10 results about "Puromycin" patented technology

The present invention relates to a method for forming a conjugate of a desired target substance and a peptide. A method according to the present invention includes a step for bringing a genetic information material-linker-peptide conjugate into contact with a target substance conjugate containing at least two target substances. The genetic information material-linker-peptide conjugate includes: (a) a linker that includes a bond portion having a structure capable of binding to a desired genetic information material and includes at least two puromycin-like substances, the puromycin-like substances being capable of covalently binding to the C-terminus of a desired peptide; (b) a genetic information material that is bonded to the bond portion of the linker of (a); and (c) a peptide that is bonded to at least two or more puromycin-like substances of the linker of (a) and is encoded by the genetic information material.

The invention relates to the technical field of molecular biology, in particular to a construction method of a J774A.1 cell line with a baz2b gene knocked out. The invention provides a construction method of a J774A.1 cell line with a baz2b gene knocked out. The construction method comprises the following steps: constructing a J774A.1 cell line for expressing Cas9 protein; the recombinant vector contains the sgRNA; a recombinant vector, pMD2. G and psPAX2 are co-transfected into cells, and then the cells, a J774A.1 cell line for expressing Cas9 protein and puromycin antibiotic are screened to obtain a J774A.1-KO baz2b cell line with inactivated baz2b function, and the J774A.1 cell line with the baz2b gene knocked out is obtained. The cell line can regulate the formation of a macrophage extracellular trapping net.

The present application relates to the field of cell reprogramming, and in particular to a method for inducing fibroblast transdifferentiation into kidney epithelial cells by using a double-stranded retrovirus vector combined with a double selection antibiotic screening strategy. The present application first applies a double-stranded retrovirus vector, and adds a Puromycin and Blasticin double-antibiotic screening strategy, to induce four transcription factors Hnf1beta, Emx2, Pax8 and Hnf4alpha to reprogram embryonic fibroblasts into kidney tubular epithelial cells within two weeks. The establishment of the technical system of the present application will provide strong technical support for obtaining kidney tubular epithelial cells in vitro.

The invention discloses a precursor protein capable of expressing recombinant cat lactoferrin (rfLF), a nucleotide molecule, a recombinant expression vector, a stably transfected cell strain and a construction method and application thereof, and relates to the technical field of recombinant protein expression. The amino acid sequence of the rfLF precursor protein comprises a heterologous secretion signal peptide and a mature fLF sequence as shown in SEQ ID NO: 1; the heterologous secretion signal peptide selects a sequence of a signal peptide OST1, INU1, SUC2, IGK1 or PPIB to replace a sequence of a leader peptide alpha-factor or a K28 alpha subunit, so that the secretion efficiency of the rfLF in a stably transfected cell strain can be remarkably improved. A recombinant expression vector containing an rfLF precursor protein gene, a CMV promoter, an SV40 terminator and a puromycin resistance gene is constructed, the recombinant expression vector is stably integrated into a CHO-K1Q cell genome in a multi-copy mode, and the stably transfected cell strain capable of efficiently and stably expressing the rfLF is obtained. The obtained rfLF has a cat specific glycosylation mode, and can be used for preparing drugs or products for preventing or treating cat stomatitis, stress soft stool and postoperative infection.

The invention relates to the technical field of veterinary ophthalmology, in particular to a cat corneal limbal stem cell immortalized cell line FLSC-SV40LT as well as a construction method and application thereof. The immortalized cell line FLSC-SV40LT is preserved in the China General Microbiological Culture Collection Center (CGMCC); the preservation number of the strain is CGMCC No. 46589; carrying out isolated culture on primary cat corneal limbal stem cells FLSC; immortalization treatment: infecting the primary FLSC cell line by using a lentivirus plasmid vector containing SV40LT; after infection, replacing a puromycin-containing BM culture medium for screening; screening survival cells, and carrying out multiplication culture, so as to obtain the immortalized cell line FLSC-SV40LT. Primary FLSCs are successfully separated, cultured and identified from cat corneal limbus tissues, SV40LT is used for successful lentivirus infection of the FLSCs, and a cat corneal limbus stem cell immortalized cell line is obtained for the first time and is named as FLSC-SV40LT; the establishment of the immortalized cell line FLSC-SV40LT provides an important basis for the basic research and clinical application of FLSC, and also provides an important research basis for veterinary ophthalmology, especially for cat corneal diseases, and comparative ophthalmology.

The invention discloses a BHK-21 cell line capable of stably expressing a human c-Myc gene and a construction method and application thereof, the cell line is hamster kidney tissue fibroblast BHK-c-Myc, the cell line carries the human c-Myc gene, and the cell line can be hijacked by viruses to be used for accelerating one-carbon metabolism in host cells and improving the synthetic efficiency of purine, so that the human c-Myc gene can be used for preparing the human c-Myc gene. The virus titer generated after the Newcastle disease virus infects host cells is improved. The construction method of the cell line comprises the following steps: amplifying a human c-Myc gene, constructing a stable expression vector, co-transfecting the stable expression vector and packaging plasmids psPAX2 and pMD2. G to an HEK-293T cell, culturing, collecting a supernatant rich in lentiviral particles, infecting a BHK-21 cell by using the collected lentivirus, screening by using a puromycin drug, and carrying out enlarged culture to obtain the cell line. And the BHK-c-Myc cell is obtained.

The invention discloses an HDAC8 gene knockout MDBK cell line as well as a construction method and application thereof. According to the method, a CRISPR / Cas9 technology is utilized, specific gRNA is designed aiming at a second exon of a cattle HDAC8 gene, CRISPR expression plasmids are constructed, adherent MDBK cells are transfected, and HDAC8 homozygous frame-shift mutant cell lines KOHDAC8-1 (4bp deletion) and KOHDAC8-2 (1bp insertion) are obtained through puromycin screening and monoclonal separation. An identification result shows that HDAC8 knockout obviously promotes replication of the bovine viral diarrhea virus (BVDV), the expression level of NS3 mRNA and protein of the virus is increased, the virus titer is obviously improved, and the cell growth rate is not obviously influenced. The cell line provided by the invention can be used as an efficient proliferation matrix of the BVDV, is used for producing inactivated vaccines for bovine viral diarrhea, and effectively improves the yield and quality of the vaccines.

This invention discloses an editing site that specifically identifies the porcine ACADL gene and its application, relating to the field of biotechnology. The editing site includes two editing sites, T1 and T2. The sequence of the T1 editing site is: CGTGGATCTCTGCGCTTGTG, and the sequence of the T2 editing site is: CGTGCTCCGCGCCTACCGA. Both T1 and T2 editing sites are located in the first exon region of the coding region of the ACADL gene on porcine chromosome 15. The chromosome coordinates of the T1 editing site are 75441814–75441833, and the coding region coordinates are 246–265; the chromosome coordinates of the T2 editing site are 75442009–75442028, and the coding region coordinates are 441–460. This invention is based on CRISPR / Cas9 gene editing technology. A targeting vector with a porcine ACADL gene editing site inserted was constructed using the PX459 vector as a backbone. Combined with electroporation and puromycin screening, and PCR amplification and Sanger sequencing, ACADL-deficient cell lines were obtained. Cell proliferation was observed using CCK-8, cloning experiments and EDU555 assays. This invention provides insights into the role of the ACADL gene in pork breed improvement.

The invention relates to a method for specifically and reversibly enriching a newborn polypeptide chain. The preparation method comprises the following steps: marking a newly-born peptide chain which is being translated on a ribosome-mRNA compound in a cell by using alkynyl-containing puromycin (OPP), then mixing a cell lysis solution with azide functionalized resin containing cleavable sites, and specifically bonding the newly-born peptide chain to a resin material by using a biological orthogonal reaction of alkynyl and azide. And after non-specifically adsorbed protein is washed off, the captured newly-born peptide chain is efficiently released by trypsin enzyme digestion. According to a specific mass tag (provided by a cleavable tag and OPP) on the enriched newborn peptide chain, efficient identification of the newborn peptide chain is facilitated, and batch identification of the mass spectrum level of the newborn peptide chain is realized at the same time. According to the method, high selectivity and high efficiency of the enrichment process are ensured; meanwhile, as the enriched newborn peptide fragment has a specific mass label, the newborn peptide chain can be directly identified by virtue of the mass migration of the label, and the problem that the newborn protein is difficult to verify after identification is solved.

The invention discloses a construction method and application of a membrane-bound IL-21 K562 cell strain, a human IL-21 mature sequence is fused with an IgG4 hinge region, a human immune globulin gamma-4 chain CH2 / CH3 region and a CD4 transmembrane structural domain through genetic engineering to construct an mbIL-21 fusion gene, and the mbIL-21 fusion gene is cloned to a PT-mnud carrier by using BamH I / Xho I double enzyme cutting sites to obtain a recombinant plasmid PCDH-mbIL-21. HEK 293T cells are transfected through a lentivirus packaging system, high-titer lentivirus particles are prepared, and the cell strain stably expressing mbIL-21 is obtained through puromycin screening after K562 cells are infected. The mbIL-21 K562 cell strain constructed by the invention has the characteristics of long acting, targeting and stable expression, and provides a powerful tool for basic research and clinical transformation of immunotherapy.