Prepn and usage of outer membrane protein subunit vaccine of seawater fish morbid vibrio

InactiveCN101020051AChemical properties determinedImmunospecific stabilityAntibacterial agentsPharmaceutical non-active ingredientsDiseaseBacteroides
The present invention is preparation and usage of outer membrane protein subunit morbid vibrio vaccine for seawater fish. The vaccine is prepared through extracting two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc, and adding immunostimulating complex. The vaccine preparing process includes culturing vibrio, extracting outer membrane protein and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.
Owner:GUANGDONG OCEAN UNIVERSITY

Detection genetic chip and detection kit for infectious diarrhea

The invention provides a genetic chip and a detection kit related to major pathogenic microorganisms causing infectious diarrhea of human beings, which are mainly specific to 13 types of bacteria including lapactic bacillus coli / shigella, salmonella, comma bacillus, vibrio parahemolyticus, aeromona hydrophila, plesiomonas, virio hollisae, vibrio fluvialis, vibrio mimicus, Wauter's strains, vibriodamsela and vibrio furnissii. The genetic chip comprises a solid-phase carrier and an oligonucleotide probe fixed on the solid-phase carrier, wherein the oligonucleotide probe comprises DNA (Deoxyribonucleic Acid) fragments selected from genes including a gyrB gene, an ITS gene, a dnaJ gene, a toxR gene and the like with remarkable biological evolution advantages or complementary DNA fragments. By adopting the genetic chip and the detection kit provided by the invention, major pathogenic microorganisms causing infectious diarrhea of human beings can be detected. The genetic chip and the detection kit have the characteristics of easiness and convenience for operation, high flux, high accuracy, high repeatability and the like, and can be applied to clinical detection of inspection departments in hospitals.
Owner:NANKAI UNIV

Gene chip for detecting nine pathogenicity vibrios in marine products

The invention relates to a gene chip for detecting nine pathogenicity vibrios in marine products and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe includes one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of a vibrio hollisae, a vibrio vulnificus, a vibrio cholera, a vibrio parahemolyticus, a vibrio harveyi, a vibrio alginolyticus, a vibrio furnissi, a vibrio mimicus and a vibrio damsel, 2) complementary DNA sequences of the DNA sequences selected in the DNA sequences in 1), 3) complementary RNA sequences of the selected DNA sequences in 1) or 2). The kit comprises the gene chips. The gene chip for detecting nine pathogenicity vibrios in marine products and the kit thereof provided by the invention are used for detecting the nine pathogenicity vibrios in marine products, and have the advantages of simplicity in operation, good sensitivity and strong repeatability.
Owner:ZHOUSHAN INST OF CALIBRATION & TESTING FOR QUALITY & TECHNICAL SUPERVISION

PCR detection method for vibrio cholerae, vibrio parahaemolyticus, and vibrio mimicus in food

The PCR detection method for the cholerae vibrio, parahaemolyticus vibrio and mimicus vibrio in food, the characteristic is: its detection steps: after the detected sample being secondary enrichment, using boiled method to extract vibrio genomic DNA, and then after PCR reaction, electrophoresis, dyeing, washing, finally using gel imager to observe the result and photograph, and after the spectra analysis, the results can be derived. The invention has the advantage: the simultaneous detection of cholerae vibrio, parahaemolyticus vibrio and mimicus vibrio in food, and can accelerate speed under the conditions of not affecting the detection rate, and can reduce workload and detection cost.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Detection kit and detection method for 5 new pathogens in foods

The invention relates to a detection kit and a detection method for 5 new pathogens in foods. The kit comprises 5 detection solutions each of which contains 10 mm of Tri*Cl, 50 mm of KCl, 25 mm of MgCl2, 2.5 mm of each dNTP component and 5U / microlitre of DNA polymerase. Besides, the detection solution A, B, C, D or E respectively contains specific primer pairs of Laribacter hongkongensis, Serratiamarcescens, Serratia odorifera, Plesiomonas shigelloides or Vibrio mimicus, each of which is 10 micrometers in amount. The detection kit and the detection method can detect the Laribacter hongkongensis, the Serratia marcescens, the Serratia odorifera, the Plesiomonas shigelloides and the Vibrio mimicus at a high sensitivity, have little detection time and simple operation, save large labor and financial resources, and meet the requirements of the quick detection.
Owner:曹际娟

B-cell antigenic multi-epitope peptide linked in tandem in OmpU of vibrio mimicus, making method and application thereof

The present invention relates to an antigenic B-cell multi-epitope peptide linked in tandem in the outer membrane protein(Omp) U gene of vibrio mimicus, a making method and an application thereof, which belong to the field of molecular immunology. The B-cell multi-epitope peptide linked in tandem can induce fish to make protective immunity response to vibrio mimicus infection. In the present invention, the amino acid sequence of the antigenic B-cell multi-epitope peptide linked in tandem in the OmpU is shown in SEQIDNO:10. The B-cell multi-epitope peptide linked in tandem in the OmpU of vibrio mimicus is made by a genetic engineering technique. The verification of immune blotting analysis, specific antibody detection and immune animal protective experiments shows that the peptide can elicit efficient and specific protective humoral immunity response to vibrio mimicus infection. The B-cell multi-epitope peptide linked in tandem can be used for the immune diagnosis and the immune prevention and treatment of aquatic animal ascitic diseases. The present invention has high social benefit and economic benefit.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Immunomagnetic bead containing OmpU antibody, preparation of immunomagnetic bead and method for capturing pathogenic vibrios and detecting pathogenic vibrios through multiplex PCR by utilizing immunomagentic bead

The invention relates to an immunomagnetic bead containing an OmpU antibody, preparation of the immunomagnetic bead and a method for capturing pathogenic vibrios and detecting the pathogenic vibrios through multiplex PCR by utilizing the immunomagnetic bead. PCR amplification of an OmpU gene is conducted by taking genomes of the vibrios as templates, pure OmpU recombinant protein is obtained to serve as an antigen to prepare the antibody, and the immunomagnetic bead containing the OmpU antibody is prepared through the coupling-washing process; the immunomagnetic bead can capture multiple vibrios, and then the vibrios are identified by multiplex PCR specific primers which are designed on the basis of a danJ gene. The immuomagnetic bead can simultaneously detect the vibrio parahaemolyticus, the vibrio cholera, the vibrio alginolyticus, the vibrio vulnificus and the vibrio mimicus at most and can be widely applied to environment and import and export food inspection. The immuomagnetic bead combines the specificity of immune separation and the high efficiency of PCR amplification, has the capacities of separation, concentration and enrichment, can efficiently separate and enrich the low-concentration pathogenic bacteria in a sample, reduces or eliminates inhibition and influences of the sample to PCR, improves detection limitation and has the very good application prospect.
Owner:SHANTOU UNIV

Pathogenic vibrio phage VmYZU10474 and application thereof

The invention discloses a pathogenic vibrio phage VmYZU10474 and application thereof. The phage is identified to have unique genome structure characteristics, belongs to a novel phage, and has been preserved in China Center for Type Culture Collection on August 12, 2020 with the preservation number of CCTCC NO: M 2020417. The phage capable of efficiently cracking vibrio is obtained, can inhibit pathogenic vibrio in various matrixes, such as mimicus vibrio, vibrio parahaemolyticus, vibrio alginolyticus and vibrio fluvialis, and can be applied to preparation of bacteriostatic agents for controlling pathogenic vibrio pollution in aquatic products and environments thereof. The prepared bacteriostatic agents can effectively control growth of pathogenic vibrio in culture media, fish juice and aquatic product samples, and meanwhile can effectively inhibit pathogenic vibrio pellicle formation on solids such as equipment and vessels; and in addition, the pathogenic vibrio phage VmYZU10474 is simple to prepare and convenient to use, and the risk that pathogenic vibrio is spread and causes food-borne diseases can be reduced.
Owner:YANGZHOU UNIV

Primer and probe for detecting vibrio cholerae or vibrio mimicus and detection method using the same

To produce high-performance specific gene amplification primers for detecting, quantifying, or identifying Vibrio cholerae and Vibrio mimicus, having low risk of misidentification and practically sufficient amplification efficiency and amplification specificity. We have determined partial nucleotide sequences of rpoD and gyrB genes of Vibrio cholerae, Vibrio mimicus, and closely related species, revealed their phylogenetic relationship, and then identified nucleotides characteristic of Vibrio cholerae and Vibrio mimicus, respectively. Thus, we have made it possible to design probes having high specificity and gene amplification primers having high specificity and excellent amplification efficiency, both of which contain the characteristic nucleotides.
Owner:NICHIREI FOODSKK

Vibrio mimicus chromogenic culture medium

The invention discloses a vibrio mimicus chromogenic culture medium with the following formula: 5g of yeast extract powder, 5g of fish peptone, 5g of peptone, 10g of sodium chloride, 8g to 10g of sodium citrate, 8.5g to 11g of sodium thiosulfate, 1g to 5g of sodium cholate, 2g to 7g of ox-bile powder, 15g to 20g of sucrose, 15g to 20g of cellobiose, 15g to 20g of arabinose, 1g to 3g of ironic citrate, 12g to 20g of agar, 0.04g of bromothymol blue, 0.04g of thymol blue and 1000mL of distilled water. The invention designs the vibrio mimicus chromogenic culture medium which is obviously different from other bacteria, especially other vibrio or other food pathogenic bacteria, according to the basic nutritional need, the specific ecological environment, the specific biochemical reaction, namely, an enzyme system and the metabolization rule, and the toleration to specific bacteria-resistant substances and the like of the vibrio mimicus, overcomes the defects of poor selectivity and the like of the traditional culture medium, and can quickly detect the vibrio mimicus in marine food products.
Owner:ZHEJIANG GONGSHANG UNIVERSITY

Gene chips for detecting multiple pathogenic bacteria in animals cultivated in sea water and uses thereof

The invention provides a gene chip for detecting various seawater cultured animal pathogenic bacteria and its application. The pathogenic bacteria include: Vibrio anguillarum, Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio harveyi, Vibrio fischeri, Vibrio splendidus, Vibrio riverina, Vibrio vulnificus, Vibrio cholerae non-O1, Vibrio mimicus, Vibrio salmonicida, Aeromonas hydrophila, Aeromonas sobria, Aeromonas salmonicida, Edward tarda Bacillus, Edwardsiella catfish, Renalobacter salmonidum, Mycobacterium marinum, Pseudomonas, Streptococcus.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Kit and method for detecting V.mimicus using loop-mediated equal-temperature amplification technology

The invention relates to a kit checking Vibrio mimicus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, Bst DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is gcggtcgtgggttacatttccattttaaggccaacaaagacgct; downstream inner primer is cagcatactgagtggttgccgcttttgcgatggtactaactgcgt; upstream outer primer is tcggataatgtggcgaaagc; downstream outer primer is tcacccatgtctgggtgtt. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for Vibrio mimicus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Vibrio mimicus efficient genetic combination method based on natural conversion and application

The invention discloses a vibrio mimicus efficient genetic combination method based on natural conversion and application. The method comprises the steps that a vibrio mimicus SCCF01 plant genome is adopted as a template, a target gene upper arm and target gene lower arm primer pair is adopted for amplifying a gene upper arm sequence and a lower arm sequence; a kanamycin resistance gene segment is amplified; the kanamycin resistance gene segment obtained through amplification, the target gene upper arm sequence and the lower arm sequence segments are fused, and a fusion PCR product containing the kanamycin resistance gene segment, the target gene upper arm sequence segments is obtained; the obtained PCR product and the acceptor vibrio mimicus SCCF01 plant are subjected to natural conversion, and the vibrio mimicus SCCF01 plant deleted plant is obtained by screening a resistance marker gene. Compared with the suicide plasmid mediated gene recombination technology and the lambda-RED recombination technology, no electricity conversion plasmid or targeting DNA is needed in the operation process, and operation is easy.
Owner:SICHUAN AGRI UNIV

Prepn and usage of extracellular product subunit vaccine of seawater fish morbid vibrio

The present invention is preparation and usage of extracellular product subunit morbid vibrio vaccine for seawater fish. The vibrio spawn is two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc. The vaccine preparing process includes culturing vibrio, extracting extracellular product and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.
Owner:GUANGDONG OCEAN UNIVERSITY

Vibrio bacteriophage PC-Liy1 with cross-species lysis capability, preparation method and application

The invention discloses a vibrio bacteriophage PC-Liy1 with cross-species lysis capability as well as a preparation method and application of the vibrio bacteriophage PC-Liy1. The bacteriophage belongs to the myophage family (Myoviridae). The vibrio phage disclosed by the invention has a wide host range and a relatively high splitting rate, and can be used for splitting vibrio alginolyticus, vibrio parahaemolyticus, vibrio cholerae, vibrio mimicus, vibrio neokarst and vibrio shewanii. The bacteriophage is high in environmental adaptability and has stable and good biological characteristics, and a biological bacteriostatic agent prepared from the bacteriophage can effectively control growth of vibrio in water and other environments.
Owner:青岛百奥安泰生物科技有限公司 +1

RPA-IAC primer for detecting vibrio mimicus and method

The invention provides a primer pair and an internal amplification control sequence. The primer pair comprises a nucleotide sequence as shown in SEQ ID NO:1 and a nucleotide sequence as shown in SEQ ID NO:2, and the internal amplification control sequence comprises a nucleotide sequence as shown in SEQ ID NO:3. The invention further provides the application of the primer pair and the internal amplification control sequence to the preparation of products for the detection or aided detection of vibrio mimicus, and a method for detecting the vibrio mimicus, based on a RPA-IAC technology. Experiments prove that the RPA-IAC primer is good in specificity, high in sensitivity and short in detection time, does not need special instruments, and is wide in application scope, and the RPA-IAC detection method for vibrio mimicus, based on the primer matched with an internal amplification control, is sensitive, accurate, convenient and rapid, and has a guiding significance on quarantining imported and exported cargoes and products.
Owner:INSPECTION & QUARANTINE TECH CENT SHANTOU CIQ +1

Vibrio mimicus OmpU adhesin protein binding peptide having adhesion antagonistic activity, polypeptide composition and application thereof

The invention relates to vibrio mimicus OmpU adhesin protein binding peptide having an adhesion antagonistic activity, a polypeptide composition and an application thereof. The vibrio mimicus OmpU adhesin protein binding peptide is composed of an amino sequence SEQ ID No.1, while the polypeptide composition is composed of three polypeptides: the SEQ ID No.1, the SEQ ID No.2 and the SEQ ID No.3, wherein the mass ratio of the three polypeptides represented as the SEQ ID No.1, the SEQ ID No.2 and the SEQ ID No.3 is 1:1:1. The vibrio mimicus OmpU adhesin protein binding peptide having the adhesion antagonistic activity and the polypeptide composition thereof not only can be specifically combined with OmpU adhesin protein but also can effectively inhibit that vibrio mimicus is adhered and immobilized on surface of intestinal mucosa through the adhesin, thereby eliminating toxicity of the vibrio mimicus. An adhesion antagonistic agent prepared from the OmpU adhesin protein binding peptide having the adhesion antagonistic activity and the polypeptide composition thereof can effectively prevent and treat fish ascites caused by the vibrio mimicus.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Multiplex PCR primer set and detecting method and kit for simultaneous detection of four pathogenic Vibrio

The invention discloses a multiplex PCR primer set and detecting method and kit for simultaneous detection of four pathogenic Vibrio. A detection primer set comprises primer pairs for detecting Vibrioparahaemolyticus, Vibrio vulnificus, Vibrio harveyi and Vibrio mimicus. The invention further provides a multiplex PCR detecting method and kit for the simultaneous detection of the four pathogenic Vibrio, by means of the primer set obtained by designing, multiplex PCR reaction is conducted on genome DNA of bacteria extracted from to-be-detected samples in the same reaction system, and whether ornot the pathogenic Vibrio is contained in the samples is determined according to the electrophoretic analysis on reaction products. The multiplex PCR primer set and detecting method and kit have theadvantages of being rapid and accurate, low in cost and high in specificity and sensitivity.
Owner:FUZHOU UNIV

Vibrio mimicus phage QY-1 with variety-crossing cracking characteristic, preparation method and application thereof

The invention relates to a vibrio mimicus phage QY-1 with a variety-crossing cracking characteristic, a preparation method and an application thereof. The separated vibrio mimicus phage is named as vibrio mimicus phage QY-1 (the preservation number is CCTCC NO: M2017588). The vibrio mimicus phage QY-1 has efficient variety-crossing cracking activity to vibrio mimicus, vibrio parahemolyticus and vibrio alginolyticus. A phage culture and a preparation thereof can serve as a biological bacteriostatic agent to control breeding of pathogenic vibrio and formation of a biofilm, so that the risk of pathogenic vibrio pollution of aquatic food and in a breeding processing environment is reduced.
Owner:YANGZHOU UNIV

Kit for detecting pathogenic vibrios

The invention discloses a kit for detecting pathogenic vibrios, and relates to a pathogenic vibrio detection technology. The kit comprises one or more of the following primer pairs: SEQ ID NO. 1-2, SEQ ID NO. 3-4, SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10, SEQ ID NO. 11-12, SEQ ID NO. 13-14, SEQ ID NO. 15-16, SEQ ID NO. 17-18 and SEQ ID NO. 19-20. The kit can be used for detecting common pathogenic vibrios such as vibrio cholerae, vibrio parahaemolyticus, vibrio vulnificus, vibrio mimicus, vibrio fluvialis and vibrio alginolyticus avoid non-specific amplification, and has strong specificity and high sensitivity.
Owner:SICHUAN HUAHAN TRIO BIOTECH CO LTD

Detection method of vibrio vulnificus

The invention discloses a detection method of vibrio vulnificus. The detection method comprises the following steps of A, detection sample making, B, gene extraction, C, 25ul reaction system preparing, D, multiplex fluorescence PCR, and E, data analysis. According to the detection method, the creative bacterial enrichment reagent technology, DNA extraction reagent technology, specific fluorescence probe hybridization PCR detection technology and multiplex PCR technology are adopted, no enriched culture is needed for samples, and false positive interference is reduced to the greatest extent on the premise of keeping high sensitivity. The detection method has the main beneficial effects that sample pre-enrichment is not needed, the bacterial detection sensitivity is high, specificity is good, and the false positive rate of conventional PCR amplification is reduced; and fast, accurate and specific detection on the vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio fluvailis can be achieved at the same time.
Owner:WUXI X RES PROD DESIGN & RES

Vibrio mimicus oral target epitope gene vaccine and preparation method and application thereof

The invention belongs to the technical field of gene vaccines and particularly relates to a vibrio mimicus oral target epitope gene vaccine. The vibrio mimicus oral target epitope gene vaccine comprises the following steps: S1, designing a vaccine target gene OVepis; S2, inserting the vaccine target gene OVepis designed in the S1 into 261-280bp of a related peptide fragment area of a II-type molecule in a protein coding gene CD74 of an immune carrier grass carp, wherein the direction is from 5'end to 3'end of a sequence; forming a CD74(1-261bp)-Ovepis-CD74(280-711bp) mosaic gene of 1020 bp, loading the mosaic gene by using a freeze-drying bacterial ghost of escherichia coli DH5a of a targeted delivery vector, and obtaining the target epitope gene vaccine. The nucleotide sequence of the mosaic gene is shown in SEQ ID NO:20. The vibrio mimicus oral target epitope gene vaccine has the beneficial effects that: the oral target epitope gene vaccine not only prevents the degradation of nuclease in vivo and increases the expression of a DNA encoding gene of the vaccine in a local antigen presenting cell of a mucous membrane, but also efficiently transfers an expressed and processed antigenpeptide to cells T and B, so that the immune effect of the vaccine is greatly improved.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Detection method for vibrio cholerae, vibrio parahaemolyticus and vibrio mimicus in foods

The invention discloses a PCR (Polymerase Chain Reaction) detection method for vibrio cholerae, vibrio parahaemolyticus and vibrio mimicus in foods. The method is characterized by comprising the following steps: performing secondary enriched culture on a sample to be detected; extracting vibrio genome DNA (Deoxyribonucleic Acid) by adopting a water boiling method; then performing electrophoresis,dyeing and bleaching after a PCR reaction; observing the result with a gel imager and photographing; finally performing spectrum analysis to obtain a detection result. The detection method has the advantages that the vibrio cholerae, vibrio parahaemolyticus and vibrio mimicus in foods can be detected simultaneously, the detection speed can be improved under the condition of not influencing the detection rate, and the workload and detection cost are lowered.
Owner:邵楚瑶

Primer and probe for detecting vibrio cholerae or vibrio mimicus and detection method using the same

The invention produces high-performance specific gene amplification primers for detecting, quantifying, or identifying Vibrio cholerae and Vibrio mimicus, having low risk of misidentification and practically sufficient amplification efficiency and amplification specificity. We have determined partial nucleotide sequences of rpoD and gyrB genes of Vibrio cholerae, Vibrio mimicus, and closely related species, revealed their phylogenetic relationship, and then identified nucleotides characteristic of Vibrio cholerae and Vibrio mimicus, respectively. Thus, we have made it possible to design probes having high specificity and gene amplification primers having high specificity and excellent amplification efficiency, both of which contain the characteristic nucleotides.
Owner:NICHIREI FOODSKK

Method for detecting pathogenic vibrios

The invention discloses a method for detecting pathogenic vibrios, and relates to a pathogenic vibrio detection technology. The detection method uses one or more of the following primer pairs for PCR:SEQ ID NO. 1-2, SEQ ID NO. 3-4, SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10, SEQ ID NO. 11-12, SEQ ID NO. 13-14, SEQ ID NO. 15-16, SEQ ID NO. 17-18 and SEQ ID NO. 19-20. The method can be used for detecting common pathogenic vibrios such as vibrio cholerae, vibrio parahaemolyticus, vibrio vulnificus, vibrio mimicus, vibrio fluvialis and vibrio alginolyticus avoid non-specific amplification, and has strong specificity and high sensitivity.
Owner:SICHUAN HUAHAN TRIO BIOTECH CO LTD

A nucleic acid combination and application thereof for detection of pathogenic vibrio

The invention discloses a nucleic acid combination for detecting pathogenic vibrio and its application, and relates to the detection technology of pathogenic vibrio. The nucleic acid combination includes one or more of the following primer pairs: SEQ ID NO.1-2, SEQ ID NO.3-4, SEQ ID NO.5-6, SEQ ID NO.7-8, SEQ ID NO.7-8, SEQ ID NO. ID NO.9-10, SEQ ID NO.11-12, SEQ ID NO.13-14, SEQ ID NO.15-16, SEQ ID NO.17-18 and SEQ ID NO.19-20; the nucleic acid combination Through the PCR method, it can detect common pathogenic Vibrio such as Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio mimicus, Vibrio riverine, Vibrio alginolyticus, etc., to avoid non-specific amplification, with Strong specificity and high sensitivity.
Owner:SICHUAN HUAHAN TRIO BIOTECH CO LTD

Vibrio mimetic ompu adhesin protein binding peptide with adhesion antagonistic activity, polypeptide composition and application thereof

The invention relates to vibrio mimicus OmpU adhesin protein binding peptide having an adhesion antagonistic activity, a polypeptide composition and an application thereof. The vibrio mimicus OmpU adhesin protein binding peptide is composed of an amino sequence SEQ ID No.1, while the polypeptide composition is composed of three polypeptides: the SEQ ID No.1, the SEQ ID No.2 and the SEQ ID No.3, wherein the mass ratio of the three polypeptides represented as the SEQ ID No.1, the SEQ ID No.2 and the SEQ ID No.3 is 1:1:1. The vibrio mimicus OmpU adhesin protein binding peptide having the adhesion antagonistic activity and the polypeptide composition thereof not only can be specifically combined with OmpU adhesin protein but also can effectively inhibit that vibrio mimicus is adhered and immobilized on surface of intestinal mucosa through the adhesin, thereby eliminating toxicity of the vibrio mimicus. An adhesion antagonistic agent prepared from the OmpU adhesin protein binding peptide having the adhesion antagonistic activity and the polypeptide composition thereof can effectively prevent and treat fish ascites caused by the vibrio mimicus.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Rapid detection method of microdroplet digital PCR for Vibrio mimicus in aquatic products

The invention discloses a microdroplet digital PCR rapid detection method for mimetic vibrio in aquatic products. First, the genomic DNA of the enrichment solution of the aquatic product sample to be tested is extracted and diluted for use; then the conserved DNA sequence of the mimetic vibrio genome is used to design Specific primers and probes; then use the primers and probes to perform microdroplet digital PCR amplification and detection on the genomic DNA of the enriched bacteria solution of the aquatic product sample to be tested. After PCR amplification, the droplet analyzer was used to detect each droplet one by one. The droplet with fluorescent signal was interpreted as 1, and the droplet without fluorescent signal was interpreted as 0. Finally, according to the Poisson distribution principle and positive droplets The concentration or copy number of the target molecule to be detected is calculated. Droplet digital PCR can directly obtain the number of DNA molecules, and can perform absolute quantification of Vibrio mimicus in aquatic products. It has the advantages of high sensitivity, accurate quantification, wide linear range of detection, good specificity and moderate cost.
Owner:LINYI UNIVERSITY

gi Genotype Norovirus Reverse Transcription Rolling Circle Amplification Method

The invention relates to a GI genome type norovirus reverse transcription roll loop amplification detection method. A gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe comprises one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of vibrio hollisae, vibrio vulnificus, vibrio cholera, vibrio parahaemolyticus, vibrio harveyi, vibrio alginolyticus, vibrio furnissii, vibrio mimicus and vibrio damsel; 2) complementary DNA sequences of the DNA sequences selected from the 1); 3) complementary DNA sequences of the DNA sequences selected from 1) or 2). A kit comprises the gene chip. The gene chip and the kit provided by the invention are used for detecting nine pathogenic vibrios in ocean products, and are simple and convenient to operate, good in sensitivity and high in repeatability.
Owner:ZHOUSHAN INST OF CALIBRATION & TESTING FOR QUALITY & TECHNICAL SUPERVISION