91 results about "Intestinal mucosa" patented technology

The invention relates to the technical field of functional food, in particular to immune regulation type prebiotic syrup with synergy of galactomannan. The active components of the composite solid beverage are prepared from the following raw materials in percentage by weight: 20%-35% of fructo-oligosaccharide, 10%-18% of galactooligosaccharide, 8%-15% of stachyose, 3%-7% of xylooligosaccharide, 5%-12% of lactitol, 5%-10% of galactomannan, 2%-5% of yeast beta-glucan and 1%-3% of N-acetylglucosamine. The composition further comprises 4-8% of inulin and 3-6% of resistant dextrin as a matrix filling and slow-release carrier, and the sum of the weight percentages of all the active ingredients and the carrier is 100%. By remodeling intestinal microecology and inhibiting inflammation pathways, the intestinal inflammation state can be remarkably improved, expression of intestinal mucosa tight junction protein is promoted, and an innovative solution is provided for people suffering from chronic bowel diseases and immune imbalance.

The invention discloses a traditional Chinese medicine navel pill for treating constipation, diarrhea and chronic enteritis and a preparation method of the traditional Chinese medicine navel pill, and belongs to the technical field of traditional Chinese medicine. The preparation method comprises the following steps: weighing the raw materials, mixing, crushing and sieving to obtain mixed medicine powder, adding honey into the mixed medicine powder, stirring and kneading until the mixture is sticky, and preparing pills. The navel pill is applied to the navel, two-way conditioning of constipation and diarrhea is achieved through the synergistic effect of traditional Chinese medicine, chronic enteritis can be treated in a targeted mode, intestinal mucosa is effectively repaired, the intestinal inflammation state is improved, the navel pill has the advantages of being safe and convenient to apply, high in bioavailability, mild and free of side effects, stimulation of oral medicine to gastrointestinal tracts is avoided, and the curative effect is good. The food is suitable for digestion function conditioning of different people.

The present invention addresses the problem of: developing a method capable of noninvasively sampling and analyzing intestinal mucosa bacteria; analyzing the intestinal bacteria, especially intestinal mucosa bacteria on the basis of the method; and developing a therapeutic method for diseases occurring in the intestinal tract for which therapeutic methods have not been established.　The inventors of the present invention have found that bacteria contained in a cotton swab (swab) sample on the feces surface exhibit a bacterial flora composition similar to that of bacteria existing in the intestinal mucosa; and, as a result of analysis based on the finding, have clarified that Adlercreutzia, which has not been reported until now as a mucosa-related bacterium, lives in the large intestinal mucosa layer, produces taurine, which is a strong anti-inflammatory compound, by the action of the bile acid-deconjugating enzyme, and alleviates enteritis, thereby completing the present invention. In other words, the present invention can provide a composition having an anti-inflammatory effect, which includes a bacterium of the genus Adlercreutzia, or a bile acid-deconjugating enzyme that is derived from a bacterium of the genus Adlercreutzia.

The utility model provides a metal support for intestinal canal anastomosis and anastomotic leakage, which relates to the technical field of medical instruments and comprises a metal support, a drainage tube and a support release device, the metal support is arranged in the support release device before being released, and the metal support is dumbbell-shaped after being released and comprises a first raised section, a second raised section and a groove section, the groove section is a double-layer metal net and comprises an inner-layer metal net and an outer-layer metal net, a space is formed between the inner-layer metal net and the outer-layer metal net, the inner face and the outer face of the metal support are both wrapped with silica gel coatings, a plurality of round holes communicated with the space are formed in the silica gel coating of the outer-layer metal net, the drainage tube is connected with the groove section, and the interior of the drainage tube is communicated with the space. After being released, the metal stent can block a digestive tract ventage or support liquid secreted by an anastomotic stoma, intestinal mucosa, blood vessels and ventage tissue, the liquid can enter the space between the two layers of metal stent nets through the round holes in the silica gel coating of the outer-layer metal net and is sucked out by negative pressure, cleanliness of the anastomotic stoma and the ventage can be kept, and healing of the anastomotic stoma and the ventage is promoted.

The invention discloses burdock tea containing low-molecular hyaluronic acid fragments and a preparation method of the burdock tea, and belongs to the technical field of functional tea drinks. The burdock tea comprises the following raw materials in parts by weight: 1 part of a low-molecular hyaluronic acid fragment and 100 parts of burdock, the preparation method comprises the following steps: (1) selecting low-molecular hyaluronic acid fragment dry powder and fresh burdock slices; (2) dissolving the low-molecular hyaluronic acid fragment dry powder in purified water to obtain a hyaluronic acid solution; and (3) uniformly spraying the hyaluronic acid solution on the fresh burdock slices, and baking to obtain the burdock slices. According to the invention, low-molecular hyaluronic acid fragments with specific molecular weight and distribution are organically combined with burdock, and a unique preparation process is adopted, so that a tea beverage with multiple health-care effects is prepared. The burdock tea not only can repair intestinal mucosa and improve gastrointestinal tract discomfort, but also has various effects of moisturizing skin, beautifying, resisting aging, assisting in treating metabolic diseases, relaxing bowel, removing free radicals in the body, enhancing the immunity of the human body and the like.

The invention discloses sea-buckthorn, radix astragali and yeast beta-glucan granules and application thereof, and relates to the technical field of food health care, and the sea-buckthorn, radix astragali and yeast beta-glucan granules are prepared from the following raw materials: sea-buckthorn, radix astragali, yeast beta-glucan, American ginseng, radix salviae miltiorrhizae, fructus lycii, flos sophorae, fructus crataegi, xylitol, erythritol, cordyceps militaris, inonotus obliquus, radix polygonati officinalis, rhizoma dioscoreae, radix ophiopogonis and fructo-oligosaccharide. According to the invention, a three-dimensional efficacy system of immune activation, inflammation inhibition and intestinal repair is constructed through scientific proportioning of raw materials such as sea-buckthorn, astragalus membranaceus, yeast beta-glucan, cordyceps militaris and inonotus obliquus. The core components have a synergistic effect, so that not only can the activity of immune cells be activated and the immunity of the organism be improved, but also the release of inflammatory factors can be inhibited, the inflammatory response can be relieved, and meanwhile, the intestinal beneficial bacteria can be proliferated, the intestinal mucosa can be repaired and the intestinal micro-ecology can be improved. Compared with traditional medicinal and edible granules with a single effect, the product can meet the health requirements of people with different constitutions and is richer in adaptive scene.

The application relates to the technical field of traditional Chinese medicine preparation, and particularly discloses a compound traditional Chinese medicine preparation for targeting egg duck and goose egg cytoplasmic disease, which comprises the following components: white head, Coptis chinensis, Huangqi, Phellodendron amurense, wine Danpi, bran-fried peach kernel, Chinese perilla, pomegranate peel, liquorice, honeysuckle, Andrographis, figwort, emblic, ginger, fried atractylodes, fried safflower, Xianhecao, spiny amaranth, and Poria cocos. Through the combination of monarch, minister, assistant and messenger, the core effects of heat-clearing and detoxifying, blood-cooling and dysentery-stopping, and dampness-drying and insect-killing of the medicines are synergistically exerted, the pathogenesis characteristics of the egg cytoplasmic disease are accurately targeted, blood stasis and blood circulation are promoted to eliminate the swelling of the lesion, and the intestinal mucosa damage is repaired to stop bleeding, the symptoms of hematochezia, diarrhea and oviduct inflammation of the egg duck and goose caused by the egg cytoplasmic disease are effectively relieved, the problems of the decreased antibiotic effect, drug residue, bacterial flora disorder and food safety risk are effectively solved, and the compound traditional Chinese medicine preparation has the remarkable progress of drug resistance, safety, no residue, intestinal protection and green environmental protection.

The invention belongs to the technical field of medical nutritional food, and particularly relates to an enteral nutritional composition for improving intestinal intolerance of postoperative patients and application of the enteral nutritional composition. The invention provides an enteral nutrition composition for improving intestinal intolerance of postoperative patients, the enteral nutrition composition is composed of carbohydrates, proteins and composite minerals, the carbohydrates and the proteins are taken as the basis, the composite minerals are strengthened, the requirement of enteral nutrition support is met, the normal secretion function of intestinal mucosa is ensured, and the intestinal intolerance of the postoperative patients is improved. According to the present invention, the intestinal tract barrier function can be maintained, the nutrition state can be improved, the nitrogen balance of the body can be promoted, the immune regulation can be maintained, the polysaccharide-protein composite gel system can be formed in vivo, the free water of the intestinal tract can be cured, the postoperative enteric cavity water sample diarrhea can be significantly reduced, and the dehydration and electrolyte disorder caused by diarrhea can be rapidly corrected;

The invention relates to a composition for promoting pet hair discharge as well as a preparation method and application thereof. The composition comprises chicken, compound cellulose DR04, probiotics and digestion coenzyme, the composite cellulose DR04 comprises a Cunninghamia lanceolata extract, apple fiber powder, a beet extract and psyllium husk powder. According to the composition for promoting hair removal of pets, the cedarwood extract in the composite cellulose DR04 is insoluble fiber, forms a loose net-shaped structure to disperse hair after entering the intestinal tract, can promote intestinal tract movement, and helps cats to remove hair balls in the belly in a defecation mode. The Cunninghamia lanceolata extract is compounded with the apple fiber powder, the beet extract and the psyllium husk powder, so that wrapping and pushing dual promotion of hair removal is realized, and the hair removal efficiency is improved. The chicken, the probiotics and the digestion coenzyme are also added, so that the pet hair removal is further promoted, the palatability of the composition is also improved while the intestinal mucosal barrier is improved, and the composition is more suitable for being eaten by pets.

This invention relates to the field of feed additive technology, specifically to a feed additive that promotes digestion and absorption and its preparation process. The preparation process of a feed additive that promotes digestion and absorption includes: preparing antioxidant-modified chicken fat; preparing an extract; preparing a composite oil phase; and preparing the feed additive. In this invention, the extract of Shenqu (a type of fermented wheat) can directly compensate for insufficient endogenous enzyme secretion in laying hens, rapidly decomposing starch in feed and chicken fat in plant proteins, laying the foundation for subsequent absorption. The extract of Zhishi (a type of immature bitter orange) accelerates gastrointestinal motility and digesta emptying, while also promoting bile and pancreatic juice secretion, further improving the digestibility and utilization rate of fat-soluble components in laying hens. The extract of pine pollen can repair the intestinal mucosa, increase intestinal villus height, increase the nutrient absorption area, and regulate the intestinal microecology, reducing nutrient loss and intestinal stress. The combined use of these three ingredients synergistically promotes the digestive and absorptive capacity of laying hens.

The invention relates to a traditional Chinese medicine composition for treating ulcerative colitis in a remission stage as well as a preparation method and application of the traditional Chinese medicine composition. The traditional Chinese medicine composition comprises the following traditional Chinese medicine raw materials in parts by weight: 5-35 parts of humifuse euphorbia herb, 3-12 parts of carbonized sanguisorba root, 3-12 parts of gordon euryale seed, 1-6 parts of rhizoma bletillae, 0.5-5 parts of gallnut, 0.06-0.3 part of catechu and 0.02-0.12 part of pearl powder. According to the traditional Chinese medicine, the effects of all the medicines are synergistic, and all the medicines are combined to achieve the effects of attacking evil, tonifying deficiency, clearing waste heat, dispersing blood stasis, stopping bleeding, tonifying spleen and consolidating root; dynamic and static are combined, blood circulation is promoted, stasis is prevented, astringency is induced, and positive consumption is prevented. The multiple medicines synergistically play roles in healing sore, promoting tissue regeneration and repairing intestinal mucosa, directly refer to the core goal of healing ulcerative colitis, and are suitable for the pathogenesis characteristics of gradual decline of damp-heat and spleen deficiency reveal in the remission period of ulcerative colitis.

[PROBLEM] To provide a formulation that is safe for ingestion over a long period of time and can improve the enterobacterial flora or can enhance the barrier function of the intestinal mucosa.[SOLUTION] The present invention is an enteric capsule formulation for improving enterobacterial flora containing nicotinamide mononucleotide as an active ingredient.

The invention provides a pharmaceutical composition for protecting intestinal injury caused by chemotherapy and application, and belongs to the field of medicines. The invention also provides a pharmaceutical composition for protecting intestinal mucosa tight junction injury caused by chemotherapy. The pharmaceutical composition is prepared from the following raw material medicines in parts by weight: 1-3 parts of astragalus polysaccharide and 1-3 parts of ziyuglycoside I. According to the invention, the compatibility of astragalus polysaccharide and ziyuglycoside I not only can improve the immunity of the organism after chemotherapy, but also can protect intestinal mucosal injury caused by intestinal chemotherapy drugs, and solves the problem that no special-effect drug for intestinal injury after chemotherapy exists in the current market, and pharmacodynamic tests prove that when the compatibility of astragalus polysaccharide and ziyuglycoside I is used, the curative effect is obvious. The intestinal mucosa tight junction injury caused by chemotherapy is protected, and the synergistic effect is achieved. The composition disclosed by the invention has the effects of protecting intestinal injury caused by pet chemotherapy or diarrhea of young animals, maintaining the integrity of the form and the structure of intestinal tissues, enhancing the immunity of the young animals, reducing the economic loss and reducing the use of antibiotics.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine intestinal administration preparation for treating UC and a preparation method. The traditional Chinese medicine intestinal administration preparation for treating UC comprises the following raw material medicines in parts by weight: 20-50 parts of rhizoma coptidis, 20-50 parts of cortex phellodendri, 20-50 parts of radix sanguisorbae, 20-50 parts of radix paeoniae alba, 20-50 parts of rhizoma bletillae, 10-40 parts of radix sophorae flavescentis and 10-40 parts of liquorice root. The composition is prepared by combining various medicines, has the effects of eliminating dampness and heat, cooling blood, stopping bleeding, astringing sores and promoting tissue regeneration, and the seven medicines are used together, so that the treatment effect is improved, a synergistic effect is achieved, and the composition is good in effect and free of toxic and side effects when being used for clinical treatment of UC for a long time; the preparation has strong heat-clearing and bleeding-stopping effects, can quickly relieve symptoms such as stomachache, tenesmus and hematochezia caused by UC, and effectively promotes intestinal mucosa healing.

The application provides a pharmaceutical composition for protecting intestinal injury caused by chemotherapy and use, and belongs to the field of medicines. The application also provides a pharmaceutical composition for protecting tight junction injury of intestinal mucosa caused by chemotherapy, which is prepared from raw medicinal materials in the following proportions by weight: 1-3 parts of astragalus polysaccharide and 1-3 parts of sanguisorba officinalis saponin I. The astragalus polysaccharide combined with the sanguisorba officinalis saponin I can not only improve the immunity of the body after chemotherapy, but also protect the intestinal mucosa injury caused by intestinal chemotherapy drugs, and solves the problem that there is no specific drug for intestinal injury after chemotherapy on the market. The drug efficacy test proves that the astragalus polysaccharide combined with the sanguisorba officinalis saponin I has a synergistic effect on protecting the tight junction injury of intestinal mucosa caused by chemotherapy. The composition of the application can protect the intestinal injury of pets caused by chemotherapy or diarrhea of young animals, maintain the integrity of the intestinal tissue morphology and structure, enhance the immunity of young animals, reduce economic losses, and reduce the use of antibiotics.

The application provides a stoma irrigation device, belonging to the field of stoma irrigation, and used for solving the problem of limited physical stimulation to the intestinal tract during stoma irrigation operation; the device comprises an insertion unit, a first liquid injection unit and a second liquid injection unit; the insertion unit comprises a first expansion piece, a second expansion piece and a flow rate adjusting piece arranged in sequence along an insertion direction; the first expansion piece is arranged, and the first liquid injection unit is used to inject gas or liquid into the first expansion piece, so that the first expansion piece is expanded, thereby fixing the insertion unit in the intestinal tract and avoiding leakage of the irrigation liquid; the second liquid injection unit is used to inject the irrigation liquid into the second expansion piece, so that the second expansion piece is expanded to actively induce intestinal peristalsis, change the traditional passive flushing mode, make the intestinal contents more easily softened and removed by peristalsis, shorten the cleaning time and improve the cleanliness; and the irrigation liquid enters the intestinal tract at a slow speed after being adjusted by the flow rate adjusting piece, so that the intestinal mucosa is protected and the discomfort of the patient is reduced.

This invention belongs to the field of intestinal microbiome technology, and particularly relates to the application of a capsular polysaccharide derived from Bacteroides Salilsii CSP6 in the treatment and / or prevention of inflammatory bowel disease. The Bacteroides Salilsii strain is... Bacteroides salyersiae CSP6. This strain was isolated from the intestine of healthy humans and deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20221993. In vivo experiments showed that the capsular polysaccharide derived from Bacteroides Salieris CSP6 can protect the colorectal mucosa from damage and promote the repair of damaged intestinal mucosa, thereby improving symptoms such as loose stools, rectal bleeding, and shortened colon and rectum, reducing weight loss caused by intestinal damage and inflammation, and ultimately exerting a therapeutic effect on inflammatory bowel disease.

The invention belongs to the technical field of livestock and poultry feed additives, and particularly relates to application of a dogwood extract in preparation of a compound feed for relieving diarrhea and enteritis, and the dogwood extract is an aqueous extract of a dogwood medicinal material. 500mg-2000mg of the dogwood extract is added into each kilogram of the basal feed, so that the compound feed is obtained. The compound feed can relieve diarrhea and intestinal inflammation of weaned piglets, especially at the 21-35-day-old stage, the diarrhea occurrence rate of the weaned piglets can be remarkably reduced by 15% or above, meanwhile, the average daily gain is increased, the feed-gain ratio is reduced, the comprehensive growth performance is better than that of a control group, the level of pro-inflammatory cytokines in IPEC-J2 cells or intestinal mucosa tissues is remarkably reduced, and the weaned piglets are prevented from suffering from diarrhea and intestinal inflammation. Meanwhile, the level of anti-inflammatory cytokines is up-regulated, and excessive activation of an NF-kB key inflammatory signal channel can be inhibited.

The invention discloses a pet feed additive for enhancing gastrointestinal peristalsis. A double-layer embedding structure is adopted, wherein the outer layer is a pH response type compound formed by chitosan and sodium alginate, and the effects of stomach protection and intestinal tract targeted slow release are achieved; the core of the inner layer is a compound of resveratrol and inulin and selenium-enriched yeast prepared through biotransformation. The composition has the synergistic effect through multiple target points: the resveratrol is used for regulating intestinal nerves and resisting inflammation, the inulin is used as prebiotics for promoting proliferation of beneficial bacteria, and the organic selenium is used for enhancing the oxidation resistance of intestinal mucosa, so that the gastrointestinal tract peristalsis is comprehensively and safely promoted. Experiments show that the additive can significantly improve the defecation condition, shorten the gastrointestinal transmission time, optimize the intestinal flora and reduce inflammation, and is suitable for being added to pet food needing to improve gastrointestinal motility.

The invention discloses a child colon lavage device and relates to the technical field of clinical nursing. The device comprises a liquid storage tank, a liquid inlet transmission box, a fluid driving part, a liquid outlet transmission box and a negative pressure generating part, the liquid inlet transmission box is provided with a liquid inlet cavity, the liquid inlet cavity is provided with a first liquid inlet and a first liquid outlet, the first liquid inlet is communicated with the liquid storage tank through a first pressure difference one-way valve, and the first liquid outlet is communicated with a liquid inlet pipe through a second pressure difference one-way valve; the fluid driving part and the negative pressure generating part are in transmission connection, when the fluid driving part generates extrusion force, the negative pressure generating part synchronously moves to generate adsorption force, the liquid inlet process of lavage liquid and the liquid discharging process of lavage backflow liquid form mechanical linkage, the extrusion force and the flow speed of the inlet liquid are matched with the negative pressure adsorption force and the suction rate of the discharged liquid, and therefore the suction efficiency of the lavage liquid is improved. The amount of lavage fluid injected into the intestinal tract can be matched with the amount of sucked backflow fluid in real time, and the risks of abdominal distension, abdominal pain, intestinal mucosa injury and perforation caused by deposition of a large amount of lavage fluid are avoided.

The invention belongs to the technical field of probiotic transformation application, and discloses extracellular membrane vesicles (BEVs) derived from Lactococcus sp. As well as a preparation method and application of the BEVs. The invention further discloses a preparation method of the BEVs. The BEVs are obtained by carrying out filtration, concentration and over-speed and over-speed centrifugal separation on a culture supernatant of the Lactococcus sp., and the BEVs are obtained by carrying out filtration, concentration and over-speed and over-speed centrifugal separation on the culture supernatant of the Lactococcus sp. According to the invention, an ulcerative colitis mouse model is established, and the prepared BEVs are adopted for intervention treatment; experimental results show that BEVs can significantly improve weight loss, colon shortening and histological injury of mice, reduce the expression level of proinflammatory factors, enhance expression of tight junction proteins and restore functional integrity of intestinal barriers, so that the reaction of colitis is effectively inhibited, and intestinal mucosa repair is promoted.

The invention belongs to the technical field of pharmacy, and particularly relates to a rhizoma phragmitis sustained release preparation for hyperuricemia and a preparation method of the rhizoma phragmitis sustained release preparation. The reed rhizome sustained release preparation for hyperuricemia is prepared from the following raw materials in parts by weight: 80 to 100 parts of reed rhizome extract, 160 to 200 parts of functionalized reed rhizome powder, 0.01 to 0.1 part of freeze-dried powder, 40 to 65 parts of quercetin and 30 to 50 parts of acrylic resin, the rhizoma phragmitis extract and quercetin cooperate to comprehensively regulate uric acid metabolism; due to the introduction of the freeze-dried powder, real-time visual monitoring of in-vivo drug distribution and drug release progress is realized, and the targeting affinity of the preparation with intestinal mucosa and joint parts can be improved, so that the blood uric acid level quickly tends to be stable and is maintained for a long time; after the colon target positioning sustained-release pellet and the quercetin quick-release pellet are mixed, the quick-release pellet can be quickly disintegrated and release quercetin to realize quick acid control, and the sustained-release pellet can accurately deliver drugs in the colon and continuously release active ingredients to realize long-acting acid stabilization.

This utility model discloses an ultra-thin, expandable anorectal drug delivery device, comprising: a catheter for inserting into the anus and rectum, with a drug injection port at the front end of the catheter and a Luer lock connector fixedly connected to the rear end of the catheter; wherein, the catheter includes an inner tube layer, a middle tube layer, and an outer tube layer, the inner tube layer being connected to the drug injection port, the middle tube layer being wrapped around the outer side of the inner tube layer, an expansion member for increasing the tube diameter being provided between the inner wall of the middle tube layer and the outer wall of the inner tube layer, and a driving member being installed at the rear end of the catheter, the expansion member being controlled by the driving member, thereby changing the tube diameter through the use of the expansion member to achieve a better drug delivery effect, reduce secondary damage to the intestinal mucosa, improve patient treatment comfort, and ensure the safety of the entire drug delivery process.

The application discloses a kind of heparin sodium extraction device in the technical field of heparin sodium extraction, including base, the base upper end is fixedly connected with support plate, the support plate one side is fixedly connected with mounting column, the mounting column upper and lower sides are equipped with connecting plate, the connecting plate one end is fixedly connected with support plate, the connecting plate is equipped with the mechanism of pulling, by mechanism of pulling to small intestine, so that small intestine is sleeved in the outside of mounting column;By gas supply mechanism, gas is made into pig small intestine by gas guide chamber, so that pig small intestine is inflated, after pig small intestine is fully inflated, gas will push the movement of pressing plate, and then make the second pressing switch be pressed, at this time, it can be determined that pig small intestine is not damaged, when damage and air leakage occur, the second pressing switch is not pressed within the set time, and the speaker will occur prompt sound, at this time, it can be judged that pig small intestine is damaged, realize the detection of pig small intestine damage state before scraping intestinal mucosa.

The invention relates to an engineering probiotic oral nano capsule modified by a nano material as well as a preparation method and application of the engineering probiotic oral nano capsule. The engineering modification of probiotics comprises the steps of knocking out a clbA gene and overexpressing an Sj16 protein and a GbpA protein. The intestinal adhesion protein GbpA is expressed on the surface of the engineered escherichia coli, an ultrasonic response element is integrated, the immunomodulatory protein Sj16 can be controllably expressed under ultrasonic stimulation, the adhesion and colonization capacity of the engineered escherichia coli in the intestinal tract is enhanced through engineered modification, the immune balance of the intestinal mucosa is cooperatively regulated, and the immunomodulatory effect of the engineered escherichia coli is improved. The generation and secretion of pathogenic autoantibodies from intestinal tracts are obviously reduced. On the basis, the molybdenum-based monatomic nano-material is functionally modified by using an enteric polymer, and a uniform nano-material-polymer composite coating is formed on the modified probiotics by adopting an in-situ wrapping technology, so that the nano-material-polymer composite coating shows a remarkable effect in the aspect of treating the autoimmune nephritis and has an important clinical application value.

The application discloses application of N-acetyl-L-phenylalanine in preparation of an intestinal inflammation treatment product. The N-acetyl-L-phenylalanine has a molecular formula of C11H13NO3, belongs to a natural amino acid derivative, and has high safety. The product is a drug, a food or a feed additive, is used for treating inflammatory diseases, reducing intestinal inflammation, and promoting intestinal mucosa repair and maintaining intestinal barrier function, so that intestinal inflammation related clinical symptoms are improved. By using NAPhe for preparation of the product, a clear active ingredient application path is provided for treatment of intestinal inflammatory diseases of mammals, especially humans.

The utility model provides an intestinal canal anastomosis and anastomotic leakage stent system, which comprises a metal stent, a drainage device and a stent release device, the metal stent is arranged in the stent release device before being released, the stent release device is used for releasing the metal stent, the metal stent is dumbbell-shaped, two ends of the metal stent are raised, and the middle of the metal stent is a groove section; the drainage device comprises an air cushion and a drainage tube, the air cushion wraps the groove section, the whole air cushion is columnar, and air columns are woven into a net shape; a space is formed between the air cushion and the groove section, and the drainage tube is connected to the metal support and communicated with the space. According to the utility model, the air cushion can be filled by injecting gas or water, so that a communicated closed space is formed between the intestinal mucosa and the surface of the metal stent, secretions or blood of the intestinal mucosa, blood vessels and ventage tissues are continuously sucked out through negative pressure, the cleanness of an anastomotic stoma and a ventage is kept, and the healing of the anastomotic stoma and the ventage is promoted.

The invention belongs to the technical field of biological medicine, and particularly discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue to preparation of a Crohn disease diagnostic kit, the reagent is characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, the sequence of the tsRNA molecular marker is GCCGTGATAGTGGTTAGTACTCT, the reagent for detecting the tsRNA molecular marker in the intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upstream and downstream primers, and the primer sequence of the tsRNA molecular marker in the intestinal mucosa tissue is shown in the description. The upstream primer is AATG CCGTGATCGTATAGTGGTT, and the downstream primer is TATCCTTGTTGACGACTGGTTGAC, and the downstream primer is The method has the advantages that absolute quantitative detection of target molecules can be rapidly and accurately completed only with a small amount of samples, and the method is used for early screening and identification of Crohn's disease and is high in sensitivity and specificity.

This invention discloses an intelligent constant-temperature pressure-controlled anti-reflux intestinal flushing device, belonging to the field of medical device technology. It includes a liquid storage and heating unit, a delivery and pressure control unit, a flushing and drainage unit, and a control unit. The liquid storage and heating unit is connected to the delivery and pressure control unit via a pipeline, and the other end of the delivery and pressure control unit is connected to the flushing and drainage unit via a pipeline. The control unit is electrically connected to the liquid storage and heating unit and the delivery and pressure control unit. This invention can prevent sudden pressure increases that could damage the intestinal mucosa through closed-loop pressure control, maintaining stable pressure within a safe range to avoid intestinal injury. It offers enhanced comfort due to constant temperature control, significantly reducing the incidence of abdominal pain and spasms. It is effective, achieving a high rate of intestinal cleansing while shortening operation time. It is convenient with one-button start and preset pressure levels; it is quick to assemble and disassemble, easy to clean, and can be operated by a single person. It is reliable, providing stable continuous operation and timely alarm response, meeting the requirements for high-frequency clinical use.