219 results about "Digestive tract" patented technology

The invention provides Eubacterium mucilaginosus E11405 and an application thereof. The invention provides Eubacterium mucus E11405, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the Eubacterium mucus E11405 is CGMCC No.31231. The invention further provides a preparation method of the Eubacterium mucus E11405. The inventor of the application studies the effect and mechanism of the Eubacterium mucus E11405 in relieving the mouse colorectal cancer, and the result shows that the Eubacterium mucus E11405 has a remarkable relieving effect on the mouse colorectal cancer, and can be used as a probiotic preparation for relieving the colorectal cancer. The Eubacterium mucilaginosus E11405 provides a new strategy for prevention and treatment of colorectal cancer-based digestive tract tumors, has potential clinical application prospects, and is expected to become an effective medicine for treating colorectal cancer-based digestive tract tumors.

The utility model relates to a digestive tract stenosis detection device which comprises an outer shell layer, an inner shell layer and filler. Wherein the inner shell layer comprises an inner shell and an inner shell cap; the inner shell and the inner shell cap are in butt joint to form a sealed cavity; the filler comprises a plurality of markers which are not mutually adhered, and all the markers are accommodated in the sealed cavity; and the outer shell layer wraps the inner shell layer. The digestive tract stenosis detection device is simple in structure, easy to manufacture and beneficial to reduction of production cost.

The invention discloses an angle rotating mechanism of a digestive endoscopy, and belongs to the technical field of digestive endoscopes, the angle rotating mechanism comprises a grip, one side of the grip is fixedly connected with a connecting pipe, a catheter is installed below the grip, a rotating device used for rotating without dead angles is installed in the catheter, an endoscope body is fixedly connected below the rotating device, and the endoscope body is fixedly connected with the connecting pipe. One side of the grip is connected with a protection device used for preventing mistaken touch. According to the endoscope, if reverse rotation is needed, an operator only needs to loosen the control button on the upper portion and press the control button on the lower portion, and then the motor can rotate reversely, so that the whole structure is driven to rotate in the opposite direction, and the endoscope body is gradually restored to the initial position; due to the optimization of the structural design, an operator can control the endoscope body to rotate without a dead angle more easily and freely, so that high-precision diagnosis and treatment operation can be realized in a complex digestive tract environment, the operation difficulty is effectively reduced, and the examination accuracy is improved.

The invention provides a digestive tract reconstruction device for protecting an anastomotic stoma, and relates to the field of medical instruments. The device comprises a nail anvil assembly, a nail bin assembly, a connection closing assembly and an anastomotic stoma protection assembly. A rotary guide mechanism is arranged in the nail bin assembly and drives the nail anvil assembly to rotate by a preset angle during axial movement, so that the short shaft of the oval nail anvil is aligned with the long shaft of the anastomotic stoma and exits without interference. And barbs are arranged in the cutting knife to hang and cut tissues, so that the nail anvil can be greatly overturned. The anastomotic stoma protection assembly comprises a degradable gasket and a folding flow guide tube, and the flow guide tube retreats and is unfolded along with the nail anvil to cover the anastomotic stoma and isolate pollutants. The mechanical injury of the anastomotic stoma when the nail anvil is withdrawn can be avoided, and the risks of infection, bleeding and leakage of the anastomotic stoma after operation are effectively reduced.

The invention relates to the technical field of medical care, in particular to a digestive endoscopy postoperative intelligent nursing system based on deep learning. The system comprises an endoscopic postoperative data acquisition and processing module, an endoscopic postoperative feature analysis module, an endoscopic postoperative recovery risk assessment module and a postoperative recovery risk intelligent nursing module, and can acquire physiological data of a patient after a digestive endoscopic surgery and digestive tract state image data after the endoscopic surgery; the long and short time memory network is used for obtaining the long and short time sequence characteristics of the physiological indexes after the endoscopic surgery, the convolutional neural network is used for identifying and obtaining the healing abnormal lesion characteristics after the endoscopic surgery, the characteristics are input into the preset deep neural network model for characteristic fusion, and postoperative recovery risk assessment calculation and postoperative intelligent nursing analysis are carried out. And generating digestive endoscopy postoperative patient recovery nursing suggestions so as to execute corresponding digestive endoscopy postoperative risk recovery nursing operation. According to the invention, postoperative data of the patient can be accurately analyzed, so that nursing decision-making work can be intelligently guided.

The invention relates to the technical field of medical instruments, in particular to a breaking device for blood clots in a digestive tract, an inner guide shaft is arranged in a catheter in a penetrating mode, a breaking head comprises a breaking cutting strip connected between an end piece and the catheter, and the breaking cutting strip is in an initial state that the breaking cutting strip elastically stretches and is folded at the periphery of the inner guide shaft. The end of the crushing head extends into the digestive tract through one end of an endoscope clamp channel, the movable finger ring is pulled upwards in the length direction of the handle, the movable finger ring drives the inner guide shaft and the end piece to synchronously and transversely move, so that the crushing cutting strips are in the state of being elastically bent and opened outwards, namely the crushing head is in the shape of an opened lantern, and then the crushing cutting strips are crushed by rotating the handle or the movable finger ring in the axial direction. The crushing head is driven to integrally and synchronously rotate, the crushing cutting strip on the outermost ring can push away digestive tract mucosa tissue to prevent mucosa from being damaged, the crushing cutting strip on the inner ring rotates around the inner guide shaft at a low speed, blood clots are crushed through a rotary cutting method, and the crushing effect is good.

The present disclosure relates to ruminant feed additive composition comprising a combination of urea, biuret and N-containing by-products of the biuret production out of urea, and optionally one or more nitrate compounds, to inhibit methane production emanating from the activities of the digestive tract of ruminant animals, the composition comprising one or more other methane inhibition compounds, chosen out of the group consisting of halogenated methane analogues in the form of halogenated aliphatic compounds with 1 or 2 carbons (also called C1-C2 hydrocarbons) and halocarbon compounds, nitro compounds, plant secondary metabolites (PSM), seaweed, algae, lichen, and / or fungi, dietary lipid and / or fatty acids, The present disclosure further relates to the use of such a ruminant feed additive composition to inhibit methane emissions from digestive activities of ruminant animals and additionally mitigate the amount of nitrous oxide (N2O) and ammonia (NH4) in the urine of the ruminant animal. The present disclosure also relates to a method for inhibiting the production of methane emanating from the digestive activities of ruminant animals, wherein the method comprises the step of orally administering to the ruminant animal an effective amount of such a ruminant feed additive composition.

The invention provides a buccal product and a preparation method thereof. In the application, the buccal product comprises the sustained-release agent, the sustained-release agent comprises at least one of a beta-cyclodextrin inclusion compound of the nicotine derivative and carboxylate of the nicotine derivative, and the sustained-release agent can enable the nicotine derivative to be uniformly, slowly and durably released in the oral cavity, so that the residence time of the nicotine derivative in the oral cavity is prolonged; therefore, the buccal product can keep stable strength for a long time, long-acting and mild physiological satisfaction is provided for consumers, and irritation to digestive tracts can be effectively reduced.

An endoscope-based special component for taking out foreign matters in a digestive tract comprises an endoscope sleeve base body (1) and an outer wall supporting air bag (2), wherein the outer wall supporting air bag (2) is arranged at the near end of the front end of the endoscope cannula base body (1); and the outer wall supporting air bag (2) is an eccentric air bag which is eccentrically arranged relative to the endoscope cannula base body (1). The utility model provides a tool system capable of ingeniously taking out foreign matters in the digestive tract, and the tool system is simple in structure and strong in operability; and the comprehensive technical effect is excellent.

Neonatal congenital digestive tract obstruction is digestive system structural deformity caused by various factors in the fetal development process, the invention provides a method for establishing a zebra fish model for neonatal congenital digestive tract obstruction, a gRNA target sequence is designed on an amino acid structural domain of a zebra fish ZIC3 gene, the specific sequence of sgRNA is GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGGGG, and a primer is synthesized; the ZIC3 mutation zebrafish juvenile fish grows to 6-7 days, and the zebrafish with the effective mutation type in embryo detection is obtained through multi-step detection.

The invention provides an application of polyoxyethylene particles in preparation of a biocompatible preparation for promoting digestive tract mucosal injury repair. The weight-average molecular weight of polyoxyethylene is 1 million Dalton to 7 million Dalton; the average particle size of the polyoxyethylene particles is 0.5 [mu] m to 2000 [mu] m; after the preparation is applied to the injured wound surface of the digestive tract mucosa, colloid covering the injured wound surface of the digestive tract mucosa is formed. The colloid can effectively protect digestive tract mucosa, avoid side effects caused by drug treatment of digestive tract mucosa injury, and provide an effective repair protection barrier for a digestive tract ulcer wound surface or a mucosa injury wound surface, so that the repair of the wound surface is promoted.

The invention provides a positioning device for an alimentary canal lesion endoscope, and relates to the technical field of alimentary canal endoscopes, the positioning device comprises an endoscope pipeline, an adjusting mechanism facilitating adjustment is arranged on the endoscope pipeline, a supporting mechanism facilitating positioning is arranged on the endoscope pipeline, and the adjusting mechanism comprises a protective hollow column and a mounting column; the supporting mechanism comprises an endoscope probe, a first adjusting pipe and a suction cup, the protective hollow column is slidably mounted at the circumferential end of the endoscope pipeline, and the mounting column is fixedly mounted at the circumferential end of the endoscope pipeline. By arranging the umbrella type supporting structure composed of the first adjusting tube, the second adjusting tube and the universal joint, the actual interior of the digestive tract is not a flat environment, natural wrinkles exist on the stomach wall, the intestinal mucosa fluctuates in a concave-convex mode, and individual differences exist in the forms of the digestive tracts of different patients; the multi-point supporting design of the umbrella type structure enables a plurality of supporting point positions to be respectively attached to mucous membranes at different positions around the focus.

The utility model discloses a mould is placed under the mould of simulation ultrasonic real -time guidance of nasal -intestinal tube, including the digestive tract simulation body of simulation esophagus, stomach, duodenum and jejunum, it adopts the flexible material of ultrasonic wave penetration, front surface is not transparent, back surface is transparent, and its inside esophagus is used for filling air, and the part except esophagus is used for filling liquid, the digestive tract simulation body is fixed between two organic glass, front surface is not transparent, back surface is transparent, the organic glass of front surface opens at esophagus place, antrum gastricum place respectively, as the acoustic window of ultrasonic, is used for the inflation sign of esophagus and antrum gastricum nasal -intestinal tube catheter tip cloud sign of ultrasonic observation when placing nasal -intestinal tube respectively, is provided with many resistance positions at stomach and duodenum, for making nasal -intestinal tube catheter tip forward into the obstruction. The utility model can simulate the sign of ultrasonic under different conditions on the mould, effectively simulates the actual entering process of nasal -intestinal tube under the real -time guidance of ultrasonic, and facilitates simulation teaching demonstration.

The invention relates to the technical field of biological materials, and provides an absorbable self-repairing suture line for maintaining the stability of a mechanical biological microenvironment and a preparation method of the absorbable self-repairing suture line. According to the suture line, an absorbable high polymer material is adopted as a matrix, and PLA microcapsules containing a medical-grade cyanoacrylate n-octyl ester repairing agent are uniformly dispersed in the matrix through a melt blending spinning process. When the suture line generates microcracks at dynamic tissue parts such as cardiovascular and digestive tracts due to periodic stress, the stress at the tip of the cracks enables the microcapsules to be broken to release the repairing agent, rapid in-situ polymerization occurs under triggering of tissue fluid, the self-repairing efficiency of 90% or above is achieved, and the strength retention rate of 95% or above is maintained in the key rehabilitation period of the suture line. The defect that a traditional absorbable suture line is prone to fatigue fracture in a dynamic environment is overcome, the mechanical integrity is actively maintained through an intelligent self-repairing mechanism, all components can be completely degraded and absorbed, and a safer and more reliable solution is provided for dynamic tissue repairing.

Provided is a suturing member capable of promoting hemostasis of a mucosa defective part and healing of the mucosa defective part. This suturing member 100A, which is used for suturing a mucosa defective part of a digestive tract wall, includes: an annular wire material 110 branched into two from an annular wire material base end 120 and connected with an annular wire material tip 130 opposing the annular wire material base end 120 to form an annular shape; and a cylindrical member 500 externally fitted to the annular wire material 110 so as to be slidable in a direction of the annular wire material tip 130 from the annular wire material base end 120. The annular wire material 110 forms a loop part 200 on the tip side of the cylindrical member 500, and has a wire material (for example, a crosslinking wire material 300) disposed above the mucosa defective part when the substantially central part of the loop part 200 is disposed so as to overlap the substantially central part of the mucosa defective part. The cylindrical member 500 is externally fitted to the annular wire material 110 and a wire material (for example, a crosslinking wire material 300) disposed above the mucosa defective part.

The present application relates to the technical field of biological medicine, and discloses a preparation method of ganoderma lucidum broken wall superfine powder for female insomnia, after the ganoderma lucidum thick piece is treated by the processes of spraying moistening, hot pressure steam heating, ultrasonic treatment and microwave drying, the content of polysaccharide, triterpene and sterol is improved, and the release rate of active ingredients is also significantly improved. The structure of the ganoderma lucidum mycelium cell wall is damaged by the present application technology, so that the active ingredients such as polysaccharide, triterpene and sterol originally existing in the ganoderma lucidum can be easily extracted and released. The ganoderma lucidum cells are loosened and broken in the present application, and the polysaccharide in the combined state can be changed into the free state, so that the content of the ganoderma lucidum polysaccharide can be greatly improved. The active ingredients in the ganoderma lucidum can be quickly and maximally released in the digestive tract by directly taking the broken wall superfine powder of the broken cells, so that the effect of the superfine powder on improving female insomnia is improved.

1. The name of the product of this design: Duodenal jejunal internal cannula device. 2. Purpose of the product of this design: used for the insertion and removal of medical products in the digestive tract. 3. The design key point of this appearance design product lies in the shape. 4. The picture or photo that best illustrates the key points of the design: 3D drawing of Design 1. 5. Designate Design 1 as the base design. 6. The product of this design is a slender object, and its length is omitted.

The invention relates to the technical field of digestive tract monitoring, in particular to a digestive tract hemorrhage monitoring system with an enteral nutrition support function, which comprises a tubular body, a channel used for conveying nutrient substances and provided with an input port and an output port is arranged in the tubular body, the input port is arranged close to one end of the tubular body remaining outside a human body, and the output port is arranged close to the other end of the tubular body remaining outside the human body. The output port is arranged close to one end, indwelling in the human body, of the tubular body, the sensor is arranged on the side wall of the portion, indwelling in the human body, of the tubular body and used for monitoring the hemorrhage condition of the digestive tract of the human body, and the input end of the host device is connected with the output end of the sensor. A data processing module in the host device processes data transmitted by a sensor, the sensor is arranged on a tubular body capable of performing nutrition support on the intestinal tract, and meanwhile, the host device is matched with the sensor, so that whether the alimentary canal is bleeding or not can be synchronously monitored during the period of nutrition support of the intestinal tract.

The utility model provides a metal support for intestinal canal anastomosis and anastomotic leakage, which relates to the technical field of medical instruments and comprises a metal support, a drainage tube and a support release device, the metal support is arranged in the support release device before being released, and the metal support is dumbbell-shaped after being released and comprises a first raised section, a second raised section and a groove section, the groove section is a double-layer metal net and comprises an inner-layer metal net and an outer-layer metal net, a space is formed between the inner-layer metal net and the outer-layer metal net, the inner face and the outer face of the metal support are both wrapped with silica gel coatings, a plurality of round holes communicated with the space are formed in the silica gel coating of the outer-layer metal net, the drainage tube is connected with the groove section, and the interior of the drainage tube is communicated with the space. After being released, the metal stent can block a digestive tract ventage or support liquid secreted by an anastomotic stoma, intestinal mucosa, blood vessels and ventage tissue, the liquid can enter the space between the two layers of metal stent nets through the round holes in the silica gel coating of the outer-layer metal net and is sucked out by negative pressure, cleanliness of the anastomotic stoma and the ventage can be kept, and healing of the anastomotic stoma and the ventage is promoted.

Systems, devices and methods for retrieving a magnetic implant used for forming a magnetic compression anastomosis between two adjacent walls of hollow organs of the digestive system of a patient are provided. The retrieving of the magnetic implant can be done using a retrieving device configured to magnetically engage the magnetic implant. The retrieving device can include a flexible housing comprising a housing wall defining a retriever magnet receiving cavity and a plurality of retriever magnets provided in series within the retriever magnet receiving cavity. The flexible housing can include a proximal portion having a proximal stopper engageable with a delivery wire. The proximal stopper can include a delivery attachment engageable with the delivery wire. The retrieving device can be magnetically engageable with the magnetic implant within the digestive tract when brought in sufficiently close proximity of each other via manipulation of the delivery wire.

The invention belongs to the technical field of medical instruments, and particularly relates to a child digestive tract foreign matter flexible clamping device which comprises an endoscope body, a flexible pipe is fixed to one end of the endoscope body, and a biopsy channel is formed in the flexible pipe. The multi-form clamping module is assembled in the biopsy channel in a sliding mode, the multi-form clamping module comprises a forceps rod, a driving guide wire, a first forceps head, a second forceps head, a third forceps head and a fourth forceps head, and the forceps rod is assembled in the biopsy channel in a sliding mode. Through a dual-mode clamping structure of the V-shaped clamp type clamping unit composed of the first clamp head and the second clamp head and the parallel type clamping unit composed of the third clamp head and the fourth clamp head, clamping modes can be flexibly switched according to the shapes of foreign matters; the device can adapt to child alimentary canal foreign matters in various forms such as flat, regular, circular and irregular shapes, and the clamping application range is greatly expanded.

The embodiment of the present application provides a medical detection device, comprising: a shell; a pressure measuring component, which is installed on the outer wall of the shell and is used for measuring the pressure of the environment outside the shell; and a concentration measuring component, which is installed on the outer wall of the shell and is used for measuring the concentration of a parameter to be measured in the environment outside the shell. The medical detection device in the embodiment of the present application can realize the detection of various parameters (including pH value, occult blood concentration, pepsin concentration and trypsin concentration) in the digestive tract, thereby improving the accuracy of the detection result of the medical detection device on the digestive tract. Meanwhile, the medical detection device can realize the measurement of the pressure in the digestive tract, thereby further improving the accuracy of the detection result. Moreover, the medical detection device can reduce the medical detection procedure and the number of devices required in the detection process, thereby saving the cost.

The application relates to the technical field of digestive tract detection, and discloses a digestive tract detection system based on artificial intelligence, which comprises a data acquisition unit, a preprocessing unit, a feature extraction unit, an abnormality detection unit and a result display unit. The application focuses on endoscopic images, accurately preprocesses the images into grayscale images and normalizes the grayscale images, reduces data complexity, highlights textures, and is beneficial to subsequent analysis; the application effectively extracts texture features, quantitatively presents subtle changes, accurately identifies lesions, scientifically judges abnormalities according to thresholds and displays the abnormalities, and realizes automatic and standardized detection. Meanwhile, physiological indexes are introduced, multidimensional data is integrated, and the function of the digestive tract is comprehensively reflected; the indexes are finely processed, individual differences and dynamic changes are considered, abnormal fluctuations are captured, and diseases are early warned; the application accurately detects abnormalities, cooperatively displays image and index results, and helps medical staff comprehensively judge. The application comprehensively and deeply detects, improves the accuracy of early screening, efficiently comprehensively diagnoses, has wide clinical applicability, promotes intelligent and accurate diagnosis and treatment, and the like.

Neonatal congenital duodenal obstruction is an intestinal lumen obstructive disease caused by abnormal development of the duodenum during fetal period, and it is a relatively common type among neonatal digestive tract obstructions. Its global incidence is approximately 1 / 5000 to 1 / 10000 neonates, and it is more common in Asian populations. The typical clinical manifestations of this disease include vomiting, upper abdominal distension, and delayed passage of meconium after birth. The present invention provides a method for establishing a zebrafish model for simulating duodenal obstruction, and additionally provides a design idea for the target.

1. The name of the product of this design: Esophageal jejunal stent (bristle type). 2. Purpose of the product of this design: to prevent or treat anastomotic fistula after reconstruction and anastomosis of the digestive tract in the human body. 3. The key points of the design of this product are its shape and its combination of elements. 4. The picture or photo that best illustrates the key points of the design: main view.

The embodiment of the invention provides a suture member capable of stopping bleeding of a mucous membrane defect part and promoting healing of the mucous membrane defect part. A suture member (100A) for suturing a mucosal defect part of a digestive tract wall, the suture member (100A) being configured so as to have: an annular wire (110) branched into two parts from an annular wire base end part (120) and formed in an annular shape by connecting to an annular wire tip end part (130) facing the annular wire base end part (120); and a cylindrical member (500) fitted over the annular wire (110) so as to be slidable in the direction from the annular wire base end (120) toward the annular wire tip (130), the annular wire (110) forming a ring part (200) further toward the tip side than the cylindrical member (500), and the annular wire (110) being disposed so that the substantially central part of the ring part (200) overlaps the substantially central part of the mucous membrane defect part. The annular wire (110) has a wire (for example, a bridge wire (300)) disposed above the mucous membrane defect portion, and the cylindrical member (500) is externally fitted to the annular wire (110) and the wire (for example, the bridge wire (300)) disposed above the mucous membrane defect portion.

The utility model relates to a collecting device for digestive tract tumor detection through excrement screening, which comprises a sampling tube, and a through hole is arranged at the eccentric position of the end part of the sampling tube; the pushing assembly is arranged in the sampling pipe in a sliding mode, abuts against an elastic structure installed in the sampling pipe, can be inserted into a sliding groove formed in the inner wall of the sampling pipe, and extrudes the elastic structure when moving directionally; according to the excrement collecting device, the pushing assembly is controlled to move upwards relative to the sampling pipe in the direction of the sliding groove to extrude the elastic structure, so that the excrement collecting work is completed, when the pushing piece is controlled to rotate relative to the sampling pipe in the direction of the sliding groove, the blocking piece is driven to rotate synchronously, and therefore the excrement collecting work is completed. The through hole is blocked, so that the possibility of cross infection of the collected excrement is avoided, and the position of the pushing assembly is locked under the action of the elastic structure.

The invention belongs to the technical field of digestive tract mucosa protective agents, and relates to a product with the efficacy of preventing and treating digestive tract mucosa injury and a preparation method thereof. The functional component of the product is hydrophilic adhesive material powder, the particle size of the powder is 50-200 meshes, or the functional component is colloid formed after the hydrophilic adhesive material absorbs water and swells, and the viscosity of the colloid is 5-200 cp; the hydrophilic adhesive material is more than one of caesalpinia spinosa gum, Arabic gum, guar gum, konjac gum, carrageenan, tragacanth gum and xanthan gum with specific viscosity. The preparation method comprises the following steps: uniformly mixing the raw materials, grinding, screening until the particle size is 50-200 meshes, and packaging, or adding the raw materials into water until the raw materials absorb water and swell to form colloid with the viscosity of 5-200cp, and packaging. The product takes effect quickly, has no side effect, is simple in preparation method and is suitable for large-scale preparation.

The present invention discloses a data processing method and system for digestive tract tumors, which relates to the field of medical information processing technology. By collecting the patient's key physiological parameters and tumor characteristics from multiple data sources, a tumor identification data set P of the patient is formed, and through standardized preprocessing and feature vector integration, the consistency and computability of the data are guaranteed. The disease progression prediction model constructed using a machine learning method takes the patient's feature vector X as input and can efficiently predict the patient's disease progression fluctuation probability index Progress. Furthermore, combined with the correction coefficient algorithm and the set correction fluctuation threshold Cthe, the recovery period content extracted from the patient's initial medical record can be dynamically corrected to obtain the corrected recovery period Tad. Through feedback and iterative optimization, the calculation formula of the corrected survival period is continuously verified and updated, ultimately achieving the effect of improving prediction accuracy and adapting to individual differences among patients.

The invention discloses a digestive tract tumor biopsy sampling device convenient for puncture and sampling for medical oncology, which relates to the technical field of tumor biopsy sampling and comprises a biopsy device, a limiting seat and a base. According to the alimentary canal tumor biopsy sampling device convenient to puncture and sample for the medical oncology, tumor tissue can be accurately contained through the sampling groove, fragmentation of a tumor tissue sample is avoided, it is guaranteed that the tissue sample meets the tissue form needed by detection, the sample quality is guaranteed, the outer sleeve needle covers the sampling groove after sampling, the sample can be fixed and cannot fall off, and the sampling efficiency is improved. The tissue is prevented from remaining in the body or being polluted during withdrawing, and meanwhile the risks of bleeding and tissue damage in the puncture process are reduced; enough samples can be obtained through one-time operation, the repeated puncture frequency is reduced, the operation time is shortened, the pain of a patient is relieved, and the operation efficiency is improved; and the modularized puncture needle design allows medical staff to quickly adjust the puncture depth according to individual differences, and the flexibility is high.