5635 results about "Antitumor activity" patented technology

Various polymers, including cationic polyamine polymers and dendrimeric polymers, are shown to possess anti-proliferative activity, and may therefore be useful for treatment of disorders characterised by undesirable cellular proliferation such as neoplasms and tumours, inflammatory disorders (including autoimmune disorders), psoriasis and atherosclerosis. The polymers may be used alone as active agents, or as delivery vehicles for other therapeutic agents, such as drug molecules or nucleic acids for gene therapy. In such cases, the polymers' own intrinsic anti-tumour activity may complement the activity of the agent to be delivered.

By replacing the antigen-binding domain, the present inventors discovered novel polypeptide complexes that retain BiTE's strong anti-tumor activity and excellent safety properties, as well as have long half-life in blood and can damage various different target cells.

The present invention provides compositions and methods for treating cancer in a human. The invention includes administering a genetically modified Th17 cell to express a CAR having an antigen binding domain, a transmembrane domain, and an ICOS intracellular signaling domain.

There is provided a novel compound that inhibits interaction between murine double minute 2 (Mdm2) protein and p53 protein and exhibits anti-tumor activity. The present invention provides an imidazothiazole derivative represented by the following formula (1) having various substituents that inhibits interaction between Mdm2 protein and p53 protein and exhibits anti-tumor activity:wherein R1, R2, R3, R4, and R5 in the formula (1) each has the same meaning as defined in the specification.

Novel chimeric moieties that show significant efficacy against cancers are provided. In certain embodiments the chimeric moieties comprise a targeting moiety attached to an interferon. In certain embodiments, the chimeric moieties comprise fusion proteins where an antibody that specifically binds to a cancer marker is fused to interferon alpha (IFN-α) or interferon beta (IFN-β).

The present invention provides: an antibody, which specifically reacts with hTROP-2 and has anti-tumor activity in vivo; a hybridoma, which produces the aforementioned antibody; a complex of the aforementioned antibody and a drug; a pharmaceutical composition for diagnosing or treating a tumor; a method for detecting a tumor; and a kit for detecting or diagnosing a tumor.

This invention provides novel chimeric moieties that show significant efficacy against cancers. In certain embodiments the chimeric moieties comprise a targeting moiety attached to an interferon. In certain embodiments, the chimeric moieties comprise fusion proteins where an antibody that specifically binds to a cancer marker is fused to interferon alpha (IFN-α).

The present invention provides a medicinal composition having an excellent antitumor activity. That is, it provides a medicinal composition comprising a sulfonamide compound, a sulfonate compound or a salt of them, which is represented by the following formula: (wherein ring A represents an aromatic ring which may have a substituent group; ring B represents a 6-membered unsaturated hydrocarbon ring which may have a substituent group etc.; ring C represents a 5-membered hetero-ring containing one or two nitrogen atoms, and the ring C may have a substituent group; W represents a single bond or -CH=CH-; X represents -NH- etc.; and Y represents a carbon atom or a nitrogen atom; and Z represents -NH- etc.), particularly N-(3-chloro-1H-indol-7-yl)-4-sulfamoylbenzenesulfonamide or a salt thereof, combined with at least one substance selected from (1) irinotecan hydrochloride trihydrate; (2) mitomycin C; (3) 5-fluorouracil; (4) cisplatin; (5) gemcitabine hydrochloride; (6) doxorubicin; (7) taxol; (8) carboplatin; (9) oxaliplatin; (10) capecitabine; and (11) a salt of the above-mentioned (1) to (10).

The present invention relates to the field of adoptive immunotherapy. The invention provides methods for generating phenotypically defined, functional, and / or expandable T cells from pluripotent stem cells engineered through safe genetic modifications. The engineered cells may provide one or more of: 1) targeting a specific predetermined antigen expressed on the cell surface of a target cell in an HLA independent manner, 2) enhanced survival and functional potential 3) “off-the-shelf” T cells for administration to multiple recipients, eventually across immunogenic barriers, and / or 4) cytotoxic potential and anti-tumor activity.

The present invention relates to a RUNX3 gene showing anti-tumor activity which is essentially involved in TGF-β dependent-programmed cell death (apoptosis) and use thereof. In addition, the present invention finds that the RUNX3 gene expression is suppressed in the various gastric cancer and lung cancer cell lines. The suppression of the RUNX3 gene expression is due to hyper-methylation of CpG island located around RUNX3 exon (1). The RUNX3 gene and its gene product of the present invention can be used effectively for the development of anti-cancer agents. CpG island around RUNX3 exon (1) could also be used not only for the development of anti-cancer agents which regulate the abnormal DNA methylation and there by induce RUNX3 expression but also for the development of methods for cancer diagnosis by measuring the abnormal DNA methylation.

Phosphonate-nucleotide ester compounds of the formula (I) have excellent antiviral activity and antineoplastic activity. Further, they can be orally administered. wherein ring A represents wherein R1 and R2 independently represent hydrogen, halogen, hydroxyl, mercapto, C6-C10 arylthio or amino; R3 represents C1-C4 alkyl or ethyl having one or more substituents selected from the group consisting of fluorine, C1-C4 alkoxy, phenoxy, C7-C10 phenylalkoxy and C2-C5 acyloxy; R4 represents ethyl having one or more substituents selected from the group consisting of fluorine, C1-C4 alkoxy, phenoxy, C7-C10 phenylalkoxy and C2-C5 acyloxy; X, Y and Z independently represent methyne or nitrogen atom; or a pharmaceutically acceptable salt thereof.

The present invention provides novel analogs of FR901464, as well as an improved methodology for preparing FR901464 and its analogs. These compounds display an anti-cancer activity and are candidates for therapies against a number of disease states associated with dysfunctional RNA splicing.

The invention belongs to the field of medicinal chemistry, and discloses pyrimidine compounds containing semicarbazide and terminal alkyne structural units, and preparation methods and applications of the pyrimidine compounds in preparation of antitumor drugs by taking lysine specific demethylase 1 (hereafter referred to as LSD1) as a target. A pyrimidine active fragment is built by adopting a three-component one-pot method, and then the target compounds are prepared by substitution, chlorination and ammonification reaction. The general formulas of the compounds are as shown in the formula I in the specification. An in vitro anti-tumor activity experiment and an LSD1 inhibition activity experiment prove that the compounds have obvious inhibiting and killing action on a plurality of tumor cells by inhibiting the activity of the LSD1, can be used as lead compounds for further development, and are applied to preparation of the antitumor drugs.

The subject invention pertains to the treatment of tumors and cancerous tissues and the prevention of tumorigenesis and malignant transformation through the modulation of JAK / STAT3 intracellular signaling. The subject invention concerns pharmaceutical compositions containing cucurbitacin I, or a pharmaceutically acceptable salt or analog thereof, to a patient, wherein the tumor is characterized by the constitutive activation of the JAK / STAT3 intracellular signaling pathway. The present invention further pertains to methods of moderating the JAK and / or STAT3 signaling pathwaysin vitro or in vivo using cucurbitacin I, or a pharmaceutically acceptable salt or analog therof. Another aspect of the present invention concerns a method for screening candidate compoudns for JAK AND / or STAT3 inhibition and anti-tumor activity.

This disclosure provides, for instance subset-optimized CART cells and related methods. For instance, the disclosure describes methods and compositions of CD4′ and CD8′ T cells that express CARs containing specific combinations of intracellular signaling domains can be used to increase persistence and anti-tumor activity of the infused CAR-expressing T cells for treating a subject having a disease, e.g., a cancer.

The present invention provides a bacterium belonging to the genus Bifidobacterium, by which DNA coding for a protein having an antitumor activity or DNA coding for a protein having the activity of converting a precursor of an antitumor substance into the antitumor substance is delivered to tumor tissues specifically under anaerobic conditions thereby expressing the protein encoded by the DNA, as well as a pharmaceutical composition comprising said anaerobic bacterium.

The invention relates to preparation and application of amphiphilic polysaccharide conjugate and medicinal compositions thereof with anti-tumor activity and biodegradability. The conjugate has amphiphilicity by using alkylenediamine as a connecting arm and introducing hydrophobic segmer, namely a carboxyl-containing anti-tumor medicament, on a polysaccharide framework, and are formed into nanometer micelles by self-assembly in water. The invention is characterized in that 1) the anti-tumor medicament is physically coated by a hydrophobic inner core consisting of hydrophobic groups so as to remarkably improve the solubility of the anti-tumor medicament; and 2) the anti-tumor medicament obtained by chemical conjugation and physical coating can jointly achieve treatment effect and improve medicament action. The polysaccharide conjugate and the medicinal compositions thereof can be used for injection, oral administration, external use or mucosa administration. The invention has the advantages of simple preparation method, mature technology, high yield, and suitability for large-scale continuous production.

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

The present invention provides an amido quinazoline derivative which has recipient singal conductance for inhibition of epidermal growth factors with anti-tumor activity. The novel compounds with a structure identical to quinazoline has quite high activity for inhibition of tumor cells, in particular to the remarkable inhibition effects on the growth of tumor cells of EGFR high expression. And the effective inhibition concentration is 5 times higher than the medicine IRESSA on the market.

An objective of the present invention is to decrease the immunogenicity of mouse-derived anti-AXL antibodies in humans by humanizing them. The present invention provides antibodies that can bind to a specific region in Anexelekto (AXL) and humanized antibodies that are produced based on such antibodies. The anti-AXL antibodies of the present invention have high antitumor activity, and are useful as agents for decreasing the AXL expression level, antitumor agents, and diagnostic agents for cancer.

The invention discloses a cyclopropylfluoroquinolone C-3 s-triazole thioether ketone thiosemicarbazone compound and a preparation method and application thereof. The chemical general structure of the compound is shown in formula I, in which R is at least one of H, ether group, hydroxyl, methyl, halogeno-group and nitro. According to the cyclopropylfluoroquinolone C-3 s-triazole thioether ketone thiosemicarbazone compound disclosed by the invention, a fluoroquinolone framework is actively overlaid or structurally complemented with three different pharmacophores such as a s-triazole heterocyclic ring, thiosemicarbazone and the like, so that the anti-tumor activity of the novel compound is increased, the toxic and side effects of normal cells are reduced, and the compound can serve as an anti-tumor activity matter to develop an anti-tumor drug of a novel structure.

The invention relates an amphiphilic polysaccharide-anti-tumor medicament conjugate capable of releasing medicines specifically at a lesion site of a living body, as well as a preparation method and application of a medicinal composition of the amphiphilic polysaccharide-anti-tumor medicament conjugate. In the conjugates, hydrophobic anti-tumor medicaments are introduced into a polysaccharide skeleton through a connecting arm which contains a disulfide bond, so that the polysaccharide-anti-tumor medicament conjugate has amphipathic characteristics and can be self-assembled into nano-micelles; the nano-micelles can load anti-tumor medicaments additionally and also can be directly used as conjugate pre-drug micelles. The amphiphilic polysaccharide-anti-tumor medicament conjugate is mainly characterized in that 1) after the nano-micelles reach the lesion site, the disulfide bond connecting arm of the conjugate can be specifically degraded by high-concentration reducing substances in lesion cells, so that the micelles are depolymerized and the medicament is released quickly, and therefore, the treatment effect is improved; 2) the anti-tumor medicament is chemically conjugated and physically coated to achieve a common treatment effect. The polysaccharide conjugate and the medicinal composition thereof can be used for injection, oral administration or external use administration; the anti-tumor activity can be improved remarkably; new ideas are provided for the development of anti-tumor medicaments.

The present invention provides a composition and a kit for treating tumors, which permits a sulfonamide-containing heterocyclic compound to exhibit its angiogenesis inhibitory activity and antitumor activity more effectively. According to the present invention, the sulfonamide-containing heterocyclic compound can be used in treating cancers more effectively by combination with a VEGF inhibitor / FGF inhibitor.

The invention relates to the technical field of medicines. The content of DNA topoisomerase I (TopoI) in tumor cells is substantially higher the content of the TopoI in normal tissues, and an inhibitor of the TopoI is listed as one of six types of antitumor drugs which are primarily researched by an American NCI (National Cancer Institute). The invention aims to obtain evodiamine derivatives withstrong antitumor activities by modifying the structure of evodiamine. The evodiamine structure of the evodiamine compounds is represented by general formula (I) in the specification. The invention also provides an application of the evodiamine compounds and medicinal salts thereof in preparing topoisomerase inhibitors and antitumor drugs.

The present invention provides tricyclic compounds, pharmaceutically acceptable salts, prodrugs, solvates, or hydrates thereof, having antimitotic activity, anti-multidrug resistance activity, for example P-glycoprotein inhibition, and antitumor activity, and which inhibit paclitaxel sensitive and resistant tumor cells. Also provided are methods of utilizing these compounds for treating tumor cells and inhibiting mitosis of cancerous cells.

Disclosed are a pharmaceutical composition having excellent antitumor activity, and a method for treating a cancer. Specifically, excellent antitumor activity is achieved when 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide or an analogous compound thereof, a pharmacologically acceptable salt thereof or a solvate thereof is used in combination with gemcitabine or erlotinib, a pharmacologically acceptable salt thereof or a solvate of any of them.

The invention aims to provide a medicament for treating cancer in which a cancer therapeutic effect is synergistically increased using a substance inhibiting activities of insulin-like growth factor-I (IGF-I) and insulin-like growth factor-II (IGF-II). According to the invention, there are provided a medicament for treating cancer which comprises a substance inhibiting activities of IGF-I and IGF-II and which is administered in combination with irradiation; and a medicament for treating cancer comprising a combination of a substance inhibiting activities of IGF-I and IGF-II and a substance having an antitumor activity.

The present invention provides novel analogs of FR901464, as well as an improved methodology for preparing FR901464 and its analogs. These compounds display an anti-cancer activity and are candidates for therapies against a number of disease states associated with dysfunctional RNA splicing.