190 results about "Adipocyte" patented technology

The invention belongs to the technical field of biomedical tissue engineering materials, and particularly relates to injectable composite plastic gel and a preparation method thereof. The injectable plastic gel provided by the invention is formed by suspending and compounding the cross-linked sodium hyaluronate gel particles and the biological tissue extracellular matrix particles, the two material particles in the injectable composite plastic gel are uniform in size and controllable in size, other toxic catalysts do not need to be added in the preparation process, and the injectable plastic gel is easy to prepare. The collagen / elastin composite material is rich in collagen and elastin, and shows good biomechanical properties. Meanwhile, the composite plastic gel contains a plurality of bioactive factors, and after the composite plastic gel is injected and filled into a body, the composite plastic gel is slowly degraded and can promote the generation and ingrowth of autologous fat cells and microvessels, so that the balance of degradation and remodeling is achieved. The preparation method of the injectable plastic gel provided by the invention can be widely applied to the fields of plastic surgery, medical beauty and the like.

The invention discloses a culture medium and application thereof, and a method for in-vitro separation culture and adipogenic differentiation of precursor adipocytes in goat muscle, and relates to the technical field of cell culture, the culture medium comprises the following components: 8-12 [mu] g / mL of insulin, 8-12% by volume of fetal calf serum, 95-105 U / mL of penicillin, 95-105 [mu] g / mL of streptomycin and the like. On the basis of the prior art, a proper amount of liquiritin and pilocarpine are mainly added into a culture medium, and synergistic cooperation of the liquiritin and pilocarpine is found, so that the adipogenic differentiation capacity of cells such as mesenchymal stem cells and precursor adipocytes is remarkably improved, and the application range is wide. On the basis, the invention also provides a complete set of perfect in-vitro isolated culture and adipogenic differentiation method of the goat intramuscular precursor adipocytes, and a method and a way are provided for a series of researches developed through the goat primary intramuscular precursor adipocytes in the future.

The invention provides a method for producing cell culture meat through 3D scaffold-free co-culture of pseudosciaena crocea stem cell spheres, and belongs to the technical field of preparation of cell culture meat. A method for producing cell culture meat by 3D scaffold-free co-culture of pseudosciaena crocea stem cell spheres comprises the following steps: mixing and inoculating pseudosciaena crocea myoblasts and pseudosciaena crocea precursor adipocytes into a cell culture plate subjected to anti-adhesion treatment for proliferation culture, spontaneously gathering to form cell spheres, and carrying out differentiation culture to obtain the cell culture meat. According to the co-culture mode provided by the invention, high-efficiency myogenic differentiation and adipogenic differentiation of myoblasts and precursor adipocytes of the large yellow croakers can be realized through proliferation culture and differentiation culture, and an in-vivo microenvironment can be effectively simulated, so that cultured meat similar to a traditional meat product in texture and flavor is produced.

The invention discloses a chicken myoblast and chicken fat precursor cell co-culture synchronous differentiation method and application thereof, and belongs to the technical field of animal cell co-culture and differentiation. The method comprises the following steps: respectively carrying out in-vitro multiplication culture on chicken myoblasts and chicken fat precursor cells, carrying out mixed co-culture, inducing for at most two days by adopting horse serum with the volume percent of 0.5-2%, carrying out pre-differentiation, and continuously carrying out induced differentiation culture for at most one day by using an induced adipogenesis culture medium. According to the synchronous differentiation method for co-culture of the chicken myoblasts and the chicken fat precursor cells, a cell co-culture system is constructed, time sequence induced differentiation is achieved, and a final product with fat droplets distributed in the gaps of muscle bundles (the average distance is 20-50 microns) and capable of recarving natural chicken intermuscular fat textures is obtained. According to the method, the differentiation period is shortened to be within 3 days from 21 days (the efficiency is improved by 600%); the induction cost is reduced by 42.7%; the final product breaks through the sensory acceptance barrier through bionic structure recarving.

The embodiment of the invention provides a self-powered microneedle patch for repairing hypertrophic scars as well as a preparation method and application of the self-powered microneedle patch. The self-powered microneedle patch comprises: a friction nano-generator for generating a current; the conductive drug-loaded microneedle patch is connected with the friction nano-generator, and the friction nano-generator is connected with the conductive drug-loaded microneedle patch; the conductive drug-loaded microneedle patch comprises a conductive microneedle patch body and a crosslinked gelatin-crosslinked hyaluronic acid microneedle bearing Sb4. The surface of the conductive micro-needle patch is provided with a metal coating, and the conductive micro-needle patch is used for mediating current generated by the friction nano-generator and applying percutaneous electrical stimulation; the cross-linked gelatin-cross-linked hyaluronic acid microneedle is coated at the tip of the conductive microneedle patch. According to the self-powered microneedle patch provided by the embodiment of the invention, myofibroblasts of hypertrophic scars are transdifferentiated into adipocytes by providing percutaneous electrochemical stimulation, inflammatory factor release is inhibited, and a tissue microenvironment is remodeled, so that the hypertrophic scars are reversed, and skin repair and tissue regeneration are realized.

The application discloses a polypeptide composition for treating obesity and related metabolic diseases and application thereof. The polypeptide composition comprises polypeptide 1 and polypeptide 2, wherein the amino acid sequence of the polypeptide 1 is shown as SEQ ID NO. 1, can be specifically combined with the CD105 receptor on the surface of MSCs and the AdipoR1 receptor of adipocytes; the amino acid sequence of the polypeptide 2 is shown as SEQ ID NO. 2, can target adipose tissue and regulate glycolipid metabolism. The polypeptide composition is combined with fat-derived mesenchymal stem cells (MSCs) and applied to a high-fat-diet obese mouse model, and the results show that the composition has a significant synergistic effect in reducing body fat, improving the morphology of adipose tissue, regulating serum metabolic factors and inflammatory factors, and has no obvious organ toxicity. The application provides a new effective strategy and a safe and reliable pharmaceutical composition for treating obesity and related metabolic diseases.

The application relates to an image-based marrow component segmentation method and system, comprising the following steps: acquiring an original marrow biopsy digital image and preprocessing, obtaining a hematopoietic cell tissue and bone trabecula Mask mask image based on the preprocessed image; based on the original marrow biopsy digital image, sequentially performing color channel conversion, morphological open operation, isolated point elimination and hole filling to obtain a bone trabecula Mask mask image; based on the preprocessed image, obtaining a fat cell tissue Mask mask image according to the morphological characteristics of fat cells; and according to the obtained bone trabecula Mask mask image, the bone trabecula and hematopoietic cell tissue Mask mask image and the fat cell tissue Mask mask image, obtaining the area proportion of the bone trabecula, the hematopoietic cell tissue and the fat cell tissue in the original marrow biopsy digital image in each image.

The present invention relates to a method for producing adipocyte-derived dedifferentiated stem cells by using centrifugation. The method for producing adipose cell-derived dedifferentiated stem cells by using centrifugation, and adipose cell-derived dedifferentiated stem cells using same, according to one embodiment of the present invention, allow a production period to be significantly shorter than that of adipose cell-derived dedifferentiated stem cells produced using a conventional ceiling culture method, and thus can be effectively used in the field of autologous adipose-derived stem cell therapeutic agents.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The invention relates to an application of an amide substituted 2-oxopyridine compound. Specifically, a compound of formula (I), or a pharmaceutically acceptable salt, a solvate, an optically pure isomer, a stereoisomer or a mixture thereof, is used for preparing a medicine or a preparation, and the medicine or the preparation is used for one or more of the following applications: (a) a medicine for treating and / or preventing cachexia-related diseases, (b) a medicine for treating and / or preventing cachexia-related diseases, (c) a medicine for treating and / or preventing cachexia-related diseases, and (c) a medicine for treating and / or preventing cachexia-related diseases; (b) inhibiting the browning of fat cells; and / or (c) promoting the degradation of the PRDM16 protein; wherein the compound shown in the formula (I) has a structure shown in the specification,

The application relates to application of semaglutide in preparation of a medicine for treating or delaying ovarian aging, and through a natural aging mouse model, a cell aging model and transcriptome analysis, it is first proved that semaglutide can significantly increase the number of follicles and reduce the level of aging markers, and from a molecular level, it is revealed that the mechanism of realizing multi-target point delay of ovarian aging is that semaglutide realizes multi-target point delay of ovarian aging through regulating an adipocyte cytokine signal pathway, inhibiting excessive cell division and regulating an NF-kappa B signal pathway. As a marketed drug, semaglutide has clear safety, a long half-life and high patient compliance, and has a significant clinical conversion prospect. The application breaks through the limitation that existing hormone replacement therapy and assisted reproductive technology can only treat symptoms or solve the problem of fertility, provides a first drug intervention strategy which can fundamentally delay the process of follicle depletion, and fills the blank in the field of ovarian aging treatment.

The invention provides a method for detecting insulin sensitivity, which comprises the following steps: (1) transfecting a cell to be detected by using a GLUT4myc cDNA plasmid: transfecting the cell to be detected by using the GLUT4myc cDNA plasmid, so that the cell stably expresses GLUT4myc; (2) measuring the endocytosis rate of the GLUT4myc: performing endocytosis stimulation to enable the GLUT4myc combined with the anti-myc antibody to be endocytosed, and regularly detecting the amount of the GLUT4myc combined with the anti-myc antibody remained on the surface of the cell; (3) measuring the GLUT4myc exocytosis rate: performing exocytosis stimulation to enable the GLUT4myc combined with the anti-myc antibody in the cell to exocytosis, and regularly detecting the translocation amount of the GLUT4myc combined with the anti-myc antibody in the cell to the surface of the cell; (4) calculating the difference value between the GLUT4myc exocytosis rate and the GLUT4myc endocytosis rate, and calculating the insulin sensitivity according to the difference value; the insulin sensitivity evaluation method has the beneficial effects that the insulin sensitivity is evaluated by detecting the exocytosis and endocytosis rates of fat cells, muscle cells or peripheral blood lymphocytes GLUT4, so that early-stage diabetic patients can be identified, and the pathogenesis of diabetes mellitus can be researched.

The application discloses a norchizhiol triterpenoid compound, a preparation method and application thereof. The norchizhiol triterpenoid compound norchizhiol A can be quickly prepared from Ganoderma lucidum. The test proves that the norchizhiol A can inhibit the accumulation of triglyceride in the differentiation process of 3T3L1 preadipocytes. The norchizhiol A can also effectively reduce the weight increase and liver coefficient of high-fat-diet-induced obese mice, regulate the blood lipid level of the obese mice, and significantly intervene and improve the lipoprotein distribution of the body. The compound can be used for preparing anti-obesity and lipid-lowering medicines.

Phytol (PHY) is a metabolite of plant chlorophyll, is wide in source and is a chain-like diterpenoid substance consisting of four isoprene units, and the phytol ingested by animals is subjected to oxidative metabolism in vivo, so that not only can energy be provided for the animals, but also the growth of the animals can be promoted, and the growth of the animals can be promoted. Moreover, the phytol and the phytanic acid metabolite of the phytol can also be used as signal molecules to participate in glycolipid metabolism and adipocyte differentiation regulation processes, but people cannot directly take the phytol and the phytanic acid from the nature. The effect of phytol in the generation and development of tumors still has huge unknown property. According to the research, the influence of the phytol and the derivative thereof on the growth of colon cancer, breast cancer and melanoma is detected through an in-vitro experiment CCK-8 (Cell Count Kit 8) and an in-vivo experiment such as a mouse subcutaneous tumor model, and the phytol and the derivative thereof are found to be capable of remarkably inhibiting the growth of colon cancer, breast cancer and melanoma and have no obvious toxic and side effects on heart, liver and kidney functions.

Various methods for isolating cell populations from adipocyte tissue and / or blood and quantifying levels of vascular endothelial growth factor receptors (VEGFR) on the isolated cell populations are provided. Also provided are methods of evaluating or modifying angiogenic therapy in a subject.

The invention aims to provide a peptide for accelerating fat metabolism and application thereof, the peptide is prepared into a product convenient to use, and the amino acid sequence of the peptide is MVHSYSETSD. The peptide is obtained through peptide library screening, bioinformatics analysis screening and fat cell decomposition experiment verification, and it is verified that the active peptide obtained through screening has the effects of accelerating fat metabolism, inhibiting fat accumulation, reducing blood fat and body fat content and reducing body weight; the insulin sensitivity and the glucose tolerance are improved, and the prevention and treatment effects on obesity and complications thereof are realized.

The invention belongs to the technical field of artificial meat tissue engineering, and particularly relates to a spiral composite hydrogel scaffold as well as a preparation method and application thereof. The spiral composite hydrogel scaffold provided by the invention adopts a bionic microstructure design, and can simulate fiber arrangement and a multi-scale hierarchical structure of natural beef tissues, so that ordered distribution of muscle cells and fat cells is guided in a microscopic space. By optimizing hydrogel components and a cross-linking mode, the mechanical strength and the elasticity of the stent are controllable in a relatively large range. A three-dimensional culture environment constructed by using the scaffold can promote differentiation and synchronous maturation of beef related muscle cells and fat cells, the time of a texturization process is greatly shortened, and the fibrosis degree and marbling effect of artificial meat are improved. Compared with a traditional two-dimensional culture method or a single scaffold method, the method can efficiently obtain textured artificial meat with a bionic structure and a texture close to that of natural beef, and is suitable for the fields of artificial meat manufacturing, functional food development, tissue engineering and the like.

The application aims to provide a peptide for accelerating fat metabolism and application thereof, and to prepare the peptide into a product convenient to use, and the amino acid sequence of the peptide is MVHSYSETSD. The peptide is obtained through screening of a peptide library, screening through bioinformatics analysis, and verification through fat cell decomposition experiment, and the application verifies that the active peptide screened has the effect of accelerating fat metabolism, inhibiting fat accumulation, reducing blood fat and body fat content, reducing body weight, improving insulin sensitivity and glucose tolerance, and realizing the prevention and treatment effect on obesity and its complications.

Disclosed herein are compounds comprising lipid PK / PD modulators for in vivo delivery of oligonucleotide-based agents (e.g., double-stranded RNAi agents or antisense oligonucleotides) to certain tissues (e.g., adipose tissue) or cell types (e.g., adipocytes). The PK / PD modulators disclosed herein, when conjugated to oligonucleotide-based therapeutic or diagnostic agents, such as RNAi agents, can enhance in vivo delivery of the composition to adipocytes to facilitate inhibition of gene expression in those cells.

This disclosure describes hardware for microfluidic chips and an associated support module for facilitating operation of one or more microfluidic chips. The microfluidic chips described herein are designed for supporting multiple different tissue types, including kidney tissue, liver tissue, adipose cells, and so forth. Chip geometry facilities fluid flow through one or more channels of the chip with a particular flow rate. For example, shear forces are reduced where needed to ensure proper flow rate of fluid in the channels. The chamber geometry and the geometry of the channels ensures that a desired amount of oxygen is delivered to sample cells or tissues in a controlled manner.

The invention discloses a metal organic framework material targeting bone marrow fat cells as well as a preparation method and application of the metal organic framework material, and belongs to the technical field of biomedical materials and tissue engineering. The material comprises: (1) a ZIF-8 core structure used for loading nucleic acid / small molecule drugs; (2) surface modification of lipid droplet targeting peptide: the lipid droplet targeting peptide is combined with a PEDF receptor to realize precise targeting; and (3) anti-miR-188 is loaded inside and is used for inhibiting adipogenic differentiation. The method at least has the following advantages: (1) a bone marrow adipocyte specific targeting MOF material is proposed for the first time, and bone metabolism intervention is converted from a mode of targeting osteoblast or macrophage to targeting adipocyte; (2) the MOF core can quickly respond to a marrow weak acid environment to realize accurate release; (3) the AdipoPep targeting peptide can obviously prolong the residence time of the bone marrow; and (4) adipogenic differentiation is significantly inhibited, osteogenesis microenvironment reconstruction is promoted, and an excellent bone mass recovery effect is shown in an osteoporosis model.

The invention discloses a construction method of a spontaneous lupus adipositis animal model, which comprises the following steps: constructing keratinocytes with genotypes of PPAR [gamma] flox / flox- / -Krt5-CreERT < 2 + > / -Adipoq-Cre < + > / -and PPAR [gamma] flox / flox- / -Krt5-CreERT < 2 + > / -Adipoq-CreERT < 2 + > / -and fat cells into a conditional PPAR [gamma]-active receptor gamma gene knockout mouse, so as to construct the animal model with the spontaneous lupus adipositis animal model. Then knocking out PPAR gamma genes in keratinocytes and adipocytes by using a gene knockout activator, so that the mice spontaneously have the phenotypes of lupus septicaemia, including local skin unhairing, lipoatrophy, persistent skin lesion, proteinuria and serum autoantibodies; histological examination finds that lobular adipositis, glomerular volume increase, mesangial cell hyperplasia, inflammatory cell infiltration, glomerular IgG deposition and the like are mainly caused by dermal immune cell infiltration and subcutaneous fat layer lymphocyte infiltration, clinical symptoms of patients with lupus adipositis are simulated, and an important tool is provided for related research of lupus adipositis.

The present invention relates to a method for producing neuronal cells from dedifferentiated adipocytes derived from a mammal, the method comprising a step for culturing dedifferentiated adipocytes derived from a mammal using a medium that contains a basic fibroblast growth factor (bFGF), retinoic acid, and a neuronal differentiation inducer, but does not substantially contain an epigenetic inhibitor.

Polynucleotide constructs are provided for adipocyte-specific production of cytotoxic proteins. Also provided are formulations and systems, including lipid-based delivery vectors, for delivering the polynucleotide constructs, and methods for making and using such nucleic acid-based polynucleotide constructs, formulations, and systems to reduce the proliferation and / or viability of adipocytes. The compositions, systems, and methods disclosed herein can be used to reduce adipocyte or fat volume in visceral, subcutaneous, and abdominal fat.

The invention relates to the technical field of biological medicine preparations, in particular to application of targeted nanoparticles in treatment of osteoporosis. The targeted nano-particles CL-NPs (at) NEs are developed, CL can stimulate lipolysis of bone marrow adipocytes, osteogenic differentiation is promoted, and therefore the bone marrow microenvironment is improved; meanwhile, autologous neutrophil is used as a carrier to transport CL-NPs, bone marrow fat cells beta3AR are accurately targeted, and the osteoporosis microenvironment can be further improved. Experiments prove that CL-NPs (at) NEs stimulate a bone marrow fat cell beta3 adrenoceptor in a targeted manner, can effectively improve OP, has safety and has the potential to become a novel medicine for osteoporosis.

The invention discloses an immortalized porcine fibroblast fat progenitor cell line as well as a construction method and application thereof, and belongs to the technical field of stem cell biology and cell engineering. Pig muscle is taken as a source, primary porcine fibroblast fat progenitor cells are obtained through separation and screening, pTERT and pCDK4 genes are overexpressed at the same time through a genetic engineering method, the cell line can break through the Harike limit, immortalization is achieved, the cell line is transferred to 43 generations at present, the cell is in a healthy and full long shuttle-shaped state, and the progenitor cells can be used as progenitor cells of the porcine fibroblast fat progenitor cells of the porcine fibroblast fat progenitor cells of the porcine fibroblast fat progenitor cells. Long-term in-vitro culture still has adipogenic differentiation capacity and can be used for preparing products such as cell culture meat.

The invention provides a safe and efficient animal skin biological degreasing method. The method is characterized in that esterase or protease with weak affinity to collagen and elastin and strong affinity to fat cell membranes is selected for synergistic effect, on the basis of not excessively damaging collagen and elastin, the permeation efficiency of lipase in animal skin and the full contact efficiency of lipase and grease are improved, and the catalytic effect of lipase is improved. And then through the synergistic effect of multiple lipases-alkalis, the hydrolysis rate of the grease is increased, and hydrolysates are effectively removed, so that efficient degreasing is realized. Through the technology, the grease content of the animal grease can be reduced to 2% or below, a petroleum-based surfactant is not used, and good energy-saving and emission-reducing effects are achieved. The method has important guiding significance for developing animal skin processing biotechnology and complex enzyme preparations.

The invention relates to an application of oligosporine in preparation of a weight-reducing medicine. The invention finds that the oligosporine B can reduce the weight of mammals. Moreover, the further research finds that the weight loss of mammals can be realized due to the fact that triglyceride in fat cells is hydrolyzed into free fatty acid and glycerol by mainly enhancing the activity of a key rate-limiting enzyme responsible for lipid metabolism in the fat cells so as to reduce the blood fat level and lipid accumulation in the fat cells, so that the weight loss of the mammals can be realized. Therefore, the weight loss is realized by reducing the adipose tissue mass.

The invention provides compound essential oil of bastardwood and application of the compound essential oil in preparation of products for preventing and treating hyperlipidemia, and relates to the technical field of traditional Chinese medicine essential oil. The traditional Chinese medicine compound essential oil is prepared from radix morindae officinalis essential oil, rhizoma coptidis essential oil and radix aucklandiae essential oil. The traditional Chinese medicine compound essential oil can significantly reduce the weight gain trend of a hyperlipidemia mouse model, reduce the weight of the mouse, effectively reduce the triglyceride, cholesterol and LDL level in serum and liver of the hyperlipidemia mouse model, improve the HDL level, significantly improve the hyperlipidemia symptom of the model mouse, and achieve the purpose of regulating lipid metabolism; meanwhile, liver fatty degeneration can be inhibited, the diameter of fat cells is reduced, and the traditional Chinese medicine compound essential oil has huge application potential in treatment or prevention of hyperlipidemia.

Disclosed is an artificial adipose tissue comprising a three-dimensional tissue comprising: a population of cells including an adipocyte; and a fragmented extracellular matrix.