146 results about "Intestinal mucosa" patented technology

The invention discloses a vitamin K2 composite micro-capsule system with stomach protection and intestine slow release functions and a preparation method and application thereof, the vitamin K2 composite micro-capsule system with stomach protection and intestine slow release functions comprises three layers, namely a core layer, a middle layer and an outer layer from inside to outside in sequence; the core layer is formed by coating vitamin K2 with a zein-lac hydrophobic core, the middle layer is a pea protein-pectin electrostatic compound, and the outer layer is sodium alginate and chitosan double-network gel. The micro-capsule system provided by the invention can be tightly combined in a gastric acid environment after being orally taken, the release of active ingredients in the stomach is reduced, and then the micro-capsule system stays at intestinal mucosa for a long time and slowly releases contents, so that the functions of the micro-capsule system are slowly presented outside, the half-life period is prolonged, and the action effect is improved. Vitamin K2 directly or indirectly participates in and regulates various physiological processes related to health, and plays an important role in the aspects of maintaining bone health, preventing cardiovascular diseases, protecting nerves, improving metabolism and the like.

The invention discloses a zinc polyphenol complex suppository as well as a preparation method and application thereof. The preparation process mainly comprises two steps as follows: a, preparation of EGCG-Zn metal polyphenol complex nanoparticles; and b, preparing the nano complex suppository. The method is simple in process, green, environment-friendly and suitable for large-scale preparation. The prepared EGCG-Zn nanoparticles are uniform in particle size and good in stability, and have good antioxidant, anti-inflammatory and tissue repair activity based on a complex network structure formed by self-assembly of EGCG and zinc ions. The nano-particles are firstly treated by adopting a drug pretreatment carrier and then loaded in a suppository matrix to construct a rectal administration type nano-suppository, so that targeted and continuous local drug effect release can be realized. In intervention of radioactive intestinal injury, the suppository not only can relieve oxidative stress and inflammatory response, but also can promote regeneration and repair of intestinal mucosa, and has good treatment potential and clinical application prospect.

The invention discloses a functional probiotic composition and application thereof, and relates to the technical field of microbial engineering. Bifidobacterium longum, lactobacillus acidophilus and enterococcus faecalis are combined to serve as a microbial agent, the microbial agent and active substances of the tea leaves form a composition, then the composition is combined with prebiotics, it is ensured that viable bacteria directly reach the intestinal tract through a microencapsulation technology, and the effect of improving the immune function is achieved; tea polyphenol in the active substances of the tea leaves can serve as a carbon source of prebiotics to stimulate proliferation of the bifidobacterium longum and the lactobacillus acidophilus, so that the acid resistance and intestinal colonization capacity of the microbial inoculum are enhanced, and meanwhile, theanine in the active substances of the tea leaves, the bifidobacterium longum and the lactobacillus acidophilus synergistically promote secretion of gamma-aminobutyric acid, so that the effect of improving the intestinal colonization is achieved. And the tea polyphenol can inhibit the large intestine rod from adhering to the intestinal mucosa, and the probiotic agent secretes antibacterial peptide, so that the integrity of the intestinal barrier is maintained together.

The invention relates to the technical field of functional food, in particular to immune regulation type prebiotic syrup with synergy of galactomannan. The active components of the composite solid beverage are prepared from the following raw materials in percentage by weight: 20%-35% of fructo-oligosaccharide, 10%-18% of galactooligosaccharide, 8%-15% of stachyose, 3%-7% of xylooligosaccharide, 5%-12% of lactitol, 5%-10% of galactomannan, 2%-5% of yeast beta-glucan and 1%-3% of N-acetylglucosamine. The composition further comprises 4-8% of inulin and 3-6% of resistant dextrin as a matrix filling and slow-release carrier, and the sum of the weight percentages of all the active ingredients and the carrier is 100%. By remodeling intestinal microecology and inhibiting inflammation pathways, the intestinal inflammation state can be remarkably improved, expression of intestinal mucosa tight junction protein is promoted, and an innovative solution is provided for people suffering from chronic bowel diseases and immune imbalance.

The invention discloses a multi-layer multi-release metagen composition and application thereof in quickly promoting defecation, lubricating intestinal tracts, relieving intestinal problems such as flatulence, stomachache, diarrhea, constipation, irritable bowel syndrome and inflammatory bowel disease, maintaining intestinal flora balance, repairing intestinal tracts, repairing intestinal mucosa health, relieving dyspepsia and improving gastrointestinal functions.

The invention discloses multi-component inulin hydrogel as well as a preparation method and application thereof, and belongs to the technical field of nano materials and medicines.The multi-component inulin hydrogel is characterized in that a medicine L-alanyl-L-glutamine contributing to intestinal mucosa repair is entrapped in the inulin hydrogel; the multi-component inulin hydrogel has the advantages that the multi-component inulin hydrogel is prepared from the inulin and composite nanoparticles (namely mesoporous polydopamine-gallium composite nanoparticles) composed of an active oxygen scavenger polydopamine and an antibacterial agent gallium ions, the repairing capacity on intestinal barriers is further enhanced, and the prepared multi-component inulin hydrogel can be used for effectively treating inflammatory bowel diseases and non-alcoholic steatohepatitis.

The invention belongs to the related technical field of pet prescription food products, and particularly relates to a prescription food for pet dogs with acute intestinal inflammation and a preparation method of the prescription food, the prescription food comprises various components such as rice, barley, chicken powder and corn protein powder, and probiotics are self-made and comprise bifidobacterium, lactobacillus acidophilus and lactobacillus casei. The preparation method comprises the steps of quantitative raw material weighing, auxiliary agent grinding, constant-temperature accurate grinding, adding of specific components for accurate grinding again, heat preservation, deodorization and degassing, drop casting forming, cooling, packaging, sealed storage and the like. Compared with the prior art, the prescription food is high in safety, and feeding tests of healthy dogs have no abnormity; clinical cases show that the leucocyte number and the inflammatory factor content of sick dogs can be reduced; the intestinal barrier can be repaired, so that the intestinal mucosa repair is accelerated; intestinal flora can be improved, and the content of short-chain fatty acid in excrement is increased; the nutrition state can be maintained, and the weight loss range of sick dogs is reduced.

The invention relates to the technical field of optical detection, in particular to an intelligent prediction system for an intestinal mucosa antioxidant active peptide purification process, which is characterized in that multi-source spectral data of an ultrafiltration process are acquired, and the multi-source spectral data comprise ultraviolet visible spectral data, fluorescence spectral data and Fourier transform infrared spectral data; performing two-dimensional conversion on the multi-source spectral data to obtain two-dimensional spectral data; fusing the two-dimensional spectral data to obtain multi-channel spectral data; identifying the multi-channel spectral data to obtain activity prediction data; and constructing a parameter optimization model, and performing online rolling optimization solution according to the activity prediction data to obtain ultrafiltration optimization parameters. Purification control is carried out by optically detecting and identifying the activity of the material.

According to the application disclosed by the invention, the new lactobacillus rhamnosus LR159 is found for the first time, and the strain can be used for effectively treating the inflammatory bowel disease by inhibiting the inflammation level, recovering the barrier function of intestinal mucosa and regulating and improving the intestinal microenvironment. Compared with known lactobacillus rhamnosus, the LR159 strain provided by the invention has better intestinal colonization ability, and can realize more lasting anti-inflammatory and mucous membrane repair effects by breaking through the limitation of pathological microenvironment of the inflammatory bowel disease, thereby enhancing the treatment effect of the inflammatory bowel disease. In conclusion, the lactobacillus rhamnosus LR159 has a great application prospect in preventing and treating the inflammatory bowel disease.

The invention provides a positioning device for an alimentary canal lesion endoscope, and relates to the technical field of alimentary canal endoscopes, the positioning device comprises an endoscope pipeline, an adjusting mechanism facilitating adjustment is arranged on the endoscope pipeline, a supporting mechanism facilitating positioning is arranged on the endoscope pipeline, and the adjusting mechanism comprises a protective hollow column and a mounting column; the supporting mechanism comprises an endoscope probe, a first adjusting pipe and a suction cup, the protective hollow column is slidably mounted at the circumferential end of the endoscope pipeline, and the mounting column is fixedly mounted at the circumferential end of the endoscope pipeline. By arranging the umbrella type supporting structure composed of the first adjusting tube, the second adjusting tube and the universal joint, the actual interior of the digestive tract is not a flat environment, natural wrinkles exist on the stomach wall, the intestinal mucosa fluctuates in a concave-convex mode, and individual differences exist in the forms of the digestive tracts of different patients; the multi-point supporting design of the umbrella type structure enables a plurality of supporting point positions to be respectively attached to mucous membranes at different positions around the focus.

The invention discloses a traditional Chinese medicine navel pill for treating constipation, diarrhea and chronic enteritis and a preparation method of the traditional Chinese medicine navel pill, and belongs to the technical field of traditional Chinese medicine. The preparation method comprises the following steps: weighing the raw materials, mixing, crushing and sieving to obtain mixed medicine powder, adding honey into the mixed medicine powder, stirring and kneading until the mixture is sticky, and preparing pills. The navel pill is applied to the navel, two-way conditioning of constipation and diarrhea is achieved through the synergistic effect of traditional Chinese medicine, chronic enteritis can be treated in a targeted mode, intestinal mucosa is effectively repaired, the intestinal inflammation state is improved, the navel pill has the advantages of being safe and convenient to apply, high in bioavailability, mild and free of side effects, stimulation of oral medicine to gastrointestinal tracts is avoided, and the curative effect is good. The food is suitable for digestion function conditioning of different people.

The invention discloses a lipidosome composite hydrogel microsphere for repairing damaged intestinal mucosa and a preparation method thereof, LHMs (at) 4-OI is composed of hyaluronic acid modified targeted drug-loaded lipidosome, sodium alginate, hydrochloric acid treated sucralfate and a CaCl cross-linking agent, and rapid gel forming is carried out under the voltage of 11.0 KV through an electrospray technology. The microspheres have pH responsiveness and gastric juice digestion resistance, CD44 receptor targeting is achieved through hyaluronic acid modification, sodium alginate and Ca form an egg box structure to provide a three-dimensional network, and sucralfate enhances adhesion to isolate harmful substances. The preparation method comprises the steps of preparation of the drug-loaded liposome by a film hydration method, hyaluronic acid modification and electrospray crosslinking, is simple to operate and low in cost, and can be used for large-scale production. The microspheres can effectively load an anti-inflammatory drug 4-OI, inhibit expression of inflammatory factors and promote self-repair of damaged intestinal mucosa, and have wide application prospects in the fields of abdominal infection, inflammatory bowel diseases, colorectal cancer and the like.

The present invention addresses the problem of: developing a method capable of noninvasively sampling and analyzing intestinal mucosa bacteria; analyzing the intestinal bacteria, especially intestinal mucosa bacteria on the basis of the method; and developing a therapeutic method for diseases occurring in the intestinal tract for which therapeutic methods have not been established.　The inventors of the present invention have found that bacteria contained in a cotton swab (swab) sample on the feces surface exhibit a bacterial flora composition similar to that of bacteria existing in the intestinal mucosa; and, as a result of analysis based on the finding, have clarified that Adlercreutzia, which has not been reported until now as a mucosa-related bacterium, lives in the large intestinal mucosa layer, produces taurine, which is a strong anti-inflammatory compound, by the action of the bile acid-deconjugating enzyme, and alleviates enteritis, thereby completing the present invention. In other words, the present invention can provide a composition having an anti-inflammatory effect, which includes a bacterium of the genus Adlercreutzia, or a bile acid-deconjugating enzyme that is derived from a bacterium of the genus Adlercreutzia.

The utility model provides a metal support for intestinal canal anastomosis and anastomotic leakage, which relates to the technical field of medical instruments and comprises a metal support, a drainage tube and a support release device, the metal support is arranged in the support release device before being released, and the metal support is dumbbell-shaped after being released and comprises a first raised section, a second raised section and a groove section, the groove section is a double-layer metal net and comprises an inner-layer metal net and an outer-layer metal net, a space is formed between the inner-layer metal net and the outer-layer metal net, the inner face and the outer face of the metal support are both wrapped with silica gel coatings, a plurality of round holes communicated with the space are formed in the silica gel coating of the outer-layer metal net, the drainage tube is connected with the groove section, and the interior of the drainage tube is communicated with the space. After being released, the metal stent can block a digestive tract ventage or support liquid secreted by an anastomotic stoma, intestinal mucosa, blood vessels and ventage tissue, the liquid can enter the space between the two layers of metal stent nets through the round holes in the silica gel coating of the outer-layer metal net and is sucked out by negative pressure, cleanliness of the anastomotic stoma and the ventage can be kept, and healing of the anastomotic stoma and the ventage is promoted.

The invention discloses a piglet anti-diarrhea complete feed formula based on a microecological preparation, and relates to the technical field of animal nutrition and health. The microsphere has a unique three-layer core-shell structure, wherein a core layer is coated with butyric acid producing probiotics and precise prebiotics; the middle layer is a chitosan-gallic acid-vanillin terpolymer with dual functions of strong mucous membrane adsorbability and quorum sensing quenching; and the shell layer is a pH-sensitive slow-release coating and is loaded with an acidifying agent. The structure is constructed through a layer-by-layer coating process, and the technical problems that in the prior art, functional components cannot be delivered in a targeted mode, the synergistic effect is poor, and intestinal barriers cannot be actively repaired are solved. When the microspheres enter animal digestive tracts, the shell layer firstly releases an acidifying agent at the front end to inhibit pathogenic bacteria and clear obstacles for subsequent steps; after entering the small intestine, the middle layer polymer is released, adheres and repairs the damaged intestinal mucosa in the form of a biological bandage, and interferes pathogen communication at the same time.

The invention discloses burdock tea containing low-molecular hyaluronic acid fragments and a preparation method of the burdock tea, and belongs to the technical field of functional tea drinks. The burdock tea comprises the following raw materials in parts by weight: 1 part of a low-molecular hyaluronic acid fragment and 100 parts of burdock, the preparation method comprises the following steps: (1) selecting low-molecular hyaluronic acid fragment dry powder and fresh burdock slices; (2) dissolving the low-molecular hyaluronic acid fragment dry powder in purified water to obtain a hyaluronic acid solution; and (3) uniformly spraying the hyaluronic acid solution on the fresh burdock slices, and baking to obtain the burdock slices. According to the invention, low-molecular hyaluronic acid fragments with specific molecular weight and distribution are organically combined with burdock, and a unique preparation process is adopted, so that a tea beverage with multiple health-care effects is prepared. The burdock tea not only can repair intestinal mucosa and improve gastrointestinal tract discomfort, but also has various effects of moisturizing skin, beautifying, resisting aging, assisting in treating metabolic diseases, relaxing bowel, removing free radicals in the body, enhancing the immunity of the human body and the like.

The invention discloses sea-buckthorn, radix astragali and yeast beta-glucan granules and application thereof, and relates to the technical field of food health care, and the sea-buckthorn, radix astragali and yeast beta-glucan granules are prepared from the following raw materials: sea-buckthorn, radix astragali, yeast beta-glucan, American ginseng, radix salviae miltiorrhizae, fructus lycii, flos sophorae, fructus crataegi, xylitol, erythritol, cordyceps militaris, inonotus obliquus, radix polygonati officinalis, rhizoma dioscoreae, radix ophiopogonis and fructo-oligosaccharide. According to the invention, a three-dimensional efficacy system of immune activation, inflammation inhibition and intestinal repair is constructed through scientific proportioning of raw materials such as sea-buckthorn, astragalus membranaceus, yeast beta-glucan, cordyceps militaris and inonotus obliquus. The core components have a synergistic effect, so that not only can the activity of immune cells be activated and the immunity of the organism be improved, but also the release of inflammatory factors can be inhibited, the inflammatory response can be relieved, and meanwhile, the intestinal beneficial bacteria can be proliferated, the intestinal mucosa can be repaired and the intestinal micro-ecology can be improved. Compared with traditional medicinal and edible granules with a single effect, the product can meet the health requirements of people with different constitutions and is richer in adaptive scene.

The invention relates to a system for intestinal delivery of therapeutic agents. Described herein are systems for enteric delivery of therapeutic agents, and methods of administering therapeutic agents to a patient by oral administration of an enteric delivery system. An intestinal delivery system includes one or more carrier members comprising a carrier polymer and a therapeutic agent, and the system may be configured in a compressed configuration and an expanded configuration, and sized to maintain contact with an intestinal wall of a small intestine by applying an outward pressure to the intestinal wall, and transporting at least a portion of the therapeutic agent across the intestinal mucosa of the small intestine.

The present approach relates to a probe device (105) for the selective removal and / or modification of intestinal mucosa. The probe device (105) comprises a tubular housing (120) with a treatment probe (125) at one end of the housing (120), a radiation guide (130), and a positioning element (200). The radiation guide (130) is configured to emit electromagnetic radiation (115) guided within the radiation guide (130) via an outlet (240) in the treatment probe (125) to the surrounding area of ​​the probe device (105). The positioning element (200) is configured to fix the treatment probe (125) and / or the outlet (240) in a segment of the intestine.

The application relates to the technical field of traditional Chinese medicine preparation, and particularly discloses a compound traditional Chinese medicine preparation for targeting egg duck and goose egg cytoplasmic disease, which comprises the following components: white head, Coptis chinensis, Huangqi, Phellodendron amurense, wine Danpi, bran-fried peach kernel, Chinese perilla, pomegranate peel, liquorice, honeysuckle, Andrographis, figwort, emblic, ginger, fried atractylodes, fried safflower, Xianhecao, spiny amaranth, and Poria cocos. Through the combination of monarch, minister, assistant and messenger, the core effects of heat-clearing and detoxifying, blood-cooling and dysentery-stopping, and dampness-drying and insect-killing of the medicines are synergistically exerted, the pathogenesis characteristics of the egg cytoplasmic disease are accurately targeted, blood stasis and blood circulation are promoted to eliminate the swelling of the lesion, and the intestinal mucosa damage is repaired to stop bleeding, the symptoms of hematochezia, diarrhea and oviduct inflammation of the egg duck and goose caused by the egg cytoplasmic disease are effectively relieved, the problems of the decreased antibiotic effect, drug residue, bacterial flora disorder and food safety risk are effectively solved, and the compound traditional Chinese medicine preparation has the remarkable progress of drug resistance, safety, no residue, intestinal protection and green environmental protection.

The invention belongs to the technical field of medical nutritional food, and particularly relates to an enteral nutritional composition for improving intestinal intolerance of postoperative patients and application of the enteral nutritional composition. The invention provides an enteral nutrition composition for improving intestinal intolerance of postoperative patients, the enteral nutrition composition is composed of carbohydrates, proteins and composite minerals, the carbohydrates and the proteins are taken as the basis, the composite minerals are strengthened, the requirement of enteral nutrition support is met, the normal secretion function of intestinal mucosa is ensured, and the intestinal intolerance of the postoperative patients is improved. According to the present invention, the intestinal tract barrier function can be maintained, the nutrition state can be improved, the nitrogen balance of the body can be promoted, the immune regulation can be maintained, the polysaccharide-protein composite gel system can be formed in vivo, the free water of the intestinal tract can be cured, the postoperative enteric cavity water sample diarrhea can be significantly reduced, and the dehydration and electrolyte disorder caused by diarrhea can be rapidly corrected;

The invention relates to a composition for promoting pet hair discharge as well as a preparation method and application thereof. The composition comprises chicken, compound cellulose DR04, probiotics and digestion coenzyme, the composite cellulose DR04 comprises a Cunninghamia lanceolata extract, apple fiber powder, a beet extract and psyllium husk powder. According to the composition for promoting hair removal of pets, the cedarwood extract in the composite cellulose DR04 is insoluble fiber, forms a loose net-shaped structure to disperse hair after entering the intestinal tract, can promote intestinal tract movement, and helps cats to remove hair balls in the belly in a defecation mode. The Cunninghamia lanceolata extract is compounded with the apple fiber powder, the beet extract and the psyllium husk powder, so that wrapping and pushing dual promotion of hair removal is realized, and the hair removal efficiency is improved. The chicken, the probiotics and the digestion coenzyme are also added, so that the pet hair removal is further promoted, the palatability of the composition is also improved while the intestinal mucosal barrier is improved, and the composition is more suitable for being eaten by pets.

The invention relates to dendrobium polysaccharide as well as a preparation method and application thereof. The method comprises the following steps: preparing dendrobium into dendrobium powder; performing carbon dioxide supercritical extraction on the dendrobium nobile powder by using ethanol as an entrainer to obtain dendrobium nobile powder; performing water extraction on the dendrobium nobile extract powder to obtain a dendrobium nobile water extract; and drying the dendrobe water extract to obtain the dendrobe polysaccharide. The dendrobium polysaccharide obtained by the method is high in purity and large in molecular weight, and has the effects of dispelling the effects of alcohol and protecting liver and intestinal mucosa; the method is simple and convenient to operate, toxic reagents are not introduced in the whole process, the preparation process is green, natural and safe, and high yield, high purity and food safety are considered.

The invention relates to application of lipidosome nano-selenium in preparation of a nutritional feed additive, and belongs to the field of poultry feed. The invention provides an application of lipidosome nano-selenium in preparation of a nutritional feed additive. Experiments prove that the selenium content in serum of the broiler fed with the phospholipid bilayer-coated nano-selenium is remarkably higher than that of the broiler fed with a selenium compound not coated with the phospholipid bilayer, the phospholipid bilayer can promote the broiler to absorb the nano-selenium, the utilization rate of selenium in the broiler is further increased, and the yield of the broiler is increased. The chicken quality is improved. Meanwhile, the lipidosome nano-selenium can improve the immune performance of the intestinal mucosa of the poultry, optimize the intestinal flora structure, promote the generation of beneficial metabolites, namely short-chain fatty acids, of the intestinal tract, improve the health level of the intestinal tract of the poultry, reduce the addition of antibiotics and promote the green, healthy and sustainable development of the livestock and poultry industry.

This invention relates to the field of feed additive technology, specifically to a feed additive that promotes digestion and absorption and its preparation process. The preparation process of a feed additive that promotes digestion and absorption includes: preparing antioxidant-modified chicken fat; preparing an extract; preparing a composite oil phase; and preparing the feed additive. In this invention, the extract of Shenqu (a type of fermented wheat) can directly compensate for insufficient endogenous enzyme secretion in laying hens, rapidly decomposing starch in feed and chicken fat in plant proteins, laying the foundation for subsequent absorption. The extract of Zhishi (a type of immature bitter orange) accelerates gastrointestinal motility and digesta emptying, while also promoting bile and pancreatic juice secretion, further improving the digestibility and utilization rate of fat-soluble components in laying hens. The extract of pine pollen can repair the intestinal mucosa, increase intestinal villus height, increase the nutrient absorption area, and regulate the intestinal microecology, reducing nutrient loss and intestinal stress. The combined use of these three ingredients synergistically promotes the digestive and absorptive capacity of laying hens.

The invention relates to a traditional Chinese medicine composition for treating ulcerative colitis in a remission stage as well as a preparation method and application of the traditional Chinese medicine composition. The traditional Chinese medicine composition comprises the following traditional Chinese medicine raw materials in parts by weight: 5-35 parts of humifuse euphorbia herb, 3-12 parts of carbonized sanguisorba root, 3-12 parts of gordon euryale seed, 1-6 parts of rhizoma bletillae, 0.5-5 parts of gallnut, 0.06-0.3 part of catechu and 0.02-0.12 part of pearl powder. According to the traditional Chinese medicine, the effects of all the medicines are synergistic, and all the medicines are combined to achieve the effects of attacking evil, tonifying deficiency, clearing waste heat, dispersing blood stasis, stopping bleeding, tonifying spleen and consolidating root; dynamic and static are combined, blood circulation is promoted, stasis is prevented, astringency is induced, and positive consumption is prevented. The multiple medicines synergistically play roles in healing sore, promoting tissue regeneration and repairing intestinal mucosa, directly refer to the core goal of healing ulcerative colitis, and are suitable for the pathogenesis characteristics of gradual decline of damp-heat and spleen deficiency reveal in the remission period of ulcerative colitis.

[PROBLEM] To provide a formulation that is safe for ingestion over a long period of time and can improve the enterobacterial flora or can enhance the barrier function of the intestinal mucosa.[SOLUTION] The present invention is an enteric capsule formulation for improving enterobacterial flora containing nicotinamide mononucleotide as an active ingredient.

The invention provides a pharmaceutical composition for protecting intestinal injury caused by chemotherapy and application, and belongs to the field of medicines. The invention also provides a pharmaceutical composition for protecting intestinal mucosa tight junction injury caused by chemotherapy. The pharmaceutical composition is prepared from the following raw material medicines in parts by weight: 1-3 parts of astragalus polysaccharide and 1-3 parts of ziyuglycoside I. According to the invention, the compatibility of astragalus polysaccharide and ziyuglycoside I not only can improve the immunity of the organism after chemotherapy, but also can protect intestinal mucosal injury caused by intestinal chemotherapy drugs, and solves the problem that no special-effect drug for intestinal injury after chemotherapy exists in the current market, and pharmacodynamic tests prove that when the compatibility of astragalus polysaccharide and ziyuglycoside I is used, the curative effect is obvious. The intestinal mucosa tight junction injury caused by chemotherapy is protected, and the synergistic effect is achieved. The composition disclosed by the invention has the effects of protecting intestinal injury caused by pet chemotherapy or diarrhea of young animals, maintaining the integrity of the form and the structure of intestinal tissues, enhancing the immunity of the young animals, reducing the economic loss and reducing the use of antibiotics.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine intestinal administration preparation for treating UC and a preparation method. The traditional Chinese medicine intestinal administration preparation for treating UC comprises the following raw material medicines in parts by weight: 20-50 parts of rhizoma coptidis, 20-50 parts of cortex phellodendri, 20-50 parts of radix sanguisorbae, 20-50 parts of radix paeoniae alba, 20-50 parts of rhizoma bletillae, 10-40 parts of radix sophorae flavescentis and 10-40 parts of liquorice root. The composition is prepared by combining various medicines, has the effects of eliminating dampness and heat, cooling blood, stopping bleeding, astringing sores and promoting tissue regeneration, and the seven medicines are used together, so that the treatment effect is improved, a synergistic effect is achieved, and the composition is good in effect and free of toxic and side effects when being used for clinical treatment of UC for a long time; the preparation has strong heat-clearing and bleeding-stopping effects, can quickly relieve symptoms such as stomachache, tenesmus and hematochezia caused by UC, and effectively promotes intestinal mucosa healing.