420 results about "Metabolic disorder" patented technology

The invention discloses a polypeptide or a pharmaceutically acceptable salt thereof. The polypeptide has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence in a conservative modification form thereof. The polypeptide or the pharmaceutically acceptable salt thereof disclosed by the invention can be combined with GLP1R and is used for effectively activating the GLP1R. The GLP1R activating polypeptide is obtained through precise calculation and deep learning model optimization, has a short sequence, has unique amino acid arrangement compared with a traditional GLP-1 analogue, can effectively activate a GLP1R receptor, can also be used for treating or preventing metabolic disorder related diseases, and has a good application prospect. For example, obesity, diabetes, dyslipidemia related diseases, fatty liver diseases, metabolic syndromes, non-alcoholic fatty liver diseases and the like.

The invention belongs to the technical field of traditional Chinese medicines, and relates to a traditional Chinese medicine composition for improving obesity and metabolic syndrome and a preparation method thereof. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 15 to 28 parts of radix astragali seu hedysari, 8 to 20 parts of radix codonopsis, 20 to 35 parts of rhizoma dioscoreae, 8 to 24 parts of semen lablab album, 6 to 20 parts of rhizoma atractylodis macrocephalae stir-fried with bran, 20 to 35 parts of raw semen coicis, 3 to 10 parts of rhizoma pinelliae preparata, 6 to 15 parts of pericarpium citri reticulatae, 10 to 20 parts of poria cocos, 6 to 15 parts of rhizoma alismatis, 6 to 15 parts of raw liquorice root, 10 to 20 parts of semen hoveniae, 10 to 20 parts of lotus leaf and 8 to 15 parts of raw fructus crataegi. The composition has the effects of invigorating spleen, replenishing qi, resolving dampness and removing turbidity, can effectively control the weight gain of obese patients and improve the metabolic disorder condition of metabolic syndrome, is safe, effective and stable, has small side effects, and has very good research and development values.

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine composition for improving cognition, emotion, memory and depression states and a preparation method and application thereof. The traditional Chinese medicine composition is prepared from the following components in parts by mass: radix scutellariae, rhizoma coptidis, radix puerariae, rhizoma anemarrhenae, bitter gourd, rhizoma zingiberis, stiff silkworm, American ginseng and radix notoginseng. Wherein the radix scutellariae and the rhizoma coptidis are monarch drugs and mainly attack the core pathogenesis; the radix puerariae, the rhizoma anemarrhenae and the pseudo-ginseng serve as ministerial drugs, assist monarch drugs and treat secondary pathogenesis; bitter gourd, rhizoma zingiberis, stiff silkworm and American ginseng are used as adjuvant drugs to regulate drug properties and treat and treat both symptoms and root causes; and radix puerariae and pseudo-ginseng are used as conductant drugs for guiding channels or harmonizing the drugs. The traditional Chinese medicine composition disclosed by the invention can be used for preventing and treating cognitive disorder, mood disorder and depressive state caused by metabolic disorder. The traditional Chinese medicine composition is small in side effect, high in individuation and suitable for being taken for a long time, and has an obvious treatment effect.

The present invention provides an isolated Akkermansia muciniphila strain, composition comprising the same, and use thereof, which can be used for treating, preventing, or alleviating obesity, metabolic disorders induced by obesity, diabetes, inflammation, liver and kidney diseases, liver diseases, cardiovascular and cerebrovascular diseases, brain aging, tumors, etc. Additionally, it can be used for preventing and treating metabolic disorders after discontinuation of GLP-1 receptor agonist drugs, preventing weight rebound and blood glucose rebound, and maintaining glucose homeostasis.

The invention belongs to the field of biotechnology and nutritional medicine, relates to a maternal obesity intervention preparation, and particularly relates to a preparation method of a plant embryo fermentation product and application of the plant embryo fermentation product in blocking of trans-generation delivery metabolic diseases. FWG is prepared through a probiotic fermentation technology, obesity, glucose and lipid metabolism disorder and oxidative stress induced by high-fat diet of a parent body can be remarkably improved, and cross-generation transmission of metabolic diseases is blocked by adjusting composition of intestinal flora of the parent body and offspring and a hypothalamic PI3K-Akt signal channel. The invention reveals that maternal FWG intervention passes through a mechanism that a PI3K-Akt pathway is dominated and multiple pathways are coordinated on the transcriptome level for the first time, the HFD-induced offspring hypothalamus metabolism programming abnormality is reversed, and a new central regulation target is provided for cross-generation metabolic disease prevention. The FWG is a wheat processing byproduct, is free of chemical additives, is suitable for long-term dietary supplement, is a natural and safe nutrition intervention scheme, and is suitable for the field of maternal and infant health.

The present invention relates to the use of selective aquaporin inhibitors, e.g., of aquaporin-4 or aquaporin-2, e.g., certain phenylbenzamide compounds, for the prophylaxis, treatment and control of aquaporin-mediated conditions, e.g., diseases of water imbalance, for example edema (particularly edema of the brain and spinal cord, e.g., following trauma or ischemic stroke, as well as the edema associated with glioma, meningitis, acute mountain sickness, epileptic seizures, infections, metabolic disorders, hypoxia, water intoxication, hepatic failure, hepatic encephalopathy, diabetic ketoacidosis, abscess, eclampsia, Creutzfeldt-Jakob disease, and lupus cerebritis, as well as edema consequent to microgravity and / or radiation exposure, as well as edema consequent to invasive central nervous system procedures, e.g., neurosurgery, endovascular clot removal, spinal tap, aneurysm repair, or deep brain stimulation, as well as retinal edema), as well as hyponatremia and excess fluid retention, and diseases such as epilepsy, retinal ischemia and other diseases of the eye associated with abnormalities in intraocular pressure and / or tissue hydration, myocardial ischemia, myocardial ischemia / reperfusion injury, myocardial infarction, myocardial hypoxia, congestive heart failure, sepsis, and neuromyelitis optica, as well as migraines, as well as to novel assays for identifying aquaporin inhibitors.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The present disclosure provides compounds of Formula (I), (II), and (III). The provided compounds are able to bind protein kinases (e.g., SIK) and may be useful in modulating (e.g., inhibiting) the activity of a protein kinase (e.g., SIK, (e.g., SIK1, SIK2, or SIK3)) in a subject or cell. The provided compounds may be useful in treating or preventing a disease (e.g., proliferative disease, musculoskeletal disease, genetic disease, hematological disease, neurological disease, painful condition, psychiatric disorder, or metabolic disorder) in a subject in need thereof. Also provided are pharmaceutical compositions, kits, methods, and uses that include or involve a compound described herein.

The invention provides a lipid-lowering traditional Chinese medicine composition and extract as well as a preparation method and application thereof, and belongs to the technical field of traditional Chinese medicines. The lipid-lowering traditional Chinese medicine composition is prepared from the following raw materials: rhizoma cyperi and radix gentianae. The invention further provides an extract of the lipid-lowering traditional Chinese medicine composition. The extract is obtained by mixing rhizoma cyperi and radix gentianae and then co-extracting. The composition or the extract can be used for preparing medicines for preventing and / or treating hyperlipemia, and can be used for improving lipid metabolism disorder of liver cells and reducing the content of triglyceride and total cholesterol in the liver cells.

Provided are novel compounds for GIPR, GLP-1R and GCGR. Specifically, provided are GLP-1R / GIPR / GCGR triagonists peptides, and conjugates comprising an Fc fragment and GLP-1R / GIPR / GCGR triagonists peptides. Pharmaceutical compositions comprising these compounds,as well as uses thereof in treating metabolic conditions and disorders, such as diabetes mellitus, type 2 diabetes, obesity, metabolic dysfunction-associated fatty liver disease (MAFLD), non-alcoholic fatty liver disease (NAFLD), metabolic dysfunction-associated steatohepatitis (MASH), and non-alcoholic steatohepatitis (NASH) are also provided.

The invention relates to a compound of formula (I): where A is an optionally substituted heteroaryl; useful for treating disorders mediated by acyl coA-diacylglycerol acyl transferase 1 (DGAT1), e.g. metabolic disorders. The.invention also provides compositions comprising the compound for treating such disorders.

The invention discloses an application of COX4I2 in preparation of a non-small cell lung cancer medicine. Specifically, the invention also discloses an application of COX4I2 in preparation of a mitochondrial iron overload preparation and an application of a COX4I2 gene inhibitor in preparation of a preparation for promoting malignant progression of tumors. According to the invention, a COX4I2-VDAC1 interaction inhibitor is screened, a COX4I2 degradation agent or cluster-competitive peptide is developed, a brand new combined chemotherapy regimen is provided for solid tumors such as NSCLC and the like, and the polypeptide has the potential of expanding to cluster metabolic disorder diseases such as neurodegenerative diseases and diabetes mellitus.

The application discloses a use of a pharmaceutical composition of a phenolic acid compound and probiotics, and particularly relates to a combination of chlorogenic acid and lactobacillus reuteri. The combination of chlorogenic acid and lactobacillus reuteri can improve glycolipid metabolic disorder, improve cognitive dysfunction, emotional disorder and delay aging, and can be used for preparing a medicine for treating metabolic disorder combined with neuropsychiatric diseases.

Administration of pentadecanoylcarnitine or pentadecanoic acid is provided for prevention, management or treatment of aggression, allergies, allergic rhinitis, Alzheimer's disease, anxiety and anxiety disorders, amyotrophic lateral sclerosis, arthritis, asthma, atherosclerosis, attention-deficit hyperactivity disorder, bipoloar disorder, brain damage, cancer, cardiovascular disease, cholestatic pruritis, depression, chronic obstructive pulmonary disease (COPD), cocaine abuse, cough, dermatitis, depression, drug-seeking behavior, gastrointestinal disorders, facial erythema associated with rosacea, glaucoma, hepatic diseases, hyperactive bladder, hypersensitivity disorders, hypertension, impulsivity, inflammation, mental disorders and conditions, metabolic disorders, migraines, nasal and sinus congestion, nausea, neuropathic pain with and symptoms of multiple sclerosis, neurological and neuropsychiatric disorders, obesity, obsessive-compulsive disorders, opioid-induced respiratory depression, osteoarthritis, pain, Parkinson disease, pathological gambling, peptic ulcers, schizophrenia, sleep disorders, spinal cord injury, tardive dyskinesia, tics and behavioral problems with Tourette's syndrome; as well as for supporting appetite, cardiovascular health, hematologic health, memory, metabolic health, mood, prolonged REM sleep, renal health, sexuality, sociability and metabolic, hematological, renal, and weight loss.

The invention relates to a PCOS metabolic disorder diagnostic kit and application thereof, the PCOS metabolic disorder diagnostic kit is used for detecting unbalance of intestinal and fecal parabacteroides and branched chain amino acid, and if the intestinal and fecal parabacteroides is reduced and the branched chain amino acid is increased at the same time, the PCOS high risk is prompted. The PCOS metabolic disorder diagnostic kit is applied to clinical diagnosis of PCOS patients.

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, e.g., siRNAs, capable of inhibiting expression of the subunit beta E (INHBE) gene. Also disclosed are pharmaceutical compositions comprising the INHBE RNAi agents, and methods of use thereof. The INHBE RNAi agents disclosed herein can be conjugated to targeting ligands to facilitate delivery to cells, including to hepatocytes. Delivery of the INHBE RNAi agent in vivo results in inhibition of expression of the INHBE gene. RNAi agents may be used in methods of treating diseases, disorders, or conditions mediated in part by the expression of the INHBE gene, such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic diseases.

This disclosure relates to an oral pharmaceutical formulation comprising a compound of formula I or a pharmaceutically acceptable salt thereof. In formula JPEG2026528933000058.jpg30170, R, A, and n are as described herein. This disclosure also relates to the preparation processes thereof, as well as their use in the treatment of disorders such as cardiovascular and metabolic disorders, including diabetes.

The present disclosure relates to the use of therapeutic ultrasound to non-invasively stimulate multiple peripheral nerve pathways that modulate energy homeostasis. An embodiment of the disclosed neuromodulation techniques includes neuromodulation techniques to treat a patient with a metabolic disorder. Certain embodiments of the disclosure are discussed in the context of blood glucose regulation.

The present disclosure generally relates to the treatment of subjects having liver disease or metabolic disorder or at risk of developing liver disease or metabolic disorder by administering a Folliculin Interacting Protein 1 (FNIP1) inhibitor and / or a Folliculin (FLCN) inhibitor to the subject.

Described are combinations of copper(II) and elesclomol useful in treatment methods for conditions associated with copper dysregulation.

A method of treating a metabolic disorder includes identifying a subject having a metabolic disorder and administering to the subject a therapeutically effective amount of GM201, wherein the therapeutically effective amount is between 0.1 mg / kg and 500 mg / kg with respect to a body weight of the subject.

The present invention relates to certain SGLT-2 inhibitors for treating and / or preventing metabolic disorders, such as type 1 or type 2 diabetes mellitus or pre-diabetes, in patients with renal impairment or chronic kidney disease (CKD).

The present disclosure is directed to compositions comprising between 50% and 95% weight per weight (w / w) of acetic acid, between 0.1% and 5% (w / w) of butyric acid or a derivative thereof, and between 0.1% and 5% (w / w) of Quercetin or a derivative thereof. Further, methods of use such as for the treatment and prevention of a medical condition associated with cancer, inflammatory diseases or disorders, metabolic disorders, obesity, diabetes, high blood pressure, vascular diseases, viral infection, and any combination thereof, in a subject in need thereof are also provided.

This invention relates to compositions containing acetic acid, butyric acid, and quercetin, and to the use thereof. This disclosure relates to a composition comprising, by weight, 50% to 95% (w / w) acetic acid, 0.1% to 5% (w / w) butyric acid or its derivatives, and 0.1% to 5% (w / w) quercetin or its derivatives. Furthermore, methods for use in the treatment and prevention of medical conditions associated with cancer, inflammatory diseases or disorders, metabolic disorders, obesity, diabetes, hypertension, vascular diseases, viral infections, and any combination thereof, and for use in subjects in need thereof.

The present invention relates to the prevention and / or treatment of metabolic disorders such as overweight and obesity, and complications associated therewith. More specifically, the present invention relates to the bacterium Turicimonas muris or a fragment thereof for preventing and / or treating metabolic disorders and complications associated therewith.

The invention discloses application of isobutyrate in construction of a heart failure cell model, and relates to the technical field of biology. By innovatively applying isobutyric acid or isobutyrate, a new heart failure cell model is constructed. The model treats myocardial cells by means of isobutyrate with the concentration of 0.5-5 mM, the heart failure phenotype can be efficiently induced, the effect of the concentration of 5 mM is optimal, expression of core heart failure marker genes such as Nppa, Nppb and Myh7 can be stably up-regulated, meanwhile, the area of the myocardial cells is remarkably increased, and the heart failure pathological characteristics are met. Compared with a traditional angiotensin II and other neurohormone induction model, the invention provides a non-neurohormone-dependent brand-new heart failure cell model construction path, focuses on metabolic disorder related heart failure inducements, makes up for the defect of single mechanism of the existing model, and provides a new heart failure cell model construction path. A unique tool is provided for researching myocardial damage caused by abnormal metabolism or intestinal flora metabolites.

The present invention pertains to a) beta-lactoglobulin or b) a nutritional composition comprising beta-lactoglobulin for use in preventing and / or treating a metabolic disorder and / or muscle atrophy. It also pertains to a method of preventing and / or treating a metabolic disorder and / or muscle atrophy in a subject. It furthermore pertains to use of a) beta-lactoglobulin or b) a nutritional composition comprising beta-lactoglobulin for increasing the level of insulin and / or glucagon in the blood of a subject and the present invention also pertains to a non-therapeutic use or method of a) beta-lactoglobulin or b) a nutritional composition comprising BLG. It also pertains to beta-lactoglobulin (BLG) for use in preventing and / or treating diabetes or prediabetes in a subject. It furthermore pertains to a nutritional composition for use in preventing and / or treating diabetes or prediabetes in a subject.

The invention relates to the technical field of formula foods for special medical purposes, in particular to a metabolic disorder amino acid component formula food and a preparation method thereof, and the metabolic disorder amino acid component formula food comprises at least two monomer amino acid raw materials; the preparation method comprises the following steps: 1) cleaning production equipment to be used, and performing protein residue verification on the cleaned production equipment; 2) sterilizing each monomer amino acid raw material; 3) controlling the particle size of each monomer amino acid raw material; and 4) mixing the monomer amino acid raw materials treated in the step 2) and the step 3). Production equipment is cleaned and verified to ensure that the product does not contain limited amino acids; the amino acid component formula food prepared by the method disclosed by the invention can reduce the gravity settling phenomenon caused by the existence of coarse powder or the adsorption agglomeration phenomenon caused by the existence of more fine powder in the use or transportation process.

The invention discloses a probiotic agent for relieving prediabetic action and application thereof, and belongs to the technical field of microorganisms. Experiments prove that bifidobacterium longum CCFM1113 and bifidobacterium adolescentis CCFM1386 composite probiotics can relieve the prediabetic stage, which is specifically embodied in reducing weight gain of mice in the prediabetic stage, regulating blood sugar metabolism, improving sugar tolerance and insulin resistance, protecting liver and pancreas tissues, being beneficial to increasing the diversity of intestinal flora, recovering the structure of the intestinal flora, and improving the immunity of the mice in the prediabetic stage. The invention also provides a preparation method of the bifidobacterium longum CCFM1113 and bifidobacterium adolescentis CCFM1386 composite probiotics. The bifidobacterium longum CCFM1113 and bifidobacterium adolescentis CCFM1386 composite probiotics. And the growth of beneficial bacteria related to metabolic disorder is enriched and regulated. The invention provides an important basis for developing a dietary formula suitable for prediabetic patients, and provides a new method for prevention and management of diabetes mellitus.