575 results about "Metabolic disorder" patented technology

The invention discloses a polypeptide or a pharmaceutically acceptable salt thereof. The polypeptide has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence in a conservative modification form thereof. The polypeptide or the pharmaceutically acceptable salt thereof disclosed by the invention can be combined with GLP1R and is used for effectively activating the GLP1R. The GLP1R activating polypeptide is obtained through precise calculation and deep learning model optimization, has a short sequence, has unique amino acid arrangement compared with a traditional GLP-1 analogue, can effectively activate a GLP1R receptor, can also be used for treating or preventing metabolic disorder related diseases, and has a good application prospect. For example, obesity, diabetes, dyslipidemia related diseases, fatty liver diseases, metabolic syndromes, non-alcoholic fatty liver diseases and the like.

The present invention relates to modulators that can regulate, for example, inhibit the expression and / or activity of an inhibin subunit βE (INHBE), such as double-stranded RNA (dsRNA) active agents or antisense polynucleotide formulations. The present invention also relates to a method for inhibiting the expression and / or activity of INHBE by using such modulators, and a method for preventing and treating INHBE-related diseases in subjects (such as metabolic disorders or obesity or cardiovascular diseases, such as metabolic syndrome).

The invention belongs to the technical field of traditional Chinese medicines, and relates to a traditional Chinese medicine composition for improving obesity and metabolic syndrome and a preparation method thereof. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 15 to 28 parts of radix astragali seu hedysari, 8 to 20 parts of radix codonopsis, 20 to 35 parts of rhizoma dioscoreae, 8 to 24 parts of semen lablab album, 6 to 20 parts of rhizoma atractylodis macrocephalae stir-fried with bran, 20 to 35 parts of raw semen coicis, 3 to 10 parts of rhizoma pinelliae preparata, 6 to 15 parts of pericarpium citri reticulatae, 10 to 20 parts of poria cocos, 6 to 15 parts of rhizoma alismatis, 6 to 15 parts of raw liquorice root, 10 to 20 parts of semen hoveniae, 10 to 20 parts of lotus leaf and 8 to 15 parts of raw fructus crataegi. The composition has the effects of invigorating spleen, replenishing qi, resolving dampness and removing turbidity, can effectively control the weight gain of obese patients and improve the metabolic disorder condition of metabolic syndrome, is safe, effective and stable, has small side effects, and has very good research and development values.

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine composition for improving cognition, emotion, memory and depression states and a preparation method and application thereof. The traditional Chinese medicine composition is prepared from the following components in parts by mass: radix scutellariae, rhizoma coptidis, radix puerariae, rhizoma anemarrhenae, bitter gourd, rhizoma zingiberis, stiff silkworm, American ginseng and radix notoginseng. Wherein the radix scutellariae and the rhizoma coptidis are monarch drugs and mainly attack the core pathogenesis; the radix puerariae, the rhizoma anemarrhenae and the pseudo-ginseng serve as ministerial drugs, assist monarch drugs and treat secondary pathogenesis; bitter gourd, rhizoma zingiberis, stiff silkworm and American ginseng are used as adjuvant drugs to regulate drug properties and treat and treat both symptoms and root causes; and radix puerariae and pseudo-ginseng are used as conductant drugs for guiding channels or harmonizing the drugs. The traditional Chinese medicine composition disclosed by the invention can be used for preventing and treating cognitive disorder, mood disorder and depressive state caused by metabolic disorder. The traditional Chinese medicine composition is small in side effect, high in individuation and suitable for being taken for a long time, and has an obvious treatment effect.

The present invention provides an isolated Akkermansia muciniphila strain, composition comprising the same, and use thereof, which can be used for treating, preventing, or alleviating obesity, metabolic disorders induced by obesity, diabetes, inflammation, liver and kidney diseases, liver diseases, cardiovascular and cerebrovascular diseases, brain aging, tumors, etc. Additionally, it can be used for preventing and treating metabolic disorders after discontinuation of GLP-1 receptor agonist drugs, preventing weight rebound and blood glucose rebound, and maintaining glucose homeostasis.

The invention discloses an endogenous small molecule metabolite for treating obesity and related metabolic diseases thereof, and belongs to the field of biological medicine. Specifically, the invention relates to application of hippuric acid in preparation of anti-obesity drugs. The invention discloses a technical scheme for treating obesity and related metabolic disorders by hippuric acid, and overcomes the defects of single curative effect, larger side effect or unclear action mechanism and the like in the prior art through the advantages of targeted improvement of liver fatty degeneration, improvement of insulin sensitivity, higher potential safety, provision of a new treatment strategy and the like. The method has remarkable technical progress and clinical application value.

The invention belongs to the field of biotechnology and nutritional medicine, relates to a maternal obesity intervention preparation, and particularly relates to a preparation method of a plant embryo fermentation product and application of the plant embryo fermentation product in blocking of trans-generation delivery metabolic diseases. FWG is prepared through a probiotic fermentation technology, obesity, glucose and lipid metabolism disorder and oxidative stress induced by high-fat diet of a parent body can be remarkably improved, and cross-generation transmission of metabolic diseases is blocked by adjusting composition of intestinal flora of the parent body and offspring and a hypothalamic PI3K-Akt signal channel. The invention reveals that maternal FWG intervention passes through a mechanism that a PI3K-Akt pathway is dominated and multiple pathways are coordinated on the transcriptome level for the first time, the HFD-induced offspring hypothalamus metabolism programming abnormality is reversed, and a new central regulation target is provided for cross-generation metabolic disease prevention. The FWG is a wheat processing byproduct, is free of chemical additives, is suitable for long-term dietary supplement, is a natural and safe nutrition intervention scheme, and is suitable for the field of maternal and infant health.

The present invention relates to a D-galactopyranose compound of formula (1)whereinthe pyranose ring is α-D-galactopyranose, and these compounds are high affinity galectin-1 and / or galectin 3 inhibitors for use in treatment of inflammation; fibrosis; scarring; keloid formation; aberrant scar formation; surgical adhesions; septic shock; cancer; metastasising cancers; autoimmune diseases, metabolic disorders; heart disease; heart failure; pathological angiogenesis; eye diseases; atherosclerosis; metabolic diseases; diabetes type I; diabetes type II; insulin resistance; Diastolic heart failure; asthma; liver disorders.

The invention provides a liver-protecting probiotic composition and application thereof in prevention or treatment of acute liver injury, and belongs to the technical field of microorganisms and medicines. The invention provides lactobacillus crispatus LJ003, and the preservation number of the lactobacillus crispatus LJ003 is CGMCC (China General Microbiological Culture Collection Center) No.30723. The invention further provides a method for preparing fermented globe artichoke leaf powder, polyphenol and chlorogenic acid by using the lactobacillus crispatus LJ003, and the fermented globe artichoke leaf powder prepared by using the lactobacillus crispatus LJ003. The prepared fermented globe artichoke leaf powder can be used for preparing the liver protection probiotic composition, and the obtained liver protection probiotic composition has a good protection effect on liver cells, can effectively improve liver cell lipid metabolism disorder caused by excessive ethanol intake, and has a remarkable effect on preventing or treating acute liver injury.

The present invention relates to the use of selective aquaporin inhibitors, e.g., of aquaporin-4 or aquaporin-2, e.g., certain phenylbenzamide compounds, for the prophylaxis, treatment and control of aquaporin-mediated conditions, e.g., diseases of water imbalance, for example edema (particularly edema of the brain and spinal cord, e.g., following trauma or ischemic stroke, as well as the edema associated with glioma, meningitis, acute mountain sickness, epileptic seizures, infections, metabolic disorders, hypoxia, water intoxication, hepatic failure, hepatic encephalopathy, diabetic ketoacidosis, abscess, eclampsia, Creutzfeldt-Jakob disease, and lupus cerebritis, as well as edema consequent to microgravity and / or radiation exposure, as well as edema consequent to invasive central nervous system procedures, e.g., neurosurgery, endovascular clot removal, spinal tap, aneurysm repair, or deep brain stimulation, as well as retinal edema), as well as hyponatremia and excess fluid retention, and diseases such as epilepsy, retinal ischemia and other diseases of the eye associated with abnormalities in intraocular pressure and / or tissue hydration, myocardial ischemia, myocardial ischemia / reperfusion injury, myocardial infarction, myocardial hypoxia, congestive heart failure, sepsis, and neuromyelitis optica, as well as migraines, as well as to novel assays for identifying aquaporin inhibitors.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention discloses a lactobacillus rhamnosus HX-4F3 strain and application thereof, and belongs to the technical field of biology. The lactobacillus rhamnosus HX-4F3 disclosed by the invention is preserved in the China Center for Type Culture Collection, and the preservation number of the lactobacillus rhamnosus HX-4F3 is CCTCC (China Center for Type Culture Collection) NO: M 20251454. The invention discloses an application of a strain HX-4F3 in preparation of drugs or food for lowering lipid or / and blood sugar. The invention also discloses application of the compound in preparation of functional food or / and medicines for preventing or / and treating metabolic diseases. The invention also discloses a composition for lowering lipid or / and blood sugar, which comprises a live bacterium of the strain HX-4F3 or freeze-dried powder, a spore preparation, a metabolic supernatant or an inactivated bacterium of the strain HX-4F3, and a pharmaceutically or food acceptable carrier. According to the lactobacillus rhamnosus HX-4F3 provided by the invention, the glucose and lipid metabolism disorder can be remarkably improved through a multiple synergistic mechanism, and the glucose and lipid metabolism disorder can be remarkably improved through the lactobacillus rhamnosus HX-4F3.

The present invention relates to Akkermansia muciniphila Akk11 having the functions of regulating blood glucose and blood fat and the use thereof. Said Akkermansia muciniphila Akk11 is classified and named as Akkermansia muciniphila Akk11 with the accession number of CCTCC NO: M2024119. The strain uses mucin as the unique source of carbon element and nitrogen element, so as to control the basic regulatory systems of glucose and energy metabolism, protect the integrity of intestinal epithelial cells and mucus layers to exert a protective effect on metabolism, regulate the levels of blood glucose and blood fat, and remarkably relieve symptoms of metabolic disorders, and thus providing strategies and reference basis for the prevention and treatment of obesity.

The invention relates to the field of metabolite detection, in particular to an endogenous metabolite detection device and method for metabolic disorder patients. The method comprises the following steps: segmenting a Raman spectrum curve of an endogenous metabolite of a patient to obtain a plurality of fluctuation segments and a reference baseline value of each fluctuation segment, screening out a normal fluctuation segment, and combining the reference baseline value of the normal fluctuation segment to obtain a normal baseline value of the Raman spectrum curve; adjusting each fluctuation section of the Raman spectrum curve according to the difference between the reference baseline value and the normal baseline value of each fluctuation section to obtain an adjusted spectrum curve, denoising the adjusted spectrum curve to obtain a final spectrum curve, and detecting the endogenous metabolites of the patient. According to the invention, the baseline drift phenomenon of the Raman spectrum curve of the endogenous metabolite of the patient can be eliminated, and the Raman spectrum data quality and the detection accuracy of the endogenous metabolite are improved.

The present disclosure provides compounds of Formula (I), (II), and (III). The provided compounds are able to bind protein kinases (e.g., SIK) and may be useful in modulating (e.g., inhibiting) the activity of a protein kinase (e.g., SIK, (e.g., SIK1, SIK2, or SIK3)) in a subject or cell. The provided compounds may be useful in treating or preventing a disease (e.g., proliferative disease, musculoskeletal disease, genetic disease, hematological disease, neurological disease, painful condition, psychiatric disorder, or metabolic disorder) in a subject in need thereof. Also provided are pharmaceutical compositions, kits, methods, and uses that include or involve a compound described herein.

The invention discloses bifidobacterium adolescentis for relieving estrogen-related metabolic disorder and obesity and application thereof, and belongs to the technical field of microorganisms. The bifidobacterium adolescentis CCFM1506 screened by the invention can effectively improve ovariectomized individual estrogen disorder symptoms, obviously slow down the weight increase speed and weight increment of estrogen disorder individuals, increase the expression quantity of serum estradiol, CYP11A1 and ERalpha in adrenal gland and the high-density lipoprotein content in serum, reduce the total cholesterol and glucose level and improve the ovariectomized ovariectomized ovariectomized ovariectomized ovariectomized ovariectomized ovariectomized ovariectomized ovariectomized abnormal glucose and lipid metabolism is adjusted; the invention has the advantages of simple preparation method and wide application prospect, can be used for preparing medicines for relieving or treating estrogen-related metabolic disorders and obesity, and can be used for preparing health-care products beneficial to controlling in-vivo fat and maintaining the health level of blood fat, and has obvious physiological effects and wide application prospects, and can be used for preparing the medicines for relieving or treating the estrogen-related metabolic disorders and obesity and preparing health-care products beneficial to controlling in-vivo fat and maintaining the health level of blood fat. A new thought and a new basis are provided for developing functional foods or medicines based on the probiotics.

The invention provides a lipid-lowering traditional Chinese medicine composition and extract as well as a preparation method and application thereof, and belongs to the technical field of traditional Chinese medicines. The lipid-lowering traditional Chinese medicine composition is prepared from the following raw materials: rhizoma cyperi and radix gentianae. The invention further provides an extract of the lipid-lowering traditional Chinese medicine composition. The extract is obtained by mixing rhizoma cyperi and radix gentianae and then co-extracting. The composition or the extract can be used for preparing medicines for preventing and / or treating hyperlipemia, and can be used for improving lipid metabolism disorder of liver cells and reducing the content of triglyceride and total cholesterol in the liver cells.

Provided are novel compounds for GIPR, GLP-1R and GCGR. Specifically, provided are GLP-1R / GIPR / GCGR triagonists peptides, and conjugates comprising an Fc fragment and GLP-1R / GIPR / GCGR triagonists peptides. Pharmaceutical compositions comprising these compounds,as well as uses thereof in treating metabolic conditions and disorders, such as diabetes mellitus, type 2 diabetes, obesity, metabolic dysfunction-associated fatty liver disease (MAFLD), non-alcoholic fatty liver disease (NAFLD), metabolic dysfunction-associated steatohepatitis (MASH), and non-alcoholic steatohepatitis (NASH) are also provided.

The invention relates to a compound of formula (I): where A is an optionally substituted heteroaryl; useful for treating disorders mediated by acyl coA-diacylglycerol acyl transferase 1 (DGAT1), e.g. metabolic disorders. The.invention also provides compositions comprising the compound for treating such disorders.

The present invention relates to a use of a novel triple activator, having activity on all of GLP-1, GIP, and glucagon receptors, for preventing or treating lipid metabolic diseases.

The invention discloses an application of COX4I2 in preparation of a non-small cell lung cancer medicine. Specifically, the invention also discloses an application of COX4I2 in preparation of a mitochondrial iron overload preparation and an application of a COX4I2 gene inhibitor in preparation of a preparation for promoting malignant progression of tumors. According to the invention, a COX4I2-VDAC1 interaction inhibitor is screened, a COX4I2 degradation agent or cluster-competitive peptide is developed, a brand new combined chemotherapy regimen is provided for solid tumors such as NSCLC and the like, and the polypeptide has the potential of expanding to cluster metabolic disorder diseases such as neurodegenerative diseases and diabetes mellitus.

The application discloses a use of a pharmaceutical composition of a phenolic acid compound and probiotics, and particularly relates to a combination of chlorogenic acid and lactobacillus reuteri. The combination of chlorogenic acid and lactobacillus reuteri can improve glycolipid metabolic disorder, improve cognitive dysfunction, emotional disorder and delay aging, and can be used for preparing a medicine for treating metabolic disorder combined with neuropsychiatric diseases.

Administration of pentadecanoylcarnitine or pentadecanoic acid is provided for prevention, management or treatment of aggression, allergies, allergic rhinitis, Alzheimer's disease, anxiety and anxiety disorders, amyotrophic lateral sclerosis, arthritis, asthma, atherosclerosis, attention-deficit hyperactivity disorder, bipoloar disorder, brain damage, cancer, cardiovascular disease, cholestatic pruritis, depression, chronic obstructive pulmonary disease (COPD), cocaine abuse, cough, dermatitis, depression, drug-seeking behavior, gastrointestinal disorders, facial erythema associated with rosacea, glaucoma, hepatic diseases, hyperactive bladder, hypersensitivity disorders, hypertension, impulsivity, inflammation, mental disorders and conditions, metabolic disorders, migraines, nasal and sinus congestion, nausea, neuropathic pain with and symptoms of multiple sclerosis, neurological and neuropsychiatric disorders, obesity, obsessive-compulsive disorders, opioid-induced respiratory depression, osteoarthritis, pain, Parkinson disease, pathological gambling, peptic ulcers, schizophrenia, sleep disorders, spinal cord injury, tardive dyskinesia, tics and behavioral problems with Tourette's syndrome; as well as for supporting appetite, cardiovascular health, hematologic health, memory, metabolic health, mood, prolonged REM sleep, renal health, sexuality, sociability and metabolic, hematological, renal, and weight loss.

The invention relates to a PCOS metabolic disorder diagnostic kit and application thereof, the PCOS metabolic disorder diagnostic kit is used for detecting unbalance of intestinal and fecal parabacteroides and branched chain amino acid, and if the intestinal and fecal parabacteroides is reduced and the branched chain amino acid is increased at the same time, the PCOS high risk is prompted. The PCOS metabolic disorder diagnostic kit is applied to clinical diagnosis of PCOS patients.

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, e.g., siRNAs, capable of inhibiting expression of the subunit beta E (INHBE) gene. Also disclosed are pharmaceutical compositions comprising the INHBE RNAi agents, and methods of use thereof. The INHBE RNAi agents disclosed herein can be conjugated to targeting ligands to facilitate delivery to cells, including to hepatocytes. Delivery of the INHBE RNAi agent in vivo results in inhibition of expression of the INHBE gene. RNAi agents may be used in methods of treating diseases, disorders, or conditions mediated in part by the expression of the INHBE gene, such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic diseases.

This disclosure relates to an oral pharmaceutical formulation comprising a compound of formula I or a pharmaceutically acceptable salt thereof. In formula JPEG2026528933000058.jpg30170, R, A, and n are as described herein. This disclosure also relates to the preparation processes thereof, as well as their use in the treatment of disorders such as cardiovascular and metabolic disorders, including diabetes.

The present disclosure relates to the use of therapeutic ultrasound to non-invasively stimulate multiple peripheral nerve pathways that modulate energy homeostasis. An embodiment of the disclosed neuromodulation techniques includes neuromodulation techniques to treat a patient with a metabolic disorder. Certain embodiments of the disclosure are discussed in the context of blood glucose regulation.

The invention relates to a compound for improving heat production and metabolic disorder of middle-aged and elderly people or obese individuals and application of the compound, in particular to application of betaine or an accelerant of the betaine, and particularly discloses application of the betaine or the accelerant of the betaine and application of the betaine or the accelerant of the betaine to preparation of a preparation or a pharmaceutical composition, and the preparation or the pharmaceutical composition is used for (a) adjusting heat production; and / or (b) ameliorating metabolic disorders. The betaine or the accelerant thereof can promote up-regulation of expression of heat-producing genes and / or expression of UCP1 in brown adipocytes, so that the body temperature is increased.

The present disclosure generally relates to the treatment of subjects having liver disease or metabolic disorder or at risk of developing liver disease or metabolic disorder by administering a Folliculin Interacting Protein 1 (FNIP1) inhibitor and / or a Folliculin (FLCN) inhibitor to the subject.

Disclosed are a heterocycloalkyl carboxylic acid derivative, an intermediate, a preparation method therefor, and a use thereof, relating to the technical field of pharmaceutical chemistry. The heterocycloalkyl carboxylic acid derivative of the present invention is a compound represented by formula (I) below, or a stereoisomer, geometric isomer, tautomer, N-oxide, hydrate, solvate, pharmaceutically acceptable salt or prodrug thereof. By means of in vitro activity detection and animal behavioral experiments, it has been proven that said compound has good therapeutic effects for neurological diseases such as depression and bipolar disorder, as well as metabolic diseases such as diabetes and metabolic disorders.