28 results about "Benign tumor" patented technology

Treatment of damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) is provided by delivering specialized pulsed electric field energy to target tissue areas in a specific dose so as to obtain a superior outcome. The specialized PEF energy and delivery has been optimized to provide advanced treatment of target tissue areas, including destruction of undesired tissue and generation of improved inflammatory and immune responses. The specialized PEF energy provides superior outcomes to radiofrequency ablation and irreversible electroporation.

Treatment of damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) is provided by delivering specialized pulsed electric field (PEF) energy to target tissue areas in a specific dose so as to obtain a superior outcome. The PEF energy and delivery has been optimized to provide advanced treatment of target tissue areas, including destruction of undesired tissue and generation of improved inflammatory and immune responses. These various types of treatment are controlled by a variety of factors including the electrode geometry, the dose of PEF energy delivered, the time the energy is delivered over, and the waveform of the PEF energy itself. The PEF energy is delivered in the form a dose which is considered to be one application of the specialized energy. Each dose creates a lesion in the target tissue area.

The invention relates to the technical field of image recognition, in particular to an osteosarcoma image intelligent recognition and classification method and system based on an image recognition model. The method comprises the following steps: collecting a tumor image and carrying out multi-sequence disturbance equilibrium enhancement to generate an enhanced block tumor image, then obtaining a color standardized image through color space transformation remapping, then extracting a tumor region image and carrying out contrast inversion processing, reconstructing a tumor feature image, and finally, carrying out multi-sequence disturbance equilibrium enhancement on the tumor feature image. Based on a preset image recognition model, tumor edge features are recognized, the edge rule degree is determined, preliminary classification is carried out, a benign tumor image is obtained, surrounding metabolite signal features of the benign tumor image are analyzed, a benign reference group is formed through combination, metabolism state comparison is carried out on tumor feature images, and metabolism difference data are generated. And performing category correction according to the metabolic state mapping data so as to identify the osteosarcoma category. According to the invention, intelligent analysis of tumor features is realized, the image processing flow is optimized, and the processing efficiency is improved.

CD24-positive malignant and benign tumors are treated by administration of a naturally occurring or modified oncolytic Zika virus. Diseases associated with abnormal T cell activation or T cell-mediated autoimmunity, wherein CD24 expression is increased, are also expected to be treated by administration of a naturally occurring or modified oncolytic Zika virus. Also contemplated are compounds and methods for treating and / or preventing Zika virus infection in a subject.

Devices, systems, and methods for treatment of the subcutaneous tissues of various types. Non-invasive ultrasound energy is used for planning, monitoring and treating the adipose tissue, small blood vessels, and benign tumors of the subcutaneous tissue. While high intensity focal ultrasound (HIFU) has been used to treat many areas of the body including cancer lesions typically using ablation / high heat energy, lower intensity volumetric ultrasound (LIVU) techniques are used to denature the subcutaneous layer. Various safety features may be included to further enhance the treatment of the subcutaneous tissue using LIVU techniques.

The invention belongs to the field of disease detection reagents, and particularly relates to application of a reagent for detecting a marker in preparation of an ovarian cancer diagnosis product or a prognosis evaluation product, the marker is piRNA as shown in SEQ ID NO: 1, an ovarian cancer diagnosis model established on the basis of the piRNA has an ROC curve lower area of 0.902, sensitivity of 0.844, specificity of 0.767 and accuracy of 0.804, and the marker is piRNA as shown in SEQ ID NO: 2. Ovarian malignant tumor patients, benign tumors and healthy individuals can be effectively distinguished, and the ovarian malignant tumor marker is remarkably superior to existing clinical common tumor markers CA-125, CEA, CA19-9, HE4, ROMA and the like. Meanwhile, the early diagnosis efficiency of the marker for ovarian tumor patients is remarkable (the area under the ROC curve is 0.854), and is superior to that of the existing clinical common tumor marker CA-125 (the area under the ROC curve is 0.815). And the expression level of the marker in ovarian cancer serum is related to the treatment state, lymph node metastasis state, clinical staging and survival prognosis time of an ovarian cancer patient, so that a reagent for detecting the marker can be used for preparing an ovarian cancer diagnosis product or a prognosis evaluation product.

The present invention relates to C-X-C motif chemokine ligand 10 (CXCL10) binding proteins and their use in methods of detecting and / or diagnosing a condition in a subject, including determining the level of CXCL10 in a subject. Specific antibodies that bind total CXCL10 (full length, N-terminally truncated and citrullinated) and antibodies that bind active CXCL10 (full length) are used to measure the level of total CXCL10 and active CXCL10 in ovarian cancer patient samples. The calculated ratio between active CXCL10 and total CXCL10 is lower in patients with malignant disease compared to patients with benign tumors or healthy individuals, and this calculated ratio is the basis for methods of diagnosing malignant disease, monitoring tumor burden and disease progression.

A method for enhancing an accuracy of a benign tumor development trend assessment system includes: a first processing procedure, an image captured before the treatment is inputted to and be processed by a server computing device of the benign tumor development trend assessment system to obtain a first processing result; a second processing procedure, the images captured before and in at least one period after the treatment are inputted to and processed by the server computing device to obtain a second processing result; a trend analyzing procedure, the trend analyzing module of the server computing device analyzes the first processing result, the second processing result and the trend pathways to obtain a tumor development trend result; and a storing procedure, the first processing result, the second processing result and the tumor development trend result are transformed to an individual trend pathway which is stored in the trend analyzing module.

The invention relates to the use of a pharmaceutical medication comprising an aromatase inhibitor, preferably a steroidal aromatase inactivator and an antioxidant as effective ingredients for the treatment of sex hormone-dependent diseases. Furthermore, the invention relates to a composition comprising an aromatase inhibitor / —inactivator and α-lipoic acid and / or extract of green tea containing polyphenols. The combination of an aromatase inhibitor and—inactivator and α-lipoic acid and / or extract of green tea containing polyphenols is particularly suitable for the treatment of sex hormone-dependent diseases as well as for the treatment of benign tumors such as e.g. lipomatoses as occurring in Madelung's disease.

The present disclosure provides a prophylactic or therapeutic agent for a benign tumor. Provided is a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a specific embodiment, the present disclosure provides a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a preferred embodiment, the prophylactic or therapeutic agent for a benign tumor (e.g., familial adenomatous polyposis) according to the present disclosure comprises a killer-type and / or helper-type WT1 peptide. In a further preferred embodiment, the aforementioned WT1 peptide is a WT1 126 killer peptide and / or WT1 35 helper peptide. In another aspect, provided are WT1 peptide-specific CTLs, a method for inducing WT1-specific helper T cells, and a method for inducing dendritic cells presenting a WT1 peptide.

The invention provides a tumor image analysis processing method and system. The method comprises the following steps: acquiring a tumor image of a patient corresponding to an irradiation item; based on the patient tumor image, extracting comprehensive features of the tumor, and based on the comprehensive features, judging a display result corresponding to the tumor; if the tumor is benign, acquiring basic data corresponding to the current benign tumor, and generating a diagnosis and treatment suggestion of the benign tumor; if the tumor is malignant, acquiring a pathological type corresponding to the malignant tumor, extracting intensity distribution data corresponding to the malignant tumor, and analyzing invasiveness corresponding to the malignant tumor; according to the method, the invasiveness of the malignant tumor is comprehensively judged according to the tumor image of the patient and the blood vessel distribution and the blood sampling inspection result corresponding to the tumor position, the misdiagnosis and missed diagnosis situations caused by the poor tumor image are made up, and the diagnosis and treatment advice corresponding to the malignant tumor is generated according to the diagnosis and treatment advice. The effectiveness of tumor result analysis is guaranteed, the workload of doctors is relieved, and effective tumor intervention is achieved.

This invention provides compounds of Formulae (IA), (IB), (IC), (ID), (IE), (IF), (IG), (IH), (IJ), (IK), (IL), (II), (III), (IIIA), and (IIIB); pharmaceutically acceptable salts and solvates thereof; and compositions thereof. This invention further provides methods for treating a disease, including but not limited to, liver disease or an abnormal liver condition; cancer (such as hepatocellular carcinoma or cholangiocarcinoma); a malignant or benign tumor of the lung, liver, gall bladder, bile duct or digestive tract; an intra- or extra-hepatic bile duct disease; a disorder of lipoprotein; a lipid-and-metabolic disorder; cirrhosis; fibrosis; a disorder of glucose metabolism; a cardiovascular or related vascular disorder; a disease resulting from steatosis, fibrosis, or cirrhosis; a disease associated with increased inflammation (such as hepatic inflammation or pulmonary inflammation); hepatocyte ballooning; a peroxisome proliferator activated receptor-associated disorder; an ATP citrate lyase disorder; an acetyl-coenzyme A carboxylase disorder; obesity; pancreatitis; or renal disease.

The present disclosure provides a composition for preventing or treating a benign tumor. Provided is a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a specific embodiment, the present disclosure provides a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a preferred embodiment, the composition for preventing or treating a benign tumor (e.g. familial adenomatous polyposis) according to the present disclosure comprises a killer type WT1 peptide and / or a helper type WT1 peptide. In a further preferred embodiment, the WT1 peptide is WT1126 killer peptide and / or WT135 helper peptide. In another aspect, provided are a method of inducing WT1 peptide-specific CTLs, a method of inducing WT1-specific helper T cells, and a method of inducing dendritic cells presenting a WT1 peptide.

The invention relates to the technical field of image recognition, and discloses a breast ultrasonic tumor recognition method fusing channel attention and dynamic channel routing, which comprises the following steps: acquiring a breast ultrasonic image, and carrying out preprocessing and data enhancement; constructing a deep convolutional neural network containing a ResNet101 backbone network, an SE channel attention unit and a dynamic feature reconstruction module; taking Focal Loss with category weight as a loss function, and combining with an SAM optimizer to train the network; according to the method, an SE channel attention unit is embedded, a dynamic feature reconstruction module is connected, and an SAM optimizer is cooperatively used, so that the model can model channel importance and global space context dependence at the same time, and the classification probability of a benign tumor, a malignant tumor or a normal tissue is output. And a flat minimum value is found on a complex loss curved surface, so that accurate and robust recognition of tumors in low-quality and small-sample breast ultrasound images is realized, and the classification accuracy and generalization ability are effectively improved.

Disclosed herein is a method and apparatus for cancer detection and diagnosis by amplification of a reflected signal from the tissue of interest. Specifically, a linearly polarized EM beam travels above the tested area and enters the tested area curvature at a zero incidence angle. The detected tumor's size is correlated with the area under the reflected signal's curve, which depends on size and depth inside the tested body. The amplitude of the reflected signal depends on an angle (θ), unique to each type of tissue, between the plane of the linearly polarized EM beam and its vector of velocity. A method is also disclosed that includes conducting a background scan, scanning at the angle (θ-m) determined for the malignant tumor's tissue, and scanning at the angle (θ-b) determined for the benign tumor's tissue. Amplitude differences between the malignant or benign scans and the background scans indicates the discovered tumor.

Provided are an anti-Nectin-4 antibody and the use thereof. The anti-Nectin-4 antibody or antigen-binding fragment can specifically bind to Nectin-4 and has high affinity and strong endocytosis capacity, and therefore can be used for diagnosis, prevention, and / or treatment of tumors (comprising cancers and benign tumors).

The application discloses application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, and is characterized in that the serum tsRNA is tsRNA-Asp-5-0013 sequence, the stem loop structure reverse transcription primer sequence is CACTCAACAGACCTGCACGAGCACGAC AGTCACAAGAGGTGCAGGTCTGT, the fluorescence quantitative PCR specific amplification upstream primer is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTTAGTATAGT. The application also provides application of the serum tsRNA in preparation of non-small cell lung cancer and benign tumor, tumor size, non-small cell lung cancer N0 and N1-3 stage, M0 and M1 stage and TNM stage diagnosis, and has high specificity and sensitivity.

The present disclosure provides methods and reagents for diagnosing pancreatic cystic tumors. Specifically, it relates to a pancreatic cyst fluid detection method based on proteins and their glycosylation modifications, which is used for the diagnosis of pancreatic cystic tumors, thereby distinguishing mucinous tumors from non-mucinous tumors, and malignant / borderline malignant tumors from benign tumors.

The present invention relates anti-microbial antibody signatures related to lung tumors, including benign tumors and adenocarcinomas. Disclosed herein are antibody panels comprising antigens from bacteria and / or viruses for use in early and accurate diagnosis of lung cancer and for reducing false positive lung carcinoma diagnoses from CT screening.

The application provides a malignant and benign tumor recognition system based on a hyperspectral image, and relates to the technical field of medical image processing.The system comprises: a feature extraction module, which is used for performing sharpening processing on an acquired hyperspectral image and extracting an edge feature map of the hyperspectral image after the sharpening processing; a feature fusion module, which is used for performing fusion of different frequency band features of the hyperspectral image and the edge feature map by using a Laplacian pyramid image fusion algorithm to obtain a tumor hyperspectral feature enhancement map; and a recognition module, which is used for inputting the tumor hyperspectral feature enhancement map into a pre-trained malignant and benign tumor recognition model, outputting tumor boundary features, and determining a tumor category of the hyperspectral image according to the tumor boundary features.Through the system, more abundant tumor edge information can be extracted, the tumor recognition performance in the case that the malignant tumor is not obvious is strengthened, and thus the accuracy of the malignant and benign tumor recognition is improved.

The present invention relates to the technical field of computer-aided preoperative analysis, and discloses a surgical margin path generating method and system for tumor surgery and a storage medium. The method comprises: acquiring clinical pictures of a tumor, dermatoscopy pictures, and medical history information of patients; segmenting and extracting tumor boundaries from the dermatoscopy pictures by using a preset deep learning network model to obtain skin tumor boundaries under a dermoscope; registering the skin tumor boundaries with the clinical pictures to obtain target tumor boundaries; generating an initial surgical margin path according to the medical history information, the target tumor boundaries, and a preset path generating model; in the case of a benign tumor, smoothing the initial surgical margin path to generate a surgical margin path of a fusiform incision.

Devices, systems and methods are provided to treat damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) by delivering specialized pulsed electric field (PEF) energy to target tissue areas. The energy is delivered in a manner so as to be non-thermal (i.e. below a threshold for causing thermal ablation). Consequently, when extracellular matrices present, the extracellular matrices are preserved, and the targeted tissue maintains its structural architecture including blood vessels and lymphatics. Thus, sensitive structures, such as biological lumens, blood vessels, nerves, etc, are preserved which are critical to maintaining the integrity and functionality of the tissue. The energy is delivered with the use of systems and devices advantageously designed for superior access to target tissue throughout the body, particularly in locations previously considered inaccessible to percutaneous approaches.

The invention relates to the technical field of medical teaching aids, in particular to a breast cancer pathology demonstration teaching aid, which comprises a base and two models rotating on the base, the two models are symmetrically designed, the two models are folded to form a chest model, and the two models are oppositely unfolded to install and debug internal tissue devices; a functional inner cavity is dug in the model, an assembly plate is installed in the functional inner cavity, a capsule body is installed on the assembly plate, the capsule body is a semi-elliptical shell, the interior of the capsule body is hollow, and a reaction medium capable of being hardened or softened is designed in the capsule body; the reaction medium can be driven into solid or liquid by the variable component so as to simulate malignant or benign tumors, and the simulation palpation can be carried out on the movable adhesion, hardness and size of the lumps.

The invention discloses a medicine for treating benign tumors and a preparation method thereof, and the medicine comprises the following components in parts by weight: 9-30 parts of codonopsis pilosula, 9-30 parts of coix seeds, 9-15 parts of selfheal, 10-15 parts of dandelion, 3-10 parts of endothelium corneum gigeriae galli, 9-12 parts of hawthorn, 3-10 parts of pericarpium citri reticulatae, 3-9 parts of ginseng and 2-6 parts of schisandra chinensis. The preparation method comprises the following steps: sorting medicinal materials, preparing a water extraction concentrated solution, preparing fine powder, granulating, filling, inspecting, packaging and the like. The medicine disclosed by the invention has the effects of invigorating spleen, replenishing qi, eliminating dampness, reducing phlegm, diminishing swelling and removing stasis. The medicine for treating benign tumors has the characteristics of quick response, good curative effect, safety and no toxic or side effect.

Devices, systems and methods are provided to treat damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) by delivering specialized pulsed electric field (PEF) energy to target tissue areas. The energy is delivered in a manner so as to be non-thermal (i.e. below a threshold for causing thermal ablation). Consequently, when extracellular matrices present, the extracellular matrices are preserved, and the targeted tissue maintains its structural architecture including blood vessels and lymphatics. Thus, sensitive structures, such as biological lumens, blood vessels, nerves, etc, are preserved which are critical to maintaining the integrity and functionality of the tissue. The energy is delivered with the use of systems and devices advantageously designed for superior access to target tissue throughout the body, particularly in locations previously considered inaccessible to percutaneous approaches.

The invention relates to a tumor prediction method and system based on fusion of spatial perception mask prompt and multiple views. The prediction method comprises the following steps: acquiring a three-dimensional ultrasonic mammary gland image of a patient; inputting the obtained three-dimensional ultrasonic mammary gland image into a trained medical image analysis model; processing and analyzing an input three-dimensional ultrasonic mammary gland image by using the medical image analysis model to obtain a tumor benign and malignant classification result and a benign tumor malignant risk prediction result in the three-dimensional ultrasonic mammary gland image; and presenting a benign tumor malignant transformation risk prediction result in a structured text form, and generating a risk assessment result about the benign tumor. By introducing the Prompt mechanism and the training strategy, the key features of the lesion area can be identified more accurately, the accuracy of benign and malignant classification is remarkably improved, a solid foundation is provided for malignant transformation risk assessment of benign tumors, and meanwhile the workload of doctors is relieved to a certain degree.

The present application relates to the technical field of medical teaching aids, in particular to a breast cancer pathological demonstration teaching aid, which comprises a base and two models rotating on the base, the two models are symmetrically designed, the two models are folded to form a chest model, and the two models can be installed and adjusted with internal tissue devices when unfolded; a functional inner cavity is formed in the inside of the model, an assembly plate is installed in the functional inner cavity, a capsule is installed on the assembly plate, the capsule is a semi-elliptical shell, the capsule is hollow, and a reaction medium capable of hardening or softening is designed in the capsule; a variable assembly, the reaction medium can be driven to be solid or liquid by the variable assembly to simulate malignant or benign tumors, and the present application can simulate palpation of the activity, adhesion, hardness and size of the lump.