Kit for detecting pathogenic vibrios

A pathogenic vibrio and kit technology, applied in the field of kits for detection of pathogenic vibrio, can solve the problems of high detection limit, long detection time, prone to false positives, etc., achieve high specificity and sensitivity, The effect of improving detection sensitivity and avoiding non-specific amplification

Active Publication Date: 2018-11-20
SICHUAN HUAHAN TRIO BIOTECH CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the methods reported above, it can be seen that the existing multiple detection methods for pathogenic Vibrio can detect no more than 4 types of Vibrio, and the applied method is limited by the technology itself. false positives etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting pathogenic vibrios
  • Kit for detecting pathogenic vibrios
  • Kit for detecting pathogenic vibrios

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] This embodiment describes a kit for detecting pathogenic Vibrio, which includes a nucleic acid combination and a membrane chip.

[0148] Wherein, the nucleic acid combination includes the following primer pairs, and the base sequences (5'-3') of the upstream primer and the downstream primer of each primer pair are as follows:

[0149] First primer pair for Vibrio cholerae toxR gene (toxR(V.c)):

[0150] Upstream primer: ATTGACGGCTACGCCATCGACA (SEQ ID NO.1), downstream primer: ACCGCAGCCCAGCCAATGTTG (SEQ ID NO.2);

[0151] Second primer pair for detection of Vibrio cholerae ctxAB gene:

[0152] Upstream primer: CATCTGGATGAGGACTGTATGC (SEQ ID NO.3), downstream primer: GCCAAGAGGACAGAGTGAGTA (SEQ ID NO.4);

[0153] The third primer pair for detecting Vibrio parahaemolyticus toxR gene (toxR(V.p)):

[0154] Upstream primer: GAAGGCAGCCAGATGTTGATT (SEQ ID NO.5), downstream primer: TCTCAGTTCCGTCAGATTGGT (SEQ ID NO.6);

[0155] The fourth primer pair used to detect the tlh gen...

Embodiment 2

[0206] The method for detecting pathogenic Vibrio in the sample to be tested by using the above kit is as follows:

[0207] 2.1 Use 3% sodium chloride alkaline peptone water to carry out mixed bacterial enrichment culture on the sample, and take the cultured mixed bacterial solution for DNA extraction; this step is carried out as required.

[0208] 2.1 Extract the genomic DNA of the sample to be tested according to the CTAB method, and use an ultra-micro spectrophotometer to measure the mass concentration of the DNA solution for later use.

[0209] 2.2 Multiplex PCR system and conditions

[0210] The reaction system of PCR amplification:

[0211] 10×PCR Buffer (with Mg 2+ , containing UNG enzyme): 5 μL;

[0212] dNTP (2.5mM each): 5μL;

[0213] Taq DNA polymerase (5U / μL): 0.5 μL;

[0214] Biotin-labeled downstream primers (20 μM): 1.2 μL; upstream primers (20 μM): 1 μL; instructions: 11 primer pairs (provided in Example 1) were added, each primer pair had 1.2 μL of downst...

Embodiment 3

[0249] According to the instructions of Tiangen Biochemical Technology (Beijing) Co., Ltd. Bacterial Genomic DNA Extraction Kit (Cat. No.: DP302), extract different pathogenic Vibrio standard strains (Vibrio cholerae (without virulence factor ctxAB), Vibrio cholerae O1 group) (with virulence factors ctxAB), Vibrio parahaemolyticus 1 (without virulence factors tdh or trh), Vibrio parahaemolyticus 2 (with virulence factors tdh and trh), Vibrio vulnificus, Vibrio mimicus, Vibrio riverines and Vibrio alginolyticus) genomic DNA. The concentration and quality of the extracted DNA were measured with an ultra-micro spectrophotometer (Thermo NanoDrop 2000) for later use.

[0250] With the kit of Example 1, detect according to the method of Example 2, according to the color development of the hybridization point with reference to figure 1 Interpret the results, the results are as follows figure 2 shown.

[0251] figure 2 Vibrio cholerae (non-V. cholerae O1 or V. cholerae O139 grou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit for detecting pathogenic vibrios, and relates to a pathogenic vibrio detection technology. The kit comprises one or more of the following primer pairs: SEQ ID NO. 1-2, SEQ ID NO. 3-4, SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10, SEQ ID NO. 11-12, SEQ ID NO. 13-14, SEQ ID NO. 15-16, SEQ ID NO. 17-18 and SEQ ID NO. 19-20. The kit can be used for detecting common pathogenic vibrios such as vibrio cholerae, vibrio parahaemolyticus, vibrio vulnificus, vibrio mimicus, vibrio fluvialis and vibrio alginolyticus avoid non-specific amplification, and has strong specificity and high sensitivity.

Description

technical field [0001] The invention relates to the technical field of pathogenic vibrio detection, in particular to a kit for detecting pathogenic vibrio. Background technique [0002] Food-borne diseases are one of the most widespread health problems in the world today, and the incidence rate ranks first among various human diseases. According to the data of the World Health Organization (WHO), food-borne and water-borne diarrheal diseases cause about 2.2 million deaths every year , most of whom are children; in industrialized countries, more than 30% of the population suffers from foodborne illness each year. [0003] Pathogenic Vibrio (Pathogenic Vibrio) is an important class of food-borne pathogens, which widely exist in the natural water environment, especially in seawater, and have a large degree of pollution to seafood. my country's coastal provinces have vast sea areas and abundant seafood. Residents love to eat seafood, and have always had the habit of eating raw ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/04C12R1/63
CPCC12Q1/689C12Q2600/16Y02A50/30
Inventor 韩嘉钰李文静金大智张京云彭丽
Owner SICHUAN HUAHAN TRIO BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap