142 results about "Stoma" patented technology

The invention provides a digestive tract reconstruction device for protecting an anastomotic stoma, and relates to the field of medical instruments. The device comprises a nail anvil assembly, a nail bin assembly, a connection closing assembly and an anastomotic stoma protection assembly. A rotary guide mechanism is arranged in the nail bin assembly and drives the nail anvil assembly to rotate by a preset angle during axial movement, so that the short shaft of the oval nail anvil is aligned with the long shaft of the anastomotic stoma and exits without interference. And barbs are arranged in the cutting knife to hang and cut tissues, so that the nail anvil can be greatly overturned. The anastomotic stoma protection assembly comprises a degradable gasket and a folding flow guide tube, and the flow guide tube retreats and is unfolded along with the nail anvil to cover the anastomotic stoma and isolate pollutants. The mechanical injury of the anastomotic stoma when the nail anvil is withdrawn can be avoided, and the risks of infection, bleeding and leakage of the anastomotic stoma after operation are effectively reduced.

The invention provides a method and device for identifying real size information of a stoma based on machine vision, and belongs to the technical field of medical assistance. The method comprises the steps of obtaining calibration parameters, receiving equipment information which is input by a user and used for shooting, calling the calibration parameters according to the equipment information, obtaining an image which is input by the user and comprises a reference substance and a stoma, and inputting the image into a machine vision fusion deep learning model which is trained by using labeling information in advance, the method comprises the following steps: dividing a reference object area and a stoma area, extracting edge contours of the reference object area and the stoma area, performing size transformation according to calibration parameters, real size information of the reference object area and the edge contours of the reference object area and the stoma area, and calculating to obtain real size information of the stoma area. According to the method, the defects of manual trimming are overcome, full-closed-loop automatic operation from image acquisition, data processing to machining is achieved, and a complete technical chain of intelligent measurement, accurate cutting and efficient adaptation is formed.

Disclosed are a Solanum tuberosum drought tolerance-related transcription factor gene StPIF4 and the use thereof. A CDS sequence of StPIF4 has a length of 1554 bp, has a nucleotide sequence shown as SEQ ID No. 1, and encodes 517 amino acids, the amino acid sequence being shown as SEQ ID No. 2. The gene is located in a cell nucleus. The gene reduces the water loss of Solanum tuberosum seedlings under the drought stress by adjusting the opening degree of stomas, thus enhancing the drought tolerance of Solanum tuberosum. The present invention provides a new genetic material and a theoretical basis for analyzing the drought-tolerant molecular mechanism and drought-tolerant breeding improvement of Solanum tuberosum.

Ostomy apparatuses and methods of use are disclosed herein. An example apparatus can include an ostomy interface configured to be inserted into a stoma of a patient, the ostomy interface being shaped so as to prevent disassociation of the ostomy interface from the stoma, the ostomy interface having an annular upper flange; and a securement interface that is configured to lockingly mate with the annular upper flange of the ostomy interface and couple an ostomy bag to the ostomy interface.

The invention discloses a film water collection negative pressure system for an antibacterial operation. The film water collection negative pressure system comprises a water collection main body, a waterproof film and a negative pressure drainage tube. The shape of the water collecting main body is configured to surround a water collecting area on the outer side of a surgical incision on the body surface of a patient, and microporous structures facing the stoma of the human body are distributed on the water collecting main body; the water collecting main body and the water collecting area are covered with the waterproof thin film, the waterproof thin film is provided with a surgical operation opening corresponding to the stoma of the human body in position, and the waterproof thin film is further provided with a liquid passing hole facing the micropore structure; the head end of a tube body of the negative pressure drainage tube is connected with the micropore structure in an attached mode. And the tail end of the tube body of the negative pressure drainage tube is communicated and connected with a negative pressure source. Sterile normal saline for lavage incision can be prevented from flowing to an operating table, a bed sheet and the ground along the body of a patient, the sterile environment of an operation area is guaranteed, the risks of low body temperature, postoperative infection and the like in the operation of the patient are reduced, and the experience of the patient in the perioperative period is improved.

The invention discloses a method for adjusting the pore opening degree of Shanghai green, and belongs to the technical field of plant detection. Shanghai leaves are placed in 20mL of open liquid containing (1) 0.5% potassium chloride and 100 [mu] M / L calcium chloride or (2) 0.5% potassium chloride and 50 [mu] M / L brassinolide or (3) 0.5% potassium chloride and 10 [mu] M / L cytokinin or (4) 0.5% potassium chloride and 5 [mu] M / L gibberellin or (5) 0.5% potassium chloride and 100 [mu] M / L methyl jasmonate, culture is performed under illumination, and the illumination time is set to be 5h, so that the pore opening degree of Shanghai is remarkably increased. Compared with a control group (containing 0.5% of potassium chloride), the pore openness of the treatment is respectively increased by 33.5%, 43.5%, 43.4%, 27.1% and 70.2%. The method disclosed by the invention lays a technical foundation for rapidly screening out the exogenous environmental stimulation factor (environical stimuli) capable of increasing the opening degree of the pore.

The present application belongs to the technical field of ostomy base plate, and particularly relates to a leakage-proof ostomy base plate for postoperative colorectal cancer, which comprises a suction cup, the upper side wall of the suction cup is fixedly connected with a connecting cylinder, the outer wall of the connecting cylinder is fixedly sleeved with two limiting rings matched with an ostomy bag, the outer wall of the suction cup is fixedly sleeved with an adhesive layer, the inner wall of the connecting cylinder is fixedly connected with an elastic film, and a center hole is formed in the center position of the elastic film. Before the ostomy base plate is used, the size and shape of the center hole of the ostomy base plate can be freely adjusted according to the use condition, so that the leakage risk of excrement caused by the size deviation of the manually cut traditional fixed circular center hole is avoided, the compression damage of the ostomy mucosa caused by the too small cutting is eliminated, the sealing property of the base plate and the skin around the ostomy is improved, the complications such as fecal dermatitis are reduced, the nursing operation difficulty is reduced, and the wearing comfort and the life quality of the patient are improved.

This invention discloses a method for measuring stomatal conductance in maize leaves based on anchor-free target detection and stomatal conductance calculation, comprising the following steps: acquiring stomatal images of maize leaves; preprocessing, data augmentation, and stomatal labeling of the maize leaf stomatal images; constructing an optimal stomatal conductance model; constructing a deep learning model for stomatal identification and measurement, and training and testing the deep learning model. This invention improves upon the CenterNet target detection model, using DLA34 as the backbone network, replacing upsampled 2D convolution with deformable convolution, introducing an attention mechanism, and adding an angle prediction branch to automatically identify and measure stomata with tilt angles in maize leaf microscopic images. Simultaneously, a stomatal conductance loss function is introduced, and the optimal stomatal conductance model is used to automatically measure the stomatal conductance of maize leaves.

1. The name of the design product: suction disc (stoma base disc). 2. The use of the design product: It is suitable for stoma people with temporary stoma or permanent stoma after surgery. After combining the product with a stoma bag of the same size, it is used to collect stoma excretion and is adsorbed on the stoma waistline. 3. The design points of the design product: in shape. 4. The picture or photo that best indicates the design points: perspective view 1.

The invention belongs to the technical field of gene engineering, and particularly relates to a cornutgiella axataenae PdMYB44 gene and application thereof. The invention provides a cornutgiella dotacea PdMYB44 gene, wherein the CDS (Coding Sequence) of the PdMYB44 gene is as shown in SEQ ID NO. 1. The PdMYB44 gene disclosed by the invention is derived from the cornutgiium axataenense, so that the drought resistance of a transgenic plant can be improved, the flowering time is shortened, and the PdMYB44 gene can be applied to plant stress resistance genetic improvement. Results of embodiments show that according to a transgenic plant over-expressing the PdMYB44 gene, the proline content is increased, the malondialdehyde content is reduced, the transpiration rate and stomatal conductance are remarkably reduced, and the drought resistance of the transgenic plant is jointly improved by synergistically regulating three key mechanisms, namely accumulation of permeation protection substances, inhibition of membrane damage and optimization of stomatal behaviors.

This invention provides a storage bag-type stoma bag device and its usage method, relating to the technical field of stoma bags, including: a stoma bag, a stoma ring, a locking mechanism, and a cutting mechanism; the stoma ring has an annular receiving space, and the stoma bag is placed in the receiving space; the locking mechanism is disposed on the stoma ring, and the locking mechanism can lock the stoma bag to fix it; the cutting mechanism is used to cut and seal the stoma bag. When the stoma bag needs to be replaced, it is separated from the stoma bag by the locking mechanism, and the stoma bag is pulled out from the receiving space to increase the receiving volume of the stoma bag. Then, the stoma bag is cut and sealed by the cutting mechanism, so that the stoma bags on both sides are sealed to prevent odor. It does not require removing the stoma ring, which alleviates the technical problems of easily damaging the skin and intestines when changing the collection bag, exposing excrement and intestines, and causing a strong odor. It achieves the technical effects of avoiding the exposure of excrement and intestines, removing odor, and not easily damaging the skin and intestines.

The stoma enema suite device comprises a fixing assembly, a pipe assembly, an enema assembly and an antifouling assembly, and the pipe assembly comprises a first pipeline for enema and a second pipeline communicated with the fixing assembly; the first pipeline is used for introducing enema liquid into the intestinal tract from the container through the stoma; the second pipeline is used for introducing gas or liquid into the fixing assembly, so that the fixing assembly is tightly combined with the stoma; the fixing assembly comprises at least two balloons, a conical fixing piece and a spiral supporting piece. A balloon is arranged on the conical tip side of the conical fixing piece; the other balloon and the spiral supporting piece are both arranged in the inner cavity of the conical fixing piece, and the balloon is located on the inner side of the cavity space formed by the spiral supporting piece. According to the stoma enema suite device, the risk of leakage due to the folded state of the stoma can be avoided, the contact area between the stoma and the stoma is increased, and the purpose of preventing enema liquid from overflowing is achieved.

The invention discloses a blackberry RubHLH1 gene as well as an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the blackberry RubHLH1 gene provided by the invention is as shown in SEQ ID NO. 1, and the amino acid sequence of expressed protein is as shown in SEQ ID NO. 2. The RubHLH1 gene is genetically transformed into arabidopsis thaliana, and a RubHLH transgenic arabidopsis thaliana plant shows a plurality of beneficial characters compared with a wild type plant at the same growth time, including that the stem length is fast and thick, the SPAD value is high, and podding is carried out in advance; wherein stem segments and petiole epithelium spines of the bHLH-3 strain are more than those of a wild type, the leaf surface is more shrunk, and the number of pores is large. The activities of POD, SOD and CAT and the contents of MDA, H2O2, total phenols and flavonoids in a transgenic plant are higher than those in a CK contrast. The invention provides an efficient gene resource and a molecular tool for cultivating excellent transgenic plant varieties by using a molecular breeding means.

The utility model relates to the technical field of medical instruments, and discloses a wound stoma measuring scale, the left end of the bottom of a first measuring scale is fixedly connected with a fixed arm, the front side of the first measuring scale is provided with a sliding groove, the interior of the sliding groove is slidably connected with a sliding block, the front side of the sliding block is fixedly connected with a push block, and the push block is fixedly connected with the fixed arm. The bottom of the front side of the sliding block is fixedly connected with a sliding arm, the front side of the top of the sliding block is fixedly connected with an indicating block, the left end of the rear side of the first measuring ruler is fixedly connected with a rotating shaft, and the surface of the rotating shaft is rotatably connected with a second measuring ruler. During use, the sliding arm is separated from the fixed arm, the fixed arm is aligned with one side of a stoma, then the sliding block slides in the sliding groove to drive the sliding arm to move to the other side of the stoma, the diameter of the stoma can be obtained by observing the scales on the first measuring ruler, operation is easy, the measuring efficiency is improved, the application range is widened, and use is convenient.

The application provides a stoma cleaning device, comprising a cover body, a cleaning mechanism and a waste liquid recovery mechanism; one end of the cover body is open; the cleaning mechanism is installed on the cover body and can spray water towards the opening of the cover body; and the waste liquid recovery mechanism can recover the waste water in the cover body after cleaning. In the application, the stoma cover is arranged in the cover body through the abutment of the opening of the cover body and the skin of the patient, then the cleaning mechanism is controlled to act, the cleaning mechanism sprays water towards the stoma to clean the stoma and the skin around the stoma, the waste liquid after cleaning is covered by the cover body, then the waste liquid recovery mechanism is controlled to act, and the waste liquid recovery mechanism recovers the waste water in the cover body after cleaning; thus, the cleaning of the stoma can be replaced by artificial cleaning, and the psychological burden of the patient and the family members is reduced.

This application relates to the field of microscopic image analysis technology and provides a method and related products for detecting plant stomatal aperture in exploratory experiments. The method includes: acquiring leaf epidermal images under different light intensities; segmenting the preprocessed leaf epidermal images; extracting multiple stomatal regions from the segmented leaf epidermal images; calculating stomatal aperture indices for each stomatal region under different light intensities; recording stomatal aperture data from each field of view; removing outliers from the stomatal aperture data to obtain an effective stomatal set; statistically calculating the average and standard deviation of the stomatal aperture data of the effective stomatal set under the same light intensity as representative values ​​for the corresponding light intensities; obtaining fitting results based on the light intensities under various experimental conditions and the representative values ​​for the corresponding light intensities; and generating exploratory experimental conclusions and reports based on the fitting results. This application enables a lightweight quantitative investigation of the relationship between stomatal opening and closing and environmental factors.

The embodiment of the invention provides an anastomat which is configured to reduce fluid resistance at an anastomotic stoma and comprises a nail anvil assembly and a nail bin assembly, and the nail anvil assembly comprises a nail anvil provided with a first patch; the staple cartridge assembly comprises a staple cartridge assembled with a second patch, the first patch is provided with a first pore part and a first cutting position, and the second patch is provided with a second pore part and a second cutting position. When the end surface of the nail anvil and the end surface of the nail bin are in a state of clamping the first patch and the second patch, the first pore part is overlapped with the second pore part; and the first cutting position is overlapped with the second cutting position. The first patch and the second patch are cut in response to an annular knife of the staple cartridge, the inner annular edges of the first patch and the second patch being toothed. The inner diameter tooth-shaped structure can enable the cut anastomotic stoma to be in a state that the periphery of the caliber is relatively relaxed, the circumferential pressure of the anastomotic stoma is weakened, and the fluid resistance of the anastomotic stoma is reduced.

The utility model provides a metal support for intestinal canal anastomosis and anastomotic leakage, which relates to the technical field of medical instruments and comprises a metal support, a drainage tube and a support release device, the metal support is arranged in the support release device before being released, and the metal support is dumbbell-shaped after being released and comprises a first raised section, a second raised section and a groove section, the groove section is a double-layer metal net and comprises an inner-layer metal net and an outer-layer metal net, a space is formed between the inner-layer metal net and the outer-layer metal net, the inner face and the outer face of the metal support are both wrapped with silica gel coatings, a plurality of round holes communicated with the space are formed in the silica gel coating of the outer-layer metal net, the drainage tube is connected with the groove section, and the interior of the drainage tube is communicated with the space. After being released, the metal stent can block a digestive tract ventage or support liquid secreted by an anastomotic stoma, intestinal mucosa, blood vessels and ventage tissue, the liquid can enter the space between the two layers of metal stent nets through the round holes in the silica gel coating of the outer-layer metal net and is sucked out by negative pressure, cleanliness of the anastomotic stoma and the ventage can be kept, and healing of the anastomotic stoma and the ventage is promoted.

The application belongs to the field of plant biotechnology, and relates to application of a bHLH type transcription factor MYC2 in regulation of plant stomatal density and a method for obtaining a plant with reduced stomatal density by overexpression. The transcription factor MYC2 can activate the activity of plant stomatal density inhibitor EPF2 and EPFL4 promoters and inhibit the activity of plant stomatal density promoter EPFL9 in the process of stomatal formation, and regulate plant stomatal density and plant water use efficiency. The application can be applied to reduce the stomatal density of poplar and improve the water use efficiency of poplar by overexpression of the PpnMYC2 transcription factor, and provides a gene resource and a technical method for cultivating a low-water-consumption plant variety.

1. Name of the product in this design: Air Hole Imaging Device (Outdoor). 2. Purpose of this design: For collecting stomatal phenotypic data of plants growing in field settings. 3. The key design feature of this product is its shape. 4. The image or photograph that best illustrates the design's key points: a 3D model.

The invention discloses a stoma device based on radial wrinkle dynamic sealing and sequential control and an intelligent control system of the stoma device, and relates to the technical field of medical instruments. The device comprises a base assembly, a flexible sealing cylinder and a defecation guide assembly. The outer ring is rotationally driven to axially displace relative to the fixed ring, compression force is applied to the flexible sealing cylinder body, so that the flexible sealing cylinder body is subjected to unstable buckling to form annular wrinkles, and second main control sealing is realized by utilizing radial contraction force of the wrinkles; a sealing cover at the tail end of the defecation guiding assembly forms a first isolation seal. The system supports two-stage sequential control, allows a user to independently open the tail end seal for defecation preparation in the closed state of the main seal, and thoroughly eliminates the risk of opening while leaking. The invention further provides an upgraded and enhanced scheme, an intervention strategy is dynamically adjusted based on the pressure change rate, breathing guidance, logic lock operation and remote monitoring functions are provided, and the crossing from passive monitoring to active rehabilitation guidance is realized. According to the invention, bag-free dignate defecation is realized, and the safety, comfort and life quality of stoma patients are remarkably improved.

The application belongs to the technical field of molecular markers, and discloses a molecular marker Ms_Chr4_73090327 related to stoma density of Medicago sativa and application. The application uses GWAS whole genome association analysis combined with molecular marker development to analyze the stoma density of Medicago sativa, and obtains an InDel molecular marker Ms_Chr4_73090327 which is closely linked to the stoma density, has polymorphism, is stable and reliable, at the 73090327 locus on the 4th chromosome of Medicago sativa, an insertion / deletion fragment TTTTCTTTCTTTGTTAGTAGAGTGTTTGGGA, and a primer pair corresponding to the molecular marker Ms_Chr4_73090327 is designed. The application further provides a method for rapidly identifying the stoma density of Medicago sativa by using the InDel molecular marker, which is simple and fast, accurate in identification result, and has a good application prospect.

The application discloses a monitoring method and system for three-dimensional phenotype parameters of stoma cells of living plants, and comprises the following steps: S1, a plant confocal three-dimensional microscopic imaging and photosynthetic parameter measuring device is used, a self-made photosynthetic leaf chamber is used to realize cooperative monitoring of a down-positioned confocal microscope and a portable photosynthetic instrument, morphological changes of the same stoma under different environments are monitored, and three-dimensional Z-stack images and physiological parameters of a stoma complex of the living plants are synchronously obtained; and S2, a fluorescence image is automatically segmented and three-dimensional surface reconstruction is performed by using a granularity-based active contour model, so that three-dimensional phenotype parameters and pore characteristics of the stoma complex are obtained.

The utility model belongs to the technical field of embossed stoma base plates, and particularly relates to an embossed surface structure of an embossed stoma base plate, which comprises a bonding layer and an embossed mold. The bonding layer is located between the stoma base plate and the embossing die. The utility model provides the embossed surface structure of the embossed stoma base plate, the structural design of the embossed surface can realize complex and diversified embossed effects, the aesthetic property and the practicability of the base plate are improved, and the high requirement of the market on the embossed stoma base plate is met.

An ostomy baseplate includes a coupling component for coupling the baseplate to a corresponding coupling component of an ostomy pouch and an adhesive component for coupling the baseplate to the abdomen of the ostomate around a stoma. The ostomy baseplate further comprises a collar formed of woven material.

The application relates to a stoma base plate which is characterized in that the stoma base plate comprises a fitting layer, the middle of the fitting layer is provided with a through hole matched with the size of a stoma, the inner surface of the fitting layer is provided with textures, and the rigidity of the fitting layer is distributed in a gradient decreasing mode from the edge of the stoma to the peripheral direction; the rigidity of the contact part of the fitting layer and the concave area on the skin surface is lower than that of the adjacent flat area around the fitting layer, and the rigidity of the edge of the fitting layer is higher than that of the adjacent flat area around the fitting layer; and a buffer layer having a porous structure. According to the application, through the collaborative design of the stiffness gradient of the fitting layer, softening of the local concave area and edge hardening, the fitting layer can accurately adapt to the unique abdomen curved surface and skin microtopography of a patient, when the patient breathes and moves, dynamic deformation matching can be achieved through the design, the problem of excrement leakage caused by static non-fitting and dynamic gaps is solved, and the application range is widened. Complications such as skin inflammation, infection and the like caused by the traditional Chinese medicine composition are fundamentally prevented.

The invention relates to the field of leaf sample preparation and analysis, in particular to a sample preparation and phenotype analysis method based on full-leaf expanding plant stomata. The method comprises the following steps: S1, leaf pretreatment: selecting complete wheat leaves, spraying an ethanol solution on the surfaces of the leaves, and repeatedly and gently smearing the leaves so that the leaves are fully soaked in the ethanol solution; s2, a rubbing base is prepared, specifically, a double-faced adhesive tape section is flatly attached to clean lining paper through the adhesive face on one side, the adhesive face on the other side is exposed, the exposed adhesive face is covered with a transparent adhesive tape section with the same length, and a composite base is obtained; s3, sectioning and flaking; s4, curing the imprint; s5, transferring and sample preparation; s6, scanning a slide; and S7, performing phenotype analysis. The method provided by the invention can preprocess the epidermis wax coat of the leaf to eliminate wax and pigment interference, realizes forward and reverse extension of the whole leaf, is simple and efficient in sample preparation, clear and uniform in print, stable and easy to distinguish the sample, can present a clear and complete leaf stomata image, and can efficiently perform stomata analysis and data acquisition in combination with a phenotype analysis algorithm.

The invention discloses a method for reducing the noon break proportion of citrus stomata based on moisture regulation and control, and particularly relates to the technical field of fruit tree physiological regulation and control. The method comprises the following steps: acquiring a citrus leaf stomatal opening time sequence G (t) and a leaf water potential parameter psi (t), and constructing a stomatal activity response model M1; setting a target noon time period, and calculating a pore closing proportion; establishing a moisture regulation response model M2 according to the soil moisture content and the transpiration rate, and predicting psi (t) changes under different irrigation conditions; inputting the psi (t) output by the M2 into the M1, predicting the influence of different moisture regulation and control strategies on the theta m, and selecting an optimal irrigation scheme to control the target irrigation time, water volume and frequency; dynamic iterative optimization is carried out through theta m actual measurement and a model self-learning mechanism, and accurate moisture management and pore behavior regulation and control are achieved; the method has high adaptability, intellectualization and self-evolution ability, the noon stomata closing proportion can be effectively reduced, and the photosynthetic efficiency and the fruit tree yield are improved.

This invention discloses a method for improving the curing quality of upper tobacco leaves under arid conditions. This method targets upper leaves in arid climates, characterized by a compact structure, low leaf water content, and water bound to cellular tissue. During the yellowing stage, a dry-bulb temperature of 42-43℃ and a wet-bulb temperature of 38-39℃ are used to keep the stomata on both sides of the leaf open, ensuring the smooth removal of moisture from the tobacco leaf and allowing O2 from the curing barn to continuously enter the leaf through the stomata, aiding in the degradation of macromolecular organic matter and thus guaranteeing the quality of the tobacco leaf. This invention improves the curing quality of upper leaves under arid climates and reduces the occurrence of ash and discoloration during the curing process.