741results about How to "Improve anti-tumor activity" patented technology

New thiol and disulfide-containing maytansinoids bearing a mono or di-alkyl substitution on the α-carbon atom bearing the sulfur atom are disclosed. Also disclosed are methods for the synthesis of these new maytansinoids and methods for the linkage of these new maytansinoids to cell-binding agents. The maytansinoid-cell-binding agent conjugates are useful as therapeutic agents, which are delivered specifically to target cells and are cytotoxic. These conjugates display vastly improved therapeutic efficacy in animal tumor models compared to the previously described agents.

This invention relates to the use of monoclonal and polyclonal antibodies that specifically bind to and have the ability in the alternative to become internalized by cells expressing folate receptor alpha (FRA) and to induce an immune effector activity such as antibody-dependent cellular cytotoxicity. The antibodies are useful in specific delivery of pharmacologic agents to FRA-expressing cells as well as in eliciting an immune-effector activity particularly on tumor cells and precursors. The invention is also related to nucleotides encoding the antibodies of the invention, cells expressing the antibodies; methods of detecting cancer cells; and methods of treating cancer using the antibodies.

This disclosure provides, for instance subset-optimized CART cells and related methods. For instance, the disclosure describes methods and compositions of CD4′ and CD8′ T cells that express CARs containing specific combinations of intracellular signaling domains can be used to increase persistence and anti-tumor activity of the infused CAR-expressing T cells for treating a subject having a disease, e.g., a cancer.

The present invention generally provides methods for B-cell reduction in an individual using CD37-specific binding molecules. In particular, the invention provides methods for B-cell reduction using CD37-specific binding molecules alone, or a combination of CD37-specific binding molecules and CD20-specific binding molecules, in some instances a synergistic combination. The invention further provides materials and methods for treatment of diseases involving aberrant B-cell activity. In addition, the invention provides humanized CD37-specific binding molecules.

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

The present invention relates to anti-TIGIT antibodies, as well as use of these antibodies in the treatment of diseases such as cancer and infectious disease.

This invention provides herbal compositions useful for increasing the therapeutic index of drugs, including those used in the treatment of disease, especially viral infections and neoplasms of cancer. This invention provides methods useful for improving the quality of life of an individual undergoing chemotherapy. Furthermore, this invention improves the treatment of disease by increasing the therapeutic index of chemotherapy drugs by administering the herbal composition PHY906 to a person undergoing such chemotherapy.

The present invention provides adeno-associated viral (AAV) vectors encoding an angiostatin protein ("AAV-angiostatin vector") and / or a costimulatory molecule B7.1 ("AAV-B7.1 vector"). The AAV-angiostatin vector can be administered to a subject, alone or in combination, sequentially or simultaneously, with a AAV-B7.1 vector for treatment, management or prevention of metastatic tumors. Pharmaceutical compositions and vaccines comprising the AAV-angiostatin vector and / or the AAV-B7.1 vector and methods of manufacturing are also described. Administration of AAV-angiostatin and AAV-B7.1 vectors by intraportal and muscular injections are also provided.

Prodrugs that are activated by and conjugated to a catalytic antibody conjugated to a moiety that binds to a tumor cell population are provided.

The invention relates to an anti-tumor natural medicine coupled with a nitric oxide donor and medical use thereof. The medicine has a chemical structure shown in the general formula (I), which couples an anti-tumor natural medicine and a nitric oxide donor and can be used for preparing a medicament for preventing and curing tumor and cancer diseases. After entering a human body, the medicament can release nitric oxide and the components of the natural medicine at the disease symptom points in vivo, double suppression effects on the tumor or cancer lesion cells can be realized, and the toxic or side effect of the natural medicine is avoided.

This invention is in the area of dosage formulations and methods of administering a CDK4 / 6 inhibitor for the transient protection of healthy cells, and in particular hematopoietic stem and progenitor cells (HSPC), from damage associated with DNA damaging chemotherapeutic agents in subjects undergoing DNA damaging chemotherapeutic therapies for the treatment of proliferative disorders. In one aspect, improved protection of healthy cells is disclosed using a dosage that provides desirable pharmacokinetic and pharmacodynamic characteristics, including AUC, Tmax, Cmax, dosage-corrected AUC, and dosage-corrected Cmax. In another aspect, a method of treating a subject undergoing chemotherapy for the treatment of a CDK 4 / 6-replication independent cellular proliferation disorder by administering Compound 1 is provided.

A method of identifying a combination of antibodies with a combined improved anti tumor activity is provided. The method comprising identifying at least two anti RTK antibodies capable of inducing synergistic endocytosis of the RTK in a cell expressing the RTK, thereby identifying the combination of antibodies with the combined improved anti-tumor activity.

The invention relates to preparation and application of an amphiphilic ursolic acid-polysaccharide coupled substance with antitumor activity. The ursolic acid is chemically modified to substitute C3 site carboxyl group with amino group, the generated aminated ursolic acid is chemically coupled to a polysaccharide framework to form the amphiphilic ursolic acid-polysaccharide coupled substance, and the amphiphilic ursolic acid-polysaccharide coupled substance can be self-assembled into a nano micelle in water. The method is characterized in that the antitumor activity of the chemically modified ursolic acid is obviously enhanced; the hydrophobic inner core formed by the hydrophobic group can physically wrap the antineoplastic drug to obviously improve the solubility of the antineoplastic drug; and the antineoplastic drug which is physically wrapped by the chemically coupled ursolic acid can implement combined chemotherapy, has higher antitumor activity, has the combined synergetic action, and lowers the toxicity. The preparation method is simple and easy to operate, has the advantage of higher yield, and can easily implement industrialization.

The present invention relates to a method for treating a cancer comprising orally administering a composition containing α,α,α-trifluorothymidine (FTD) and 5-chloro-6-(1-(2-iminopyrrolidinyl)methyl)uracil hydrochloride in a molar ratio of 1:0.5 at a dose of 20 to 80 mg / m2 / day in terms of FTD in 2 to 4 divided portions per to patients in need of the treatment.

A method for controlling in vivo heat-inducible gene expression for provision of therapeutic polypeptide. The method includes the steps of: (a) providing a construct comprising a polynucleotide encoding a therapeutic polypeptide, wherein the polynucleotide is operatively linked to a heat-inducible promoter; (b) administering the construct to a warm-blooded vertebrate at a site at or near the tumor; and (c) applying heat to the site at or near the tumor to express the therapeutic polypeptide, whereby anti-tumor activity is observed.

The invention relates to a process for preparing water-soluble chitooligosacchrides, which is prepared by utilizing the difference of recognition capability and disengagement capability of enzymes to different glycosidic bonds and the inhomogeneous distribution of acetylaminos in chitosan raw material. The invention realizes simple process, wherein at the same time of preparing Chitosan oligosaccharide, 8-200 polymerization degree of water-soluble chitooligosacchride can be achieved simultaneously through the method of ultrafiltration membrane separation. The product obtained thereby has exhibites antineoplastic action and immunologic enhancement.

The present disclosure provides for a scientific formulation useful in the treatment and prevention of human and animal diseases. A biologically effective amount of each of the components of the formulation is administered to patients in pill (or capsule) form via multiple different and identifiable pills. The compounds of the formulation are segregated into different pill types, and contain various amounts of the compounds Curcumin, Genistein, Squalamine, Vitamin E, N-Acetyl-Cysteine, Methylselenocysteine, Zinc Gluconate, B Complex, Lentinen, Coenzyme Q10 Acetyl-L-Carnitine, Lipoic Acid, Resveratrol, and Vitamin C. Furthermore, Arabinoxylan and / or Peperine may be added to the various pill formulations.

The invention relates to a ruthenium-containing coordination compound. The ruthenium-containing coordination compound is a coordination compound expressed by ARu(X'Y')Z or [ARu(XY)Z]+B-, wherein A is arene; XY is one of dialkyl amine, and feiluolin and derivatives thereof; the X'Y' is one of 8-hydroxyguinoline and a derivative thereof; Z is one of halogen, -SCN, -N3,-SCH3, -SH, -COOH, pyridyl, pyridyl substituted by one or more groups in C1-C3 alkyl and tyrosine kinase inhibitor with a single coordination atom; and B- is PF6- or BF4-. The new ruthenium-containing coordination compound can effectively act on DNA, or substitute a high-selectivity protein kinase inhibitor or a derivative thereof for one or more of ligands in the cytotoxicity organic metal ruthenium coordination compound, and can act on the protein kinase (or protein phosphatase) and a multi-target point combining molecular anti-tumor compound of DNA at the same time.

It is intended to provide a compound represented by the following general formula (1) or a pharmaceutically acceptable salt thereof. Because of having a sufficiently high antitumor activity, this compound or its salt is useful as a remedy for cell proliferative diseases, in particular, cancer. It is also intended to provide a medicinal composition which contains the above-described compound or its salt as the active ingredient. [Chemical formula 1] (1) wherein X is selected from heteroaryl, etc.; Y<1> and Y<2> are selected from -N=, etc.; Y<3> and Y<4> are selected from -CH=, etc.; A is selected from sulfamide, etc.; R<1> is selected from hydrogen, etc.; and R<2> is selected from C1-6 alkyl, etc.

Catalytic antibodies are disclosed. The catalytic antibodies are specific for prodrug compounds. The catalytic antibodies enhance cleavage of an active drug moiety from a prodrug residue, thereby activating the drug.

It was discovered that the use of an antigen-binding molecule having a cancer-specific antigen-binding domain, and a TNF superfamily-binding domain or a TNF receptor superfamily-binding domain enables agonist activity against a factor belonging to the TNF superfamily or the TNF receptor superfamily to be exhibited only in the presence of cancer-specific antigen-expressing cells, thus leading to activation of immune cells and thereby maintain anti-tumor activity while avoiding side effects such as hepatotoxicity. It was also discovered that concomitant use of the antigen-binding molecule with an antigen-binding molecule having a cancer-specific antigen-binding domain and a T cell receptor complex-binding domain can avoid side effects while increasing the anti-tumor activity.

The invention discloses a mixed compound medicament of natural medicament components and nitric oxide donors. The mixed compound medicament is characterized in that: the mixed compound medicament is obtained by compounding at least one natural medicament component and at least one nitric oxide donor in any mass concentration ratio, wherein the natural medicament component is a medicinal material with antitumor activity; and the nitric oxide donor is a compound with the ability of releasing nitric oxide. After the mixed compound medicament of the natural medicament components and the nitric oxide donors is applied, the antitumor activity and selectivity of the natural medicament components can be effectively strengthened, and the toxic or side effect of non-natural medicaments can be avoided; meanwhile, the antitumor activity of the nitric oxide is played, so the mixed compound medicament has the ability of remarkable double-effect inhibition on the activity of pathological cells, and can be widely and effectively applied in the treatment of cancer.

The invention relates to ruthenium complex, the preparation method thereof and the application thereof. The ruthenium complex has the structure in the formula (1) and the structure in the formula (2), wherein X is hydrogen, benzene, p-methoxy benzene, imidazolyl or thienyl, N-N is bipyridine or phenanthroline, and L is imidazole or methyl imidazole. The ruthenium complex can be used for preparingthe medicament for treating and / or preventing the cancer.

The invention discloses a chiral fluoroquinolone C-3 fused heterocycle alpha, beta-unsaturated ketone derivative as well as a preparation method and application thereof. The chiral fluoroquinolone C-3 fused heterocycle alpha, beta-unsaturated ketone derivative is a compound having the general structural formula (I), wherein Ar represents phenyl, substituted phenyl or pyridyl. According to the chiral fluoroquinolone C-3 fused heterocycle alpha, beta-unsaturated ketone derivative disclosed by the invention, three medicinal groups with different structural characteristics, including fluoroquinolone, a fused heterocycle of thiadiazole and s-triazole, and alpha, beta-unsaturated ketone are spliced to build a chiral fluoroquinolone-fused heterocycle-unsaturated ketone derivative and realize structural compensation and overlapping of the three medicinal groups, including the fluoroquinolone, thiazole [3,2-b][1,2,4] triazole and the alpha, beta-unsaturated ketone, so that the antitumor activity of a new compound is improved, toxic and side effects on normal cells are reduced, and the chiral fluoroquinolone C-3 fused heterocycle alpha, beta-unsaturated ketone derivative can be used as an antitumor active substance for developing an antitumor drug with a totally new structure.

The present invention relates to a method of treating and / or preventing cancer comprising administering a combination of an effective amount of a DNA hypomethylating agent and an effective amount of at least one immunomodulatory agent and / or optionally an effective amount of at least one targeted therapy agent.

The invention relates to a vaccine comprising an adenovirus vector and a vaccinia virus vector and an application of the vaccine in treating tumor. The vaccine comprises oncolytic adenovirus and vaccinia virus; the two viruses are used in sequence, wherein the oncolytic adenovirus is the reproductive human adenovirus type 5 and the vaccinia virus is the vaccinia virus for smallpox vaccine. According to the vaccine, the oncolytic adenovirus and the vaccinia virus are prepared into the vaccine by sequential combination, so the antineoplastic activity can be improved, the stronger cellular immune response can be generated compared with the effect of reversely associated virus or separate virus, the using effect is better and the long-term specific immunity of tumor is shown. The tumor vaccine can eradicate the tumor and generate the long-term specific immunity of tumor and can be used in the treatment of various tumors of the human or animals; and meanwhile, the vaccine can effectively prevent the tumor from relapsing and has a wide application prospect.

Nanoconstructs having three components: (1) biodegradable nanopolymers and nanoparticles, (2) immunodrugs such as CpG, and a (3) tumor binding device, which are actively targeted to tumor cells such as melanoma cells through receptor-mediated uptake and methods of using the same are described. Antitumor immunity is further enhanced by combination of PG-CpG nanoconstructs with agonists of positive costimulatory signals and inhibitors of negative immune regulatory signals.

New thiol and disulfide-containing maytansinoids bearing a mono or di-alkyl substitution on the α-carbon atom bearing the sulfur atom are disclosed. Also disclosed are methods for the synthesis of these new maytansinoids and methods for the linkage of these new maytansinoids to cell-binding agents. The maytansinoid-cell-binding agent conjugates are useful as therapeutic agents, which are delivered specifically to target cells and are cytotoxic. These conjugates display vastly improved therapeutic efficacy in animal tumor models compared to the previously described agents.

A camptothecin derivative comprising a compound of the formula [I]:wherein R1, R2, R3, R4 and R5 are (A) adjacent two groups combine to form alkylene, or both are H, and one of the remaining three groups is -Xn-Alkm-R6, and the other two are H, alkyl or halogen, or (B) adjacent two groups combine to form alkylene, and one of the carbon atoms of said alkylene group is substituted by -Xn-Alkm-R6, and the remaining three groups are H, alkyl or a halogen, and one or two -CH2- of the alkylene in (A) or (B) may optionally be replaced by -O-, -S- or -NH-, X is -O- or -NH-, Alk is alkylene,or -OH, m and n are both 0 or 1, or m is 1 and n is 0, which camptothecin compound is bound to a polysaccharide having carboxyl groups via an amino acid or a peptide, or a pharmaceutically acceptable salt thereof. Said camptothecin derivatives show enhanced antitumor activities but few side effects and are useful as a medicament.