Highly active conjugated bile acid-deconjugating enzyme and use thereof

A non-invasive fecal swab method identifies Adlercreutzia bacteria producing a highly active bile acid deconjugation enzyme that alleviates colitis and suppresses inflammation, addressing the limitations of invasive sampling and providing a treatment for IBD.

WO2026088913A1PCT designated stage Publication Date: 2026-04-30KEIO UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/036870
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-21
Filing Date
2025-10-20
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Conventional methods for sampling intestinal mucosal bacteria are invasive, limiting knowledge about mucosa-associated bacteria and their interaction with the host immune system, and there is no established treatment for inflammatory bowel disease (IBD) despite the presumed involvement of intestinal bacteria.

Method used

A non-invasive method using cotton swab samples of fecal surfaces to analyze intestinal mucosal bacteria, revealing Adlercreutzia bacteria, which produce a bile acid deconjugation enzyme that generates taurine, an anti-inflammatory compound alleviating colitis.

Benefits of technology

The method allows for the analysis of mucosal-related bacteria without invasion, identifying Adlercreutzia's bile acid deconjugation enzyme with high taurine production activity, providing a 40 times greater anti-inflammatory effect than B. longum, and effectively suppressing colitis and lowering serum cholesterol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000026_0000
    Figure 00000026_0000
  • Figure 00000027_0000
    Figure 00000027_0000
  • Figure 00000027_0001
    Figure 00000027_0001
Patent Text Reader

Abstract

The present invention addresses the problem of: developing a method capable of noninvasively sampling and analyzing intestinal mucosa bacteria; analyzing the intestinal bacteria, especially intestinal mucosa bacteria on the basis of the method; and developing a therapeutic method for diseases occurring in the intestinal tract for which therapeutic methods have not been established. The inventors of the present invention have found that bacteria contained in a cotton swab (swab) sample on the feces surface exhibit a bacterial flora composition similar to that of bacteria existing in the intestinal mucosa; and, as a result of analysis based on the finding, have clarified that Adlercreutzia, which has not been reported until now as a mucosa-related bacterium, lives in the large intestinal mucosa layer, produces taurine, which is a strong anti-inflammatory compound, by the action of the bile acid-deconjugating enzyme, and alleviates enteritis, thereby completing the present invention. In other words, the present invention can provide a composition having an anti-inflammatory effect, which includes a bacterium of the genus Adlercreutzia, or a bile acid-deconjugating enzyme that is derived from a bacterium of the genus Adlercreutzia.
Need to check novelty before this filing date? Find Prior Art

Description

Highly active conjugated bile acid deconjugase and its uses

[0001] The present invention relates to providing a highly active conjugated bile acid deconjugase and its uses.

[0002] It has been suggested that intestinal mucosal bacteria affect the health of the host through regulation of the host immune system (Non-Patent Document 1, Non-Patent Document 2). However, since the conventional sampling method for intestinal mucosal bacteria has been invasive, knowledge about mucosa-associated bacteria has been limited, and the relationship between mucosa-associated bacteria and the host immune system has also remained speculative.

[0003] Inflammatory bowel disease (IBD), a disease known as an intestinal disease, is a disease for which a treatment method has not been fully established at present. Although it is presumed that intestinal bacteria are involved in this disease, the interaction between intestinal bacteria including mucosa-associated bacteria and their host has not been fully understood, and elucidating such an interaction has become an important issue for establishing a treatment method for inflammatory bowel disease.

[0004] It is known that the deconjugation of bile acids by bile acid deconjugase (or bile salt hydrolase enzyme, hereinafter abbreviated as BSH) is an important enzymatic reaction for bile acid circulation and secondary bile acid production in the host intestine including humans (Non-Patent Document 3), and it is suggested that bile acid metabolism is important for host health.

[0005] A function of regulating human serum cholesterol concentration has also been reported for BSH. In the prior art (Non-Patent Document 4), the BSH of Bifidobacterium longum SBT2928 strain, which is a Bifidobacterium, was evaluated and reported to have high deconjugation activity.

[0006] Patent No. 4429422

[0007] Atarashi et al., 2015, Cell 163, 367-380Furusawa et al., Nature volume 504, 446-450 (2013)Guzior and Quinn Microbiome (2021) 9:140Tanaka, et al., Appl. Environ. Microbiol., (2000) 66 (6): 2502-2512

[0008] The present invention aims to develop a non-invasive method for sampling and analyzing intestinal mucosal bacteria, and based on this method, to analyze intestinal bacteria, particularly intestinal mucosal bacteria, and to develop treatment methods for diseases occurring in the intestinal tract for which no treatment methods have yet been established.

[0009] The inventors of the present invention discovered that bacteria contained in cotton swab samples from the surface of feces exhibit a bacterial flora composition similar to that of bacteria present in the intestinal mucosa. Based on this, they conducted an analysis and revealed that Adlercreutzia, a bacterium never before reported as a mucosal-related bacterium, inhabits the colonic mucosa. They also discovered that its bile acid deconjugation enzyme produces taurine, an anti-inflammatory compound, which alleviates colitis, thus completing the present invention. In other words, the present invention can provide a composition having anti-inflammatory activity that contains bacteria of the genus Adlercreutzia, or a bile acid deconjugation enzyme derived from bacteria of the genus Adlercreutzia.

[0010] More specifically, the present application provides the following embodiments to solve the aforementioned problems: [1]: an anti-inflammatory composition comprising a bile acid deconjugation enzyme activity protein derived from bacteria of the genus Adlercreutzia; [2]: a bile acid deconjugation enzyme activity protein derived from bacteria of the genus Adlercreutzia comprising the amino acid sequence of SEQ ID NO.: 2, the amino acid sequence of SEQ ID NO.: 4, or the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: A composition having anti-inflammatory activity according to [1], having an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence of 4; [3]: A composition having anti-inflammatory activity according to [1] or [2], wherein the inflammation is selected from the group consisting of colitis and non-alcoholic steatohepatitis (NASH); [4]: ​​A composition having anti-inflammatory activity according to [1] or [2], wherein a protein having bile acid deconjugation activity derived from Adlercreutzia bacteria enhances the production of taurine from taurocholic acid; [5]: A composition having anti-inflammatory activity according to [1] or [2], wherein the Adlercreutzia bacteria is Adlercreutzia equolifaciens; [6]: A composition having anti-inflammatory activity according to [1] or [2], wherein the Adlercreutzia bacteria is Adlercreutzia equolifaciens JCM 14811T strain, Adlercreutzia equolifaciens JY1 strain, or Adlercreutzia equolifaciens [5]: A composition having anti-inflammatory activity, wherein the bacterium is strain JY2; [7]: A composition having anti-inflammatory activity, comprising a bacterium of the genus Adlercreutzia; [8]: A composition having anti-inflammatory activity, wherein the inflammation is selected from the group consisting of colitis and non-alcoholic steatohepatitis (NASH); [9]: A composition having anti-inflammatory activity, wherein the bacterium of the genus Adlercreutzia enhances the production of taurine from taurocholic acid by the action of a bile acid deconjugating enzyme, as described in [7] or [8];

[10] : A composition having anti-inflammatory activity, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens;

[11] : A composition having anti-inflammatory activity, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens JCM 14811T;

[12] : SEQ ID NO.: Amino acid sequence of 2, SEQ ID NO.: 4 amino acid sequence, or SEQ ID NO.: 2 amino acid sequence, or SEQ ID NO.: A bile acid deconjugation enzyme activity protein having an amino acid sequence with one or more amino acid deletions, substitutions, or additions in the amino acid sequence of 4.

[13] : A bile acid deconjugation enzyme activity protein described in

[12] , derived from bacteria of the genus Adlercreutzia.

[14] : A bile acid deconjugation enzyme activity protein described in

[12] or

[13] that enhances the production of taurine from taurocholic acid in the intestinal tract.

[15] : A bile acid deconjugation enzyme activity protein described in

[12] or

[13] that exhibits anti-inflammatory effects by producing taurine in the intestinal tract.

[0011] This invention has found that bacteria contained in cotton swab samples of fecal surfaces exhibit a similar bacterial flora composition to bacteria present in the intestinal mucosa, and based on this, it provides a method for analyzing mucosal-related bacteria by analyzing cotton swab samples of fecal surfaces.

[0012] Furthermore, as a result of this analysis, it was identified that bacteria of the genus Adlercreutzia inhabit the mucosal layer of the large intestine, and that their bile acid deconjugating enzyme has a very high taurine-producing activity, thus enabling the provision of a highly active bile acid deconjugating enzyme.

[0013] Furthermore, since it has been demonstrated that taurine produced by the bile acid deconjugation enzyme of the present invention alleviates colitis, the present invention can provide a composition having anti-inflammatory activity that contains a bacterium of the genus Adlercreutzia or a bile acid deconjugation enzyme derived from a bacterium of the genus Adlercreutzia.

[0014] Figure 1 shows that Adlercreutzia bacteria are more abundant in fecal surface samples compared to whole fecal samples. Figure 2 shows an experimental scheme to investigate whether Adlercreutzia bacteria can suppress colitis by colonizing the intestinal tract. Figure 3 shows that colonizing the intestinal tract with Adlercreutzia bacteria can suppress colitis. Figure 4 shows that Adlercreutzia bacteria enhance the production of anti-inflammatory substances. Figure 5 shows an experimental scheme to investigate whether colitis can be suppressed by adding intestinal metabolites, which are products of Adlercreutzia bacteria, instead of Adlercreutzia bacteria themselves. Figure 6 shows that taurine, one of the intestinal metabolites produced by Adlercreutzia bacteria, can significantly suppress colitis. Figure 7 shows the cascade in which taurine is produced from taurocholic acid by bile acid deconjugating enzymes. Figure 8 shows the results of bile acid deconjugation by bacteria of the genus Adlercreutzia. Figure 9 shows that the bile acid deconjugating enzyme from bacteria of the genus Adlercreutzia has very high activity (taurine production activity) and stability compared to the known bile acid deconjugating enzyme from B. longum. Figure 10 shows that the bile acid deconjugating enzyme from bacteria of the genus Adlercreutzia has very high thermal stability compared to the bile acid deconjugating enzyme from B. longum. Figure 11 shows that the bile acid deconjugating enzyme from bacteria of the genus Adlercreutzia has very high long-term stability compared to the bile acid deconjugating enzyme from B. longum. Figure 12 shows the BSH activity of the newly isolated Adlercreutzia equolifaciens JY1 and JY2 strains in this invention compared to the BSH activity of Adlercreutzia equolifaciens JCM14811 strain. Figure 13 shows an overview of the vector structure used to produce the AeBSH gene-inserted E. coli strain. Figure 14 shows the experimental protocol for evaluating the activity of ulcerative colitis using the AeBSH gene-inserted E. coli strain.Figure 15 shows the results of evaluating the activity of ulcerative colitis using an AeBSH gene-inserted E. coli strain with the experimental protocol. Figure 16 shows the in vitro deconjugation activity of BSH produced from the AeBSH gene-inserted E. coli strain.

[0015] The inventors of this invention discovered that as feces move through the intestinal tract, bacteria present in the intestinal mucosa adhere to the surface of the feces before excretion. Therefore, a cotton swab sample of the fecal surface functions as a replica of the bacteria present in the intestinal mucosa. In other words, the bacteria contained in a cotton swab sample of the fecal surface exhibit a similar bacterial flora composition to those present in the intestinal mucosa. Based on this, they conducted an analysis and revealed that Adlercreutzia bacteria, which had never been reported as mucosal-related bacteria before, inhabit the colonic mucosal layer. They also revealed that these bacteria, through the action of their bile acid deconjugating enzyme, produce taurine, an anti-inflammatory compound, which alleviates colitis, thus completing the present invention.

[0016] <Method for analyzing intestinal mucosal bacteria> In other words, as one aspect of the present invention, we have found that bacteria contained in cotton swab samples of fecal surfaces exhibit a bacterial flora composition similar to that of bacteria present in the intestinal mucosa, and based on this, we have shown that it is possible to provide a method for analyzing mucosal-related bacteria by analyzing cotton swab samples of fecal surfaces.

[0017] Previously, sampling methods for intestinal mucosal bacteria were invasive, resulting in limited knowledge about mucosal-related bacteria. However, the method described above has shown that swab samples from the surface of feces function as replicas of bacteria present in the intestinal mucosa. This allows for non-invasive sampling of intestinal mucosal bacteria, enabling the analysis of even species present in very small numbers.

[0018] Fecal samples obtained using this method can be collected from any animal species, and from a pharmaceutical development perspective, they can be collected from humans.

[0019] This method allows you to obtain a bacterial sample present in the intestinal mucosa by collecting a fecal sample and wiping the surface of the feces with a sterilized or disinfected cotton swab. From the moment a fecal sample is removed from the intestinal tract, the environment in the intestines and the surrounding environment change significantly, and there is a high possibility that the biome profile will also change. Therefore, it is preferable to use a fresh fecal sample.

[0020] Cotton swabs used to wipe the surface of feces are stored in a preservation solution such as sterile saline or sterile RNA protective agent, based on the bacterial analysis results. Storage should be done by freezing or refrigeration. When refrigerating, it is preferable to use the samples for analysis without prolonged storage, as the bacterial condition deteriorates easily.

[0021] Bacterial samples collected from the surface of feces can be subjected to bacteriological analysis, protein analysis, nucleic acid analysis, and other analyses. For example, by comprehensively analyzing the 16S ribosomal RNA sequence of the obtained bacteria using a next-generation sequencer, it can be used as an analytical method to identify and compare bacteria present in the sample.

[0022] <Identification of bacteria present in the intestinal mucosa and identification of involved components based on analysis of their mechanism of action> Using bacterial samples collected from the surface of feces by this method, and with the bacterial community present in the entire feces as a control, bacterial flora composition analysis was performed based on 16S ribosomal RNA sequence analysis. By selecting bacteria with a high relative abundance on the fecal surface, it was revealed that Adlercreutzia bacteria, which had not been previously reported as mucosal-related bacteria, inhabit the colonic mucosa.

[0023] When this Adlercreutzia bacterium was implanted in the intestinal tract of gnotobiotic mice and its function was confirmed, it was found to suppress inflammatory symptoms in the large intestine. Furthermore, analysis of the mechanism by which Adlercreutzia bacteria suppress inflammatory symptoms in the large intestine revealed that the bile acid deconjugation enzyme derived from Adlercreutzia bacteria acts on taurocholic acid, a type of conjugated bile acid present in the intestinal tract, causing deconjugation. This leads to the production of deconjugated bile acid and taurine in the intestinal tract, thereby suppressing colitis. It was also found that the taurine production activity of this Adlercreutzia bile acid deconjugation enzyme is significantly higher than that of the known B. longum bile acid deconjugation enzyme.

[0024] Based on this finding, in one aspect, the present invention can provide an invention relating to a bile acid deconjugation enzyme activity protein derived from bacteria of the genus Adlercreutzia. This protein is derived from bacteria of the genus Adlercreutzia and includes not only the proteins that constitute the bile acid deconjugation enzyme of Adlercreutzia bacteria (identified by the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4), but also modified versions thereof that possess bile acid deconjugation enzyme activity.

[0025] In other words, the bile acid deconjugation enzyme activity protein derived from Adlercreutzia bacteria in the present invention can be identified as a bile acid deconjugation enzyme activity protein having an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4 (bile acid deconjugation enzyme of Adlercreutzia equolifaciens bacteria) or the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4.

[0026] The bile acid deconjugating enzyme activity protein identified by the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4 may be derived from bacteria of the genus Adlercreutzia, more specifically from Adlercreutzia equolifaciens, and even more specifically from Adlercreutzia equolifaciens strain JCM 14811T (GenBank: AP024470.1) or Adlercreutzia equolifaciens strains JY1 and JY2 (both isolated by the present inventors). The protein derived from the bacterium Adlercreutzia equolifaciens JCM 14811T (amino acid sequence of SEQ ID NO.: 2) is encoded by the nucleotide sequence of SEQ ID NO.: 1, and the proteins derived from Adlercreutzia equolifaciens strains JY1 and JY2 (both isolated by the inventors) (amino acid sequence of SEQ ID NO.: 4) are encoded by the nucleotide sequence of SEQ ID NO.: 3.

[0027] The bile acid deconjugating enzyme protein derived from Adlercreutzia bacteria in the present invention, whose structure was identified above, has the effect of enhancing the production of taurine from taurocholic acid in the intestinal tract. This effect has been shown to be 40 times more active (taurine production activity) than that of the known bile acid deconjugating enzyme of B. longum.

[0028] The bile acid deconjugation enzyme protein of the present invention exhibits anti-inflammatory effects by producing taurine in the intestinal tract. As described above, the bile acid deconjugation enzyme protein of the present invention has a remarkably high activity (taurine production activity) that is 40 times higher than that of the known bile acid deconjugation enzyme of B. longum. Therefore, it can significantly increase the concentration of taurine in the intestinal tract compared to the known bile acid deconjugation enzyme, and can provide a more effective anti-inflammatory effect with taurine.

[0029] The bile acid deconjugating enzyme activity protein of the present invention also increases bile acid secretion into the intestinal tract when applied to the intestinal tract, and as a result, exhibits the effect of lowering serum cholesterol levels.

[0030] <Development of Pharmaceutical Applications> As described above, when Adlercreutzia bacteria were implanted in the intestinal tract of gnotobiotic mice and their function was confirmed, it became clear that they suppressed inflammatory symptoms in the large intestine. Based on this, one aspect of the present invention provides a composition containing Adlercreutzia bacteria that has anti-inflammatory effects in the intestinal tract.

[0031] The inflammation in the intestinal tract that the composition of the present invention is intended to treat can be selected from colitis, non-alcoholic steatohepatitis (NASH), and more specifically from inflammatory bowel disease (IBD), Crohn's disease, drug-induced enteritis, ischemic colitis, and the like.

[0032] In this study, we investigated the mechanism of action of Adlercreutzia bacteria when they were implanted in the intestinal tract of gnotobiotic mice to suppress inflammatory symptoms in the large intestine. The results showed that this suppression of inflammatory symptoms was due to Adlercreutzia bacteria enhancing the production of taurine from taurocholic acid through the action of bile acid deconjugating enzymes.

[0033] The Adlercreutzia bacteria included as an active ingredient in this embodiment of the present invention may be Adlercreutzia equolifaciens bacteria, and more specifically, Adlercreutzia equolifaciens strain JCM 14811T or Adlercreutzia equolifaciens strain JY1 or JY2 (both isolated strains by the present inventors).

[0034] In yet another aspect of the present invention, the present invention can also provide an anti-inflammatory composition that does not contain Adlercreutzia bacteria themselves as a component, but rather contains a protein having bile acid deconjugation enzyme activity derived from Adlercreutzia bacteria.

[0035] The bile acid deconjugation enzyme-containing protein derived from Adlercreutzia bacteria included as an active ingredient in this embodiment of the present invention can be identified as a bile acid deconjugation enzyme-containing protein having an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4 (bile acid deconjugation enzyme of Adlercreutzia equolifaciens bacteria) or the amino acid sequence of SEQ ID NO.: 2 or SEQ ID NO.: 4. This protein may be obtained from the cells of Adlercreutzia bacteria, or it may be produced by a protein expression system (e.g., an E. coli expression system) incorporating the DNA encoding these proteins.

[0036] Since the anti-inflammatory effect when Adlercreutzia bacteria themselves are applied to the body is exerted by bile acid deconjugation enzymes derived from Adlercreutzia bacteria, it is reasonable to assume that applying a protein possessing bile acid deconjugation enzyme activity derived from Adlercreutzia bacteria to the body will also produce a similar anti-inflammatory effect based on a similar mechanism of action.

[0037] The present invention will be specifically illustrated below with reference to examples. The examples shown below do not limit the present invention in any way.

[0038] Example 1: Identification of Intestinal Mucosal-Related Bacteria In this example, intestinal mucosal-related bacteria were identified.

[0039] (1-1) Examination of sampling methods for intestinal mucosal-related bacteria First, we examined non-invasive sampling methods for intestinal mucosal microorganisms as an alternative to the conventional invasive sampling methods. Specifically, we hypothesized that when feces pass through the intestines, microorganisms present on the surface of the intestinal mucosa (especially mucus) adhere to the surface of the feces and are excreted. We then confirmed whether the microorganisms contained in cotton swab samples of the fecal surface exhibited a similar bacterial flora composition to those present in the intestinal mucosa.

[0040] For this purpose, first, microorganisms on the surface of mouse feces and the surface of colonic contents were collected by cotton swab (swab) sampling. Each sample was subjected to 16S rRNA gene amplicon sequence analysis by sequencing the product obtained by amplifying the V1-V2 region of 16S rRNA using a next-generation sequencer (MiSeq; Illumina). As a result, it was found that the bacterial flora composition based on the 16S rRNA gene obtained from the cotton swab (swab) sample on the fecal surface showed a bacterial flora composition having a relative ratio similar to that of the mucosal-associated bacteria on the surface of the colonic contents.

[0041] (1-2) Examination of intestinal mucosal-associated bacteria involved in colitis Based on the method for confirming the bacterial flora composition of microorganisms on the intestinal mucosal surface established in (1-1), the bacterial flora composition in the sample on the fecal surface (equivalent to the intestinal mucosal surface) was compared with the bacterial flora composition in the sample of the whole feces.

[0042] A part of the results is shown in Fig. 1. In this figure, Adlercreutzia bacteria were found as bacteria whose abundance ratio in the sample on the fecal surface (indicated as "Surface" in Fig. 1) increased significantly compared to the abundance ratio in the sample of the whole feces (indicated as "Whole" in Fig. 1) (Fig. 1). The analysis was performed using the generalized Wilcoxon test.

[0043] Example 2: Action of Adlercreutzia bacteria using a mouse model In this example, a mouse model of colitis was used to clarify the action of Adlercreutzia bacteria, which was shown to be present in the intestinal mucosa in Example 1 and have a high abundance ratio in healthy subjects and subjects with a treatment response to inflammatory bowel disease (IBD), on colitis.

[0044] The experimental design was as shown in Figure 2. Specifically, germ-free mice (C57BL / 6, female, 4-6 weeks old, 5 mice per group) were housed in a germ-free mouse housing vinyl isolator (ICM Co., Ltd.), fed with AIN93G sterile feed, and allowed to drink freely from a drinking bottle containing sterile water. These germ-free mice were divided into three groups: a control germ-free mouse group, a Ruminococcus gnavus-treated group, and an Adlercreutzia equolifaciens (+R. gnavus)-treated group, creating gnotobiotic mice (gnotobiotics are germ-free animals in which known microorganisms have been colonized) (see Figure 2(a)). The Adlercreutzia bacteria used in the examples were Adlercreutzia equolifaciens, more specifically, Adlercreutzia equolifaciens JCM 14811T strain (obtained from the Microbial Materials Development Laboratory, RIKEN BioResource Research Center (RIKEN BRC)). While Adlercreutzia equolifaciens was administered alone in preliminary studies, its engraftment in germ-free mice was poor. Therefore, co-administration with Ruminococcus gnavus (i.e., Adlercreutzia equolifaciens + R. gnavus) was chosen to improve engraftment. For this reason, a control group administered with Ruminococcus gnavus was established.

[0045] For the gnotobiotic mice, a culture solution of Ruminococcus gnavus was prepared for the Ruminococcus gnavus administration group, and a culture solution of Adlercreutzia equolifaciens + R. gnavus was prepared for the Adlercreutzia equolifaciens (+ R. gnavus) administration group. These were placed in experimental isolators, and 10 doses were administered to each group of mice using a sterile gastric tube and syringe. 8It was prepared by orally administering bacteria with CFU and allowing them to colonize for 4 weeks. During this period, in order to confirm the colonization of bacteria in the mouse intestinal tract, feces were sampled once a week and the CFU of the bacteria was examined. In addition, the control germ-free mouse group was raised for 4 weeks without administering bacteria.

[0046] Four weeks later, after measuring the body weight of the mice, the drinking water in the drinking bottles was changed to a sterilized 1.5% sodium dextran sulfate (DSS) aqueous solution, and the DSS test was started. Drinking DSS water was continued for 5 to 7 days until the colitis worsened (see Fig. 2(b)). During this period, while checking the survival of the mice every day, the body weight, water intake, and food intake of the mice were measured. In addition, feces were sampled every day, the degree of bloody stool and diarrhea was examined, and a Disease Activity Index (DAI) score was given.

[0047] The above DAI scoring refers to previous studies (Wanping Aw et al., Science of Food (2020) 4:5;). That is, ・ For body weight loss, a numerical value is given based on the reduction rate. 0: -1%, 1: -5%, 2: -10%, 3: -15%, 4: -20%, 5: death. ・ For bloody stool, a numerical value is given based on the amount of blood contained in the stool. 0: normal, 1: slightly red, 2: half of the feces mixed with blood, 3: all feces stained, 4: no feces even after waiting for more than 30 minutes with bloody stool, 5: weakness / death. ・ For diarrhea, a numerical value is given based on the softness of the feces. 0: normal, 1: some feces are soft, 2: overall soft feces, 3: soft feces and diarrhea mixed / all feces are very soft, 4: almost all feces are diarrhea / no feces even after waiting for more than 30 minutes, 5: weakness / death.

[0048] The results for the survival rate and the results for the DAI in this example are shown in Fig. 3. The survival rate was analyzed by the generalized Wilcoxon test (left in Fig. 3). In addition, the DAI was analyzed by two-way ANOVA (analysis of variance) (with FDR correction) (right in Fig. 3). In this figure, "**" indicates P < 0.01, and "***" indicates P < 0.001.

[0049] As a result, mice colonized with Adlercreutzia bacteria showed a significantly improved survival rate and reduced symptoms of DSS-induced colitis. In other words, it was shown that colitis was suppressed.

[0050] Example 3: Mechanism of Colitis Suppression by Adlercreutzia Bacteria In this example, experiments were conducted with the aim of elucidating the mechanism of suppression of colitis by Adlercreutzia bacteria, as observed in Example 2.

[0051] First, metabolome analysis was performed on the cecal contents of gnotobiotic mice engrafted with A. equolifaciens in Example 2, using either capillary electrophoresis-time-of-flight mass spectrometry (CE-TOFMS) or liquid chromatography-mass spectrometry (LC-MS). The results are shown in Figure 4. In this figure, statistical analysis was performed using Dunnett's test, where "NS" indicates no significant difference and "***" indicates a significant difference with P < 0.001. As shown in this figure, accumulation of substances such as taurine, ornithine, and ursodeoxycholic acid (UDCA) was observed in the cecal contents of gnotobiotic mice engrafted with A. equolifaciens.

[0052] Next, we investigated whether taurine, ornithine, and ursodeoxycholic acid (UDCA), which were found to accumulate in the intestinal tract by metabolome analysis, were involved in the significant improvement in survival rate and the reduction of symptoms of DSS-induced colitis in gnotobiotic mice engrafted with A. equolifaciens, as observed in Example 2.

[0053] The experimental design was as shown in Figure 5. Specifically, germ-free mice (C57BL / 6, female, 8-12 weeks old, 5 mice per group) were housed in germ-free mouse housing vinyl isolators (ICM Co., Ltd.), fed with AIN93G sterile feed, and allowed free drinking from drinking bottles containing sterile water. These germ-free mice were divided into four groups: a control group, a taurine administration group, an ornithine administration group, and an ursodeoxycholic acid (UDCA) administration group. The taurine, ornithine, and ursodeoxycholic acid (UDCA) groups were each given either a filtered 15 mM taurine aqueous solution, a filtered 15 mM ornithine aqueous solution (containing L(+)-ornithine monohydrochloride), or a filtered 0.5 mM UDCA aqueous solution, respectively, and administered via free drinking for 7 days (Figure 5(a)).

[0054] Seven days later, the mice's body weight was measured, and each water bottle was replaced with a sterile 1.5% DSS aqueous solution bottle. Taurine, ornithine, or UDCA were added to the test groups as described above (i.e., the control germ-free mouse group received 1.5% DSS aqueous solution, the taurine group received 15 mM taurine + 1.5% DSS aqueous solution, the ornithine group received 15 mM ornithine + 1.5% DSS aqueous solution, and the ursodeoxycholic acid (UDCA) group received 0.5 mM UDCA + 1.5% DSS aqueous solution).

[0055] The mice were given either the DSS aqueous solution or each test aqueous solution for 5 to 7 days until their colitis worsened (see Figure 5(b)). During this time, their body weight, water intake, and food intake were measured daily while their survival was monitored. Fecal samples were also collected daily to examine the degree of bloody stools and diarrhea, and a Disease Activity Index (DAI) score was assigned as shown in Table 1 of Example 2.

[0056] The results for weight change and DAI in this example are shown in Figure 6. Survival rates were analyzed using the generalized Wilcoxon test (Figure 6 left). DAI was analyzed using two-way ANOVA (configured variance analysis) (with FDR correction) (Figure 6 right). In this figure, "*" indicates P < 0.05 and "***" indicates P < 0.001.

[0057] As a result, supplementation with taurine, in particular among the three substances, significantly reduced DSS-induced colitis in germ-free mice. It was demonstrated that taurine alleviates DSS colitis in germ-free mice. Specifically, the significant improvement in survival rate in gnotobiotic mice engrafted with A. equolifaciens and the reduction in symptoms of DSS-induced colitis suggest that increased taurine accumulation in the intestinal tract promotes the alleviation of DSS colitis.

[0058] Example 4: Investigation of the taurine-producing ability of Adlercreutzia bacteria This example was conducted with the aim of elucidating the mechanism of action, based on the finding in Example 3 that A. equolifaciens, which engrafted in the intestinal tract of gnotobiotic mice, enhanced the production and accumulation of taurine in the intestinal tract.

[0059] The pathway for taurine production in the intestinal tract is as shown in Figure 7. Specifically, bile acid deconjugating enzyme (BSH) binds to taurocholic acid, which leads to bile acid deconjugation, breaking it down into cholic acid and taurine.

[0060] First, in Example 2, the concentrations of taurocholic acid and cholic acid in the cecal contents of gnotobiotic mice engrafted with A. equolifaciens were measured by LC-MS. The results are shown in Figure 8. In this figure, statistical analysis was performed using the Tukey-Kramer test for taurocholic acid and the Dunnett test for cholic acid, and significant differences were found. As shown in this figure, in the cecal contents of gnotobiotic mice engrafted with A. equolifaciens, taurocholic acid was significantly decreased, while cholic acid was significantly increased and accumulated. This indicates that bacteria of the genus Adlercreutzia have a strong deconjugation effect on taurocholic acid, leading to increased taurine accumulation in the intestinal tract.

[0061] Based on these results, the genome of the JCM 14811T strain of Adlercreutzia equolifaciens was used as a template to clone bile acid deconjugation enzyme (BSH) using the following primer sequences: Forward 5'-agaaggagatatacatatgtgcacgggcgttcgttttgccg-3' (SEQ ID NO.: 5) Reverse 5'-tcagtggtggtggtggtggtgggccgccacgcggatgagttcg-3' (SEQ ID NO.: 6), and the protein was subsequently purified. The cloned base sequence had the nucleotide sequence of SEQ ID NO.: 1, which encoded the BSH protein (amino acid sequence of SEQ ID NO.: 2). For comparison, we used the bile acid deconjugation enzyme from Bifidobacterium longum strain SBT2928, which has been reported to have the function of regulating human serum cholesterol concentration in prior art (Patent Document 1).

[0062] The generated and purified enzyme was mixed with taurocholic acid in PBS to a concentration of 3.5 μM and reacted at 37°C. Samples were taken from this reaction mixture every minute. The sampled reaction mixture was mixed with ninhydrin reaction solution and heated at 100°C for 18 minutes, after which the reaction mixture was cooled at 4°C for 20 minutes. Subsequently, using taurine as a calibration curve, the color development of taurine released in the reaction mixture at OD 570 nm was measured with a plate reader. The Kcat value (the amount of substrate converted by 1 mole of enzyme per unit time, i.e., the enzyme reaction rate) was calculated by averaging the taurine levels from 0 to 2 minutes of the reaction.

[0063] The results are shown in Figure 9. This figure shows that the Kcat value of BSH from Adlercreutzia equolifaciens JCM 14811T strain (12363.8±611.7) was approximately 40 times higher than the Kcat value of Bifidobacterium longum SBT2928 (287.1±98.4). In other words, it was found that the bile acid deconjugation enzyme derived from A. equolifaciens has a high ability and stability to produce taurine from taurine-bound bile acids.

[0064] These results suggest that the mucosal-associated bacterium Adlercreutzia equolifaciens alleviates colitis through the action of a bile acid deconjugation enzyme that produces large amounts of the anti-inflammatory compound taurine. This mechanism highlights the potential of these bacteria as targets for therapeutic interventions for colitis.

[0065] Example 5: Stability evaluation of BSH in Adlercreutzia equolifaciens In this example, the stability of bile acid deconjugating enzyme (BSH) in Adlercreutzia equolifaciens was evaluated.

[0066] The durability of the bile acid deconjugation enzyme from Adlercreutzia equolifaciens JCM 14811T strain (referred to as AeBSH in this example) was measured using both thermal stability tests and long-term stability tests. In both tests, the bile acid deconjugation enzyme from Bifidobacterium longum strain SBT2928 (referred to as BlBSH in this example) was used as a control.

[0067] 100 μl each of AeBSH solution (7 μM), the enzyme to be tested for thermal stability, or BlBSH solution (7 μM), the control enzyme, was dispensed into a 96-well plate (N=3 for each of the six specified temperatures). After standing on ice for 10 minutes, the plate was placed on a plate heater and heated at the specified temperatures (30°C, 37°C, 40°C, 50°C, 60°C, and 70°C) for 10 minutes.

[0068] Subsequently, 100 μl of TCA solution, warmed to the same temperature, was added to each well and quickly mixed with the BSH in each well, and allowed to stand for 3 minutes. 20 μl of the reaction mixture was sampled from each well and mixed with 20 μl of 15% trichloroacetic acid to stop the enzymatic reaction. The enzyme activity in each well was then measured by colorimetric quantification using a ninhydrin assay to determine the amount of free taurine.

[0069] The measurement results were calculated by setting the activity at 37°C as 100%, and then determining the percentage of taurine release at each temperature (30°C, 37°C, 40°C, 50°C, 60°C, and 70°C) relative to that value. The results are shown in Figure 10.

[0070] AeBSH maintained nearly 100% activity up to 40°C, 50°C, and 60°C compared to its activity at 37°C, and almost completely lost activity at 70°C. In contrast, BlBSH's activity decreased significantly with increasing temperature at 40°C and 50°C, and remained almost the same above 50°C. These results indicate that AeBSH exhibits significantly higher thermal stability at high temperatures up to 60°C compared to BlBSH.

[0071] Each BSH (AeBSH at 200 mM, BlBSH at 3 mM) dissolved in long-term stability test buffer (PBS buffer) was stored at 4°C. Before storage (day 0), after 1 day of storage, and after 1 month of storage, 100 μl of each sample was dispensed into a 96-well plate (N=3 for each of the three predetermined storage periods), and the samples were adjusted to 37°C.

[0072] Subsequently, the enzyme activity of each sample was measured using a procedure similar to that for the thermal stability test. Specifically, 100 μl of TCA solution adjusted to 37°C was added to each well, quickly mixed with the BSH in each well, and allowed to stand for 3 minutes. 20 μl of the reaction mixture was sampled from each well and mixed with 20 μl of 15% trichloroacetic acid to stop the enzymatic reaction. Then, the enzyme activity of each well was determined by measuring the released taurine colorimetrically using a ninhydrin assay.

[0073] The measurement results were calculated by setting the enzyme activity (taurine release) on day 0 as 100%, and then determining the percentage of taurine release at each storage period (after 1 day and after 1 month). The results are shown in Figure 11.

[0074] Compared to its enzyme activity on day 0, AeBSH's enzyme activity gradually decreased after 1 day and 1 month, but it maintained 83% of its activity even after 1 month. In contrast, BlBSH's activity decreased significantly over time, dropping to 48% after 1 day and showing almost no activity after 1 month. These results demonstrate that AeBSH has significantly higher long-term stability compared to BlBSH.

[0075] Example 6: Isolation of another Adlercreutzia equolifaciens and acquisition of BSH In this example, experiments were conducted with the aim of obtaining an isolated strain of Adlercreutzia equolifaciens other than the Adlercreutzia equolifaciens JCM 14811T strain described above, and obtaining alternative BSH from it.

[0076] Human stool samples were collected using a swab and suspended in GAM culture medium (Shimadzu Diagnostics). 10 3 double, 10 4 double, 10 5 50 μl of each diluted solution was plated onto 20% GAM-0.5% arginine 1.5% agar medium and incubated anaerobically at 37°C for 1 week.

[0077] Next, colonies (mainly small colonies) were picked with a toothpick and seeded onto a 96-well plate. Each was then subcultured, and PCR was performed using the following Adlercreutzia detection primers: Adler_F 5' - agtcatcatgccccttatgc - 3' (SEQ ID NO.: 7) and Adler_R 5' - acgcctccgccccagaag - 3' (SEQ ID NO.: 8).

[0078] From the culture medium of the two PCR-positive colonies, a streak was performed on GAM 0.5%-arginine 1.5% agar medium, and after 4 days of incubation, single colonies were stocked.

[0079] From single-colony stocks, the full-length 16S rRNA gene was amplified using primers: 27Fmod 5'- agrgtttgatymtggctcag -3' (SEQ ID NO.: 9) and 1492Rmod 5'-tacggytaccttgttacgactt -3' (SEQ ID NO.: 10). Sanger sequencing was performed to obtain the 16S rRNA gene sequences. The sequences of the 16S rRNA genes obtained from two strains of Adlercreutzia bacteria derived from the two PCR-positive colonies were completely identical.

[0080] BLAST analysis of the 16S rRNA genes of the two obtained Adlercreutzia strains revealed 99.71% homology with the sequence of the reference strain, Adlercreutzia equolifaciens JCM 14811T, thus confirming that they are the same species.

[0081] Alignment of the BSH sequences obtained from the human isolate Adlercreutzia equolifaciens strain JY1, strain JY2, and strain JCM14811 revealed that BSH genes with completely identical sequences were isolated from both Adlercreutzia equolifaciens strain JY1 and JY2 (nucleotide sequence of SEQ ID NO.: 3). Furthermore, the BSH protein encoded by this sequence (amino acid sequence of SEQ ID NO.: 4) was obtained. Comparison of the BSH gene sequence (SEQ ID NO.: 3) and protein (SEQ ID NO.: 4) with the BSH sequence obtained from strain JCM14811 revealed a sequence difference of 10 bases at the DNA level and 2 residues at the amino acid level.

[0082] Next, the BSH activity of the obtained bacterial cells (JY1 strain and JY2 strain) was measured using cell lysates.

[0083] Each bacterial cell was suspended in PBS buffer on ice and disrupted using beads for 15 minutes. The protein content in the suspension was then adjusted to 8 μg / ml to prepare a lysate, while a 2 mM taurocholic acid (TCA) solution (in PBS buffer) was prepared.

[0084] Next, both the cell lysate and TCA solution were incubated at 37°C for 10 minutes. 100 μl each of the cell lysate and TCA solution were then mixed and incubated at 37°C for 30 minutes. Afterward, the amount of taurine was measured by ninhydrin colorimetric analysis, and JCM 14811 was performed. T The relative value was calculated based on stock prices.

[0085] The results are shown in Figure 12. This figure shows that the BSH activity of the newly isolated Adlercreutzia equolifaciens JY1 and JY2 strains in this example was nearly equivalent to that of the control Adlercreutzia equolifaciens JCM14811 strain.

[0086] Example 7: Construction of an expression system for BSH of Adlercreutzia equolifaciens and its activity. In this example, the objective was to construct an E. coli expression system for BSH of Adlercreutzia equolifaciens.

[0087] The AeBSH gene (SEQ ID No.: 1), linked to the constitutively expressed trc promoter of E. coli, was inserted at the location of the intS gene in a gatC gene-deficient strain of E. coli BW25113 (obtained from the National BioResource Project (NBRP)). A kanamycin resistance gene was also inserted for the selection of insertion strains. A schematic of the vector structure is shown in Figure 13. E. coli strains incorporating this vector are called AeBSH E. coliΔgatC strains. On the other hand, as a control strain, a strain was prepared in which the fluorescent protein gene mVenus was inserted in place of the AeBSH gene at the same site as the AeBSH gene insertion site in the same E. coli strain. E. coli strains incorporating this vector are called mVenus E. coliΔgatC strains.

[0088] The experimental protocol is shown in Figure 14. Seven female mice (C57BL / 6) fed AIN93G Diet and raised under free drinking conditions were given each of the above strains for 10 minutes. 8 The CFU was administered orally and allowed to settle for 4 weeks. Subsequently, 1.5% dextran sulfate sodium (DSS) was given via a drinking bottle, and weight loss, bloody stools, and diarrhea were measured and observed. In addition, the DAI score, an index for evaluating the activity of ulcerative colitis, was calculated in the same manner as in Example 2.

[0089] The results are shown in Figure 15. The left panel of Figure 15 shows the change in body weight of the mice, and the right panel shows the change in DAI score. Regarding body weight change, compared to the change in body weight of individuals administered with the control mVenus E. coliΔgatC strain (indicated as mVenus in the figure), the change in body weight of individuals administered with AeBSH E. coliΔgatC strain (indicated as AeBSH in the figure) was significantly suppressed. However, no significant difference was observed in the change in DAI score.

[0090] Furthermore, we investigated in vitro whether BSH produced from the AeBSH gene-inserted Escherichia coli strain (AeBSH E. coliΔgatC strain) possesses deconjugation activity for taurocholic acid. In this experiment, mVenus E. coliΔgatC strain was used as the negative control, and BSH from Adlercreutzia equolifaciens JCM14811 strain was used as the positive control. Deconjugation activity was measured using the same method as in Example 4.

[0091] The results are shown in Figure 16. These results indicate that, although the activity is lower compared to BSH produced from the AeBSH gene-inserted E. coli strain (AeBSH E. coliΔgatC strain) (indicated as "AeBSH" in the figure), it possesses deconjugation activity.

[0092] This invention has found that bacteria contained in cotton swab samples from the surface of feces exhibit a similar bacterial flora composition to bacteria present in the intestinal mucosa, and based on this, it can provide a method for analyzing mucosal-related bacteria by analyzing cotton swab samples from the surface of feces.

[0093] Furthermore, as a result of this analysis, it was identified that bacteria of the genus Adlercreutzia inhabit the mucosal layer of the large intestine, and that their bile acid deconjugating enzyme has a very high taurine-producing activity, thus enabling the provision of a highly active bile acid deconjugating enzyme.

[0094] Furthermore, since it has been demonstrated that taurine produced by the bile acid deconjugation enzyme of the present invention alleviates colitis, the present invention can provide a composition having anti-inflammatory activity that contains a bacterium of the genus Adlercreutzia or a bile acid deconjugation enzyme derived from a bacterium of the genus Adlercreutzia.

Claims

1. A composition containing a protein with bile acid deconjugation enzyme activity derived from bacteria of the genus Adlercreutzia, which has anti-inflammatory effects in the intestinal tract.

2. The composition having anti-inflammatory activity according to claim 1, wherein the bile acid deconjugating enzyme activity protein derived from bacteria of the genus Adlercreutzia has an amino acid sequence of SEQ ID NO.: 2, an amino acid sequence of SEQ ID NO.: 4, or an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence of SEQ ID NO.: 2 or the amino acid sequence of SEQ ID NO.:

4.

3. The composition having an anti-inflammatory effect according to claim 1 or 2, wherein the inflammation is selected from the group consisting of colitis and non-alcoholic steatohepatitis (NASH).

4. A composition having the anti-inflammatory effect according to claim 1 or 2, wherein a protein having bile acid deconjugation enzyme activity derived from bacteria of the genus Adlercreutzia enhances the production of taurine from taurocholic acid.

5. The composition having anti-inflammatory activity according to claim 1 or 2, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens.

6. The composition having anti-inflammatory activity according to claim 5, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens JCM 14811T strain, Adlercreutzia equolifaciens JY1 strain, or Adlercreutzia equolifaciens JY2 strain.

7. A composition containing bacteria of the genus Adlercreutzia that has anti-inflammatory effects in the intestinal tract.

8. The composition having an anti-inflammatory effect according to claim 7, wherein the inflammation is selected from the group consisting of colitis and non-alcoholic steatohepatitis (NASH).

9. A composition having the anti-inflammatory effect according to claim 7 or 8, wherein bacteria of the genus Adlercreutzia enhance the production of taurine from taurocholic acid through the action of bile acid deconjugating enzymes.

10. The composition having anti-inflammatory activity according to claim 7 or 8, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens.

11. The composition having anti-inflammatory activity according to claim 10, wherein the bacterium of the genus Adlercreutzia is Adlercreutzia equolifaciens JCM 14811T.

12. A protein having bile acid deconjugation enzyme activity, having an amino acid sequence with SEQ ID NO.: 2, an amino acid sequence with SEQ ID NO.: 4, or an amino acid sequence with one or more amino acid deletions, substitutions, or additions in the amino acid sequence with SEQ ID NO.: 2 or the amino acid sequence with SEQ ID NO.:

4.

13. A protein having the bile acid deconjugating enzyme activity described in claim 12, derived from a bacterium of the genus Adlercreutzia.

14. A protein having bile acid deconjugating enzyme activity according to claim 12 or 13, which has the effect of enhancing the production of taurine from taurocholic acid in the intestinal tract.

15. A protein having bile acid deconjugating enzyme activity according to claim 12 or 13, which exhibits anti-inflammatory effects by producing taurine in the intestinal tract.