288 results about "Adipocyte" patented technology

The invention discloses an application of an HERP gene knockout mouse model in obesity and metabolic disorder diseases. The invention finds that compared with a wild type high-fat group, HERP gene knockout can cause phenotypes such as early obesity, more serious obesity degree, increase of fat weight ratio, aggravation of adipose tissue inflammation, dyslipidemia and glucose metabolism disorder of mice during high-fat feeding. And the HERP gene is knocked out, so that the adipocyte differentiation is increased. The HERP gene knockout mouse is more sensitive to nutrition, obesity can occur more quickly during high-fat feeding, symptoms such as fat amplification, fat inflammation and glucose and lipid metabolism disorder are more serious, and the HERP gene knockout mouse can be used for molecular mechanism research and drug screening of obesity, fat tissue and glucose and lipid metabolism disorder. It is further found that cilostazol can significantly relieve mouse obesity and lipid metabolism disorder caused by HERP gene defects, but has no obvious weight losing effect on normal genotype mice, and a new strategy is provided for precise treatment.

The invention belongs to the technical field of biomedical tissue engineering materials, and particularly relates to injectable composite plastic gel and a preparation method thereof. The injectable plastic gel provided by the invention is formed by suspending and compounding the cross-linked sodium hyaluronate gel particles and the biological tissue extracellular matrix particles, the two material particles in the injectable composite plastic gel are uniform in size and controllable in size, other toxic catalysts do not need to be added in the preparation process, and the injectable plastic gel is easy to prepare. The collagen / elastin composite material is rich in collagen and elastin, and shows good biomechanical properties. Meanwhile, the composite plastic gel contains a plurality of bioactive factors, and after the composite plastic gel is injected and filled into a body, the composite plastic gel is slowly degraded and can promote the generation and ingrowth of autologous fat cells and microvessels, so that the balance of degradation and remodeling is achieved. The preparation method of the injectable plastic gel provided by the invention can be widely applied to the fields of plastic surgery, medical beauty and the like.

The invention discloses a culture medium and application thereof, and a method for in-vitro separation culture and adipogenic differentiation of precursor adipocytes in goat muscle, and relates to the technical field of cell culture, the culture medium comprises the following components: 8-12 [mu] g / mL of insulin, 8-12% by volume of fetal calf serum, 95-105 U / mL of penicillin, 95-105 [mu] g / mL of streptomycin and the like. On the basis of the prior art, a proper amount of liquiritin and pilocarpine are mainly added into a culture medium, and synergistic cooperation of the liquiritin and pilocarpine is found, so that the adipogenic differentiation capacity of cells such as mesenchymal stem cells and precursor adipocytes is remarkably improved, and the application range is wide. On the basis, the invention also provides a complete set of perfect in-vitro isolated culture and adipogenic differentiation method of the goat intramuscular precursor adipocytes, and a method and a way are provided for a series of researches developed through the goat primary intramuscular precursor adipocytes in the future.

The invention provides a method for producing cell culture meat through 3D scaffold-free co-culture of pseudosciaena crocea stem cell spheres, and belongs to the technical field of preparation of cell culture meat. A method for producing cell culture meat by 3D scaffold-free co-culture of pseudosciaena crocea stem cell spheres comprises the following steps: mixing and inoculating pseudosciaena crocea myoblasts and pseudosciaena crocea precursor adipocytes into a cell culture plate subjected to anti-adhesion treatment for proliferation culture, spontaneously gathering to form cell spheres, and carrying out differentiation culture to obtain the cell culture meat. According to the co-culture mode provided by the invention, high-efficiency myogenic differentiation and adipogenic differentiation of myoblasts and precursor adipocytes of the large yellow croakers can be realized through proliferation culture and differentiation culture, and an in-vivo microenvironment can be effectively simulated, so that cultured meat similar to a traditional meat product in texture and flavor is produced.

The present invention relates to pluripotent stem cell comprising an expression construct for expression of a Myo1B protein. The invention further provides for methods of producing adipocytes comprising the pluripotent stem cells and for foodstuff comprising the adipocytes or pluripotent stem cells.

The present application relates to use of Ligilactobacillus salivarius in preparing a drug for preventing and / or treating diseases associated with overweight and / or obesity . The strain can inhibit the weight growth of a high-fat diet-induced obesity model mouse, reduce the blood lipid level of the high-fat diet-induced obesity model mouse, improve the liver injury index of the high-fat diet-induced obesity model mouse, reduce the area of white adipose cells of the high-fat diet-induced obesity model mouse, improve the colon GLP-1 level of the high-fat diet-induced obesity model mouse, improve the intestinal flora imbalance of the high-fat diet-induced obesity model mouse, and improve the liver glycolipid metabolism of the high-fat diet-induced obesity model mouse; and reduce the waist circumference, hip circumference, body fat mass, BMI, and weight of overweight and overweight and / or obesity volunteers, and maintain the muscle content, promoting overweight and overweight and / or obesity people to carry out safe, effective, and sustainable weight management.

The invention discloses a chicken myoblast and chicken fat precursor cell co-culture synchronous differentiation method and application thereof, and belongs to the technical field of animal cell co-culture and differentiation. The method comprises the following steps: respectively carrying out in-vitro multiplication culture on chicken myoblasts and chicken fat precursor cells, carrying out mixed co-culture, inducing for at most two days by adopting horse serum with the volume percent of 0.5-2%, carrying out pre-differentiation, and continuously carrying out induced differentiation culture for at most one day by using an induced adipogenesis culture medium. According to the synchronous differentiation method for co-culture of the chicken myoblasts and the chicken fat precursor cells, a cell co-culture system is constructed, time sequence induced differentiation is achieved, and a final product with fat droplets distributed in the gaps of muscle bundles (the average distance is 20-50 microns) and capable of recarving natural chicken intermuscular fat textures is obtained. According to the method, the differentiation period is shortened to be within 3 days from 21 days (the efficiency is improved by 600%); the induction cost is reduced by 42.7%; the final product breaks through the sensory acceptance barrier through bionic structure recarving.

The embodiment of the invention provides a self-powered microneedle patch for repairing hypertrophic scars as well as a preparation method and application of the self-powered microneedle patch. The self-powered microneedle patch comprises: a friction nano-generator for generating a current; the conductive drug-loaded microneedle patch is connected with the friction nano-generator, and the friction nano-generator is connected with the conductive drug-loaded microneedle patch; the conductive drug-loaded microneedle patch comprises a conductive microneedle patch body and a crosslinked gelatin-crosslinked hyaluronic acid microneedle bearing Sb4. The surface of the conductive micro-needle patch is provided with a metal coating, and the conductive micro-needle patch is used for mediating current generated by the friction nano-generator and applying percutaneous electrical stimulation; the cross-linked gelatin-cross-linked hyaluronic acid microneedle is coated at the tip of the conductive microneedle patch. According to the self-powered microneedle patch provided by the embodiment of the invention, myofibroblasts of hypertrophic scars are transdifferentiated into adipocytes by providing percutaneous electrochemical stimulation, inflammatory factor release is inhibited, and a tissue microenvironment is remodeled, so that the hypertrophic scars are reversed, and skin repair and tissue regeneration are realized.

The invention provides an application of liquiritin in preparation of a PPAR gamma receptor partial agonist. Through a structure-based high-throughput virtual screening technology, it is found that liquiritin can be used as a partial agonist of a PPAR gamma receptor, and the relative activation efficiency of liquiritin is 35.9% of that of rosiglitazone; in-vitro experiments prove that liquiritin can remarkably promote glucose uptake and consumption of HepG2 cells and does not induce adipocyte differentiation; in-vivo experiments prove that liquiritin can effectively improve the blood glucose level of an insulin resistance mouse model induced by high fat diet and reduce the level of serum proinflammatory factors. Compared with thiazolidinedione compounds, liquiritin not only can relieve and treat insulin resistance or related metabolic diseases, but also does not cause adverse reactions such as weight gain, fat accumulation and myocardial hypertrophy, provides a new candidate compound for developing safe and effective anti-diabetic drugs, and has a wide application prospect.

The invention provides a fish precursor fat cell myogenic differentiation and pluripotent differentiation culture medium, a method for inducing myogenic differentiation and pluripotent differentiation and application, and particularly belongs to the technical field of cell biology. The differentiation culture medium for inducing the fish precursor fat cells to differentiate into the muscle cells comprises a myogenic differentiation culture medium and a differentiation maintenance culture medium. According to the myogenic differentiation culture medium, the large yellow croaker precursor fat cells can be induced to be differentiated towards muscle cells through the regulation and control effect of growth factors, and the differentiation maintaining culture medium can maintain myogenic differentiation and enhance the quality of myotubes; by combining the adipogenic differentiation culture medium, the directional pluripotent differentiation of the precursor adipocytes to different types of cells can be finally realized, and myotubes and adipocytes are efficiently formed. The preparation of the cell culture meat provides a new strategy and method.

The present invention provides a method of producing a population of mesenchymal stromal cells (MSC) of CD73 + CD44 +, CD90 +. The CD73 + CD44 +, CD90 + MSC is used in a method for producing terminally differentiated osteoblasts, adipoblasts and chondroblasts from pluripotent stem cells (PSCs). The differentiation methods include the use of a single agent-a WNT signaling pathway activator used on an adherent culture of PSC, such as a GSK3 [beta] inhibitor.

The application discloses a polypeptide composition for treating obesity and related metabolic diseases and application thereof. The polypeptide composition comprises polypeptide 1 and polypeptide 2, wherein the amino acid sequence of the polypeptide 1 is shown as SEQ ID NO. 1, can be specifically combined with the CD105 receptor on the surface of MSCs and the AdipoR1 receptor of adipocytes; the amino acid sequence of the polypeptide 2 is shown as SEQ ID NO. 2, can target adipose tissue and regulate glycolipid metabolism. The polypeptide composition is combined with fat-derived mesenchymal stem cells (MSCs) and applied to a high-fat-diet obese mouse model, and the results show that the composition has a significant synergistic effect in reducing body fat, improving the morphology of adipose tissue, regulating serum metabolic factors and inflammatory factors, and has no obvious organ toxicity. The application provides a new effective strategy and a safe and reliable pharmaceutical composition for treating obesity and related metabolic diseases.

The present disclosure provides, among other things, compounds, and compositions useful as inhibitors of adipocyte plasma membrane associated protein (APMAP). The presently provided compounds and compositions are useful in the treatment of diseases, disorders, and conditions associated with APMAP. In some embodiments, the present disclosure provides a compound represented by Formula I or a pharmaceutically acceptable salt thereof, wherein R1, A, B, X1, X2, X3, and Y are as described in classes and subclasses here, both singly and in combination.

A minimally invasive body sculpting system and method is provided using a numbing component, a helium plasma component, and an NIL component. An NIL cannula of the NIL component is insertable into the body to remove the fat cell via nutational movement thereof and suction there through. Skin tightening is achieved through the subcutaneous exposure of the skin to helium plasma.

The application relates to an image-based marrow component segmentation method and system, comprising the following steps: acquiring an original marrow biopsy digital image and preprocessing, obtaining a hematopoietic cell tissue and bone trabecula Mask mask image based on the preprocessed image; based on the original marrow biopsy digital image, sequentially performing color channel conversion, morphological open operation, isolated point elimination and hole filling to obtain a bone trabecula Mask mask image; based on the preprocessed image, obtaining a fat cell tissue Mask mask image according to the morphological characteristics of fat cells; and according to the obtained bone trabecula Mask mask image, the bone trabecula and hematopoietic cell tissue Mask mask image and the fat cell tissue Mask mask image, obtaining the area proportion of the bone trabecula, the hematopoietic cell tissue and the fat cell tissue in the original marrow biopsy digital image in each image.

The present invention relates to a method for producing adipocyte-derived dedifferentiated stem cells by using centrifugation. The method for producing adipose cell-derived dedifferentiated stem cells by using centrifugation, and adipose cell-derived dedifferentiated stem cells using same, according to one embodiment of the present invention, allow a production period to be significantly shorter than that of adipose cell-derived dedifferentiated stem cells produced using a conventional ceiling culture method, and thus can be effectively used in the field of autologous adipose-derived stem cell therapeutic agents.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The invention relates to an application of an amide substituted 2-oxopyridine compound. Specifically, a compound of formula (I), or a pharmaceutically acceptable salt, a solvate, an optically pure isomer, a stereoisomer or a mixture thereof, is used for preparing a medicine or a preparation, and the medicine or the preparation is used for one or more of the following applications: (a) a medicine for treating and / or preventing cachexia-related diseases, (b) a medicine for treating and / or preventing cachexia-related diseases, (c) a medicine for treating and / or preventing cachexia-related diseases, and (c) a medicine for treating and / or preventing cachexia-related diseases; (b) inhibiting the browning of fat cells; and / or (c) promoting the degradation of the PRDM16 protein; wherein the compound shown in the formula (I) has a structure shown in the specification,

The application relates to application of semaglutide in preparation of a medicine for treating or delaying ovarian aging, and through a natural aging mouse model, a cell aging model and transcriptome analysis, it is first proved that semaglutide can significantly increase the number of follicles and reduce the level of aging markers, and from a molecular level, it is revealed that the mechanism of realizing multi-target point delay of ovarian aging is that semaglutide realizes multi-target point delay of ovarian aging through regulating an adipocyte cytokine signal pathway, inhibiting excessive cell division and regulating an NF-kappa B signal pathway. As a marketed drug, semaglutide has clear safety, a long half-life and high patient compliance, and has a significant clinical conversion prospect. The application breaks through the limitation that existing hormone replacement therapy and assisted reproductive technology can only treat symptoms or solve the problem of fertility, provides a first drug intervention strategy which can fundamentally delay the process of follicle depletion, and fills the blank in the field of ovarian aging treatment.

The invention provides a method for detecting insulin sensitivity, which comprises the following steps: (1) transfecting a cell to be detected by using a GLUT4myc cDNA plasmid: transfecting the cell to be detected by using the GLUT4myc cDNA plasmid, so that the cell stably expresses GLUT4myc; (2) measuring the endocytosis rate of the GLUT4myc: performing endocytosis stimulation to enable the GLUT4myc combined with the anti-myc antibody to be endocytosed, and regularly detecting the amount of the GLUT4myc combined with the anti-myc antibody remained on the surface of the cell; (3) measuring the GLUT4myc exocytosis rate: performing exocytosis stimulation to enable the GLUT4myc combined with the anti-myc antibody in the cell to exocytosis, and regularly detecting the translocation amount of the GLUT4myc combined with the anti-myc antibody in the cell to the surface of the cell; (4) calculating the difference value between the GLUT4myc exocytosis rate and the GLUT4myc endocytosis rate, and calculating the insulin sensitivity according to the difference value; the insulin sensitivity evaluation method has the beneficial effects that the insulin sensitivity is evaluated by detecting the exocytosis and endocytosis rates of fat cells, muscle cells or peripheral blood lymphocytes GLUT4, so that early-stage diabetic patients can be identified, and the pathogenesis of diabetes mellitus can be researched.

The application discloses a norchizhiol triterpenoid compound, a preparation method and application thereof. The norchizhiol triterpenoid compound norchizhiol A can be quickly prepared from Ganoderma lucidum. The test proves that the norchizhiol A can inhibit the accumulation of triglyceride in the differentiation process of 3T3L1 preadipocytes. The norchizhiol A can also effectively reduce the weight increase and liver coefficient of high-fat-diet-induced obese mice, regulate the blood lipid level of the obese mice, and significantly intervene and improve the lipoprotein distribution of the body. The compound can be used for preparing anti-obesity and lipid-lowering medicines.

The invention relates to the technical field of medical equipment, in particular to an abdominal wall fat extraction device. An abdominal wall fat extraction device comprises a movable cart, a fixing plate, a mounting block and the like, the fixing plate is fixedly connected to the top of the movable cart, the mounting block is fixedly connected to the right rear side of the top of the fixing plate, a measuring cylinder is placed in the middle of the top of the mounting block, and a stand column is fixedly connected to the rear side of the top of the mounting block; a pressing disc is fixedly connected to the end of a telescopic rod of the electric push rod, and a rubber disc is fixedly connected to the bottom of the pressing disc. Automatic injection of swelling liquid is achieved through electric control, operation is more convenient, after liposuction is completed, instruments such as a liposuction tube can be backwashed in time, fat cells are prevented from being adhered to a hose a or a tube cavity a, the problems that an existing device is difficult to clean in time after suction, and follow-up cleaning difficulty is increased due to residual impurities are effectively solved, the operation efficiency is improved, and the operation cost is reduced. And the subsequent workload of medical staff is reduced.

Phytol (PHY) is a metabolite of plant chlorophyll, is wide in source and is a chain-like diterpenoid substance consisting of four isoprene units, and the phytol ingested by animals is subjected to oxidative metabolism in vivo, so that not only can energy be provided for the animals, but also the growth of the animals can be promoted, and the growth of the animals can be promoted. Moreover, the phytol and the phytanic acid metabolite of the phytol can also be used as signal molecules to participate in glycolipid metabolism and adipocyte differentiation regulation processes, but people cannot directly take the phytol and the phytanic acid from the nature. The effect of phytol in the generation and development of tumors still has huge unknown property. According to the research, the influence of the phytol and the derivative thereof on the growth of colon cancer, breast cancer and melanoma is detected through an in-vitro experiment CCK-8 (Cell Count Kit 8) and an in-vivo experiment such as a mouse subcutaneous tumor model, and the phytol and the derivative thereof are found to be capable of remarkably inhibiting the growth of colon cancer, breast cancer and melanoma and have no obvious toxic and side effects on heart, liver and kidney functions.

Various methods for isolating cell populations from adipocyte tissue and / or blood and quantifying levels of vascular endothelial growth factor receptors (VEGFR) on the isolated cell populations are provided. Also provided are methods of evaluating or modifying angiogenic therapy in a subject.

The invention aims to provide a peptide for accelerating fat metabolism and application thereof, the peptide is prepared into a product convenient to use, and the amino acid sequence of the peptide is MVHSYSETSD. The peptide is obtained through peptide library screening, bioinformatics analysis screening and fat cell decomposition experiment verification, and it is verified that the active peptide obtained through screening has the effects of accelerating fat metabolism, inhibiting fat accumulation, reducing blood fat and body fat content and reducing body weight; the insulin sensitivity and the glucose tolerance are improved, and the prevention and treatment effects on obesity and complications thereof are realized.

The invention belongs to the technical field of artificial meat tissue engineering, and particularly relates to a spiral composite hydrogel scaffold as well as a preparation method and application thereof. The spiral composite hydrogel scaffold provided by the invention adopts a bionic microstructure design, and can simulate fiber arrangement and a multi-scale hierarchical structure of natural beef tissues, so that ordered distribution of muscle cells and fat cells is guided in a microscopic space. By optimizing hydrogel components and a cross-linking mode, the mechanical strength and the elasticity of the stent are controllable in a relatively large range. A three-dimensional culture environment constructed by using the scaffold can promote differentiation and synchronous maturation of beef related muscle cells and fat cells, the time of a texturization process is greatly shortened, and the fibrosis degree and marbling effect of artificial meat are improved. Compared with a traditional two-dimensional culture method or a single scaffold method, the method can efficiently obtain textured artificial meat with a bionic structure and a texture close to that of natural beef, and is suitable for the fields of artificial meat manufacturing, functional food development, tissue engineering and the like.

The application aims to provide a peptide for accelerating fat metabolism and application thereof, and to prepare the peptide into a product convenient to use, and the amino acid sequence of the peptide is MVHSYSETSD. The peptide is obtained through screening of a peptide library, screening through bioinformatics analysis, and verification through fat cell decomposition experiment, and the application verifies that the active peptide screened has the effect of accelerating fat metabolism, inhibiting fat accumulation, reducing blood fat and body fat content, reducing body weight, improving insulin sensitivity and glucose tolerance, and realizing the prevention and treatment effect on obesity and its complications.

The invention discloses a lipid-lowering and weight-losing composition with homology of medicine and food as well as a preparation method and application thereof, and belongs to the technical field of traditional Chinese medicine compositions. The composition for reducing fat and losing weight comprises the following raw materials in parts by weight: 10-40 parts of lotus leaves, 20-50 parts of haws, 15-45 parts of poria cocos, 5-35 parts of dried orange peel, 60-130 parts of raspberries, 0-15 parts of fingered citron and 0-15 parts of kudzuvine roots. Compared with a model group, the fat-reducing and weight-losing composition disclosed by the invention has the advantages that the weight of a mouse can be reduced by 12%-15%, the serum total cholesterol level and the leptin level are reduced, the number of fat cells per unit area is increased, the liver adiposis symptom is obviously improved, the expression of heat production factors in epididymal fat and groin fat is up-regulated, and liver toxicity is avoided. The raw materials of the composition for reducing fat and losing weight are all traditional Chinese medicines with homology of medicine and food, so that the composition has no obvious damage to organisms and is safer; the fat-reducing and weight-losing composition can achieve a good weight-losing effect by compounding the raw materials.

Provided herein are methods for making thermogenic adipose cells, and use of such thermogenic adipose cells for treating, or reducing risk of, conditions associated with an elevated body mass index (BMI) such as diabetes.