CHO cell line with GS gene knockout and preparation method and application thereof

A cell line and gene technology, which is applied in the field of CHO cell line with GS gene knockout and its preparation, can solve the problems of cell resource consumption, cell line canceration, cell genome cutting damage, etc., and achieve faster screening efficiency, simple and efficient operation Effect

Active Publication Date: 2019-10-18
ZHUHAI UNITED LAB
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no relevant reports on the identification of CRISPR vectors integrated into the genome sequence of host cells. These cell lines containing integrated vector sequences may express the puromycin resistance gene, and may continue to express Cas9 protein and sgRNA sequences, resulting in cell Cutting damage to the genome, while consuming cell resources, increases the metabolic burden of the cell line
After the vector sequence is randomly integrated into the host cell genome, it may increase the possibility of activating oncogenes, causing the cell line to become cancerous, and the cancerous cells are not suitable for the expression of biological products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CHO cell line with GS gene knockout and preparation method and application thereof
  • CHO cell line with GS gene knockout and preparation method and application thereof
  • CHO cell line with GS gene knockout and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Gene editing vector construction

[0071] The GS gene of CHO cells consists of 7 exons, of which the coding sequence (CDS) encoding and expressing the GS protein is located in exons 2-7 (see figure 1 ), and its normal function plays a vital role in cell growth and survival. The partial sequence of exons 2 to 7 of the GS gene is shown below (the CDS sequence is marked with an underline "_____"):

[0072] SEQ ID NO.1: Exon 2

[0073] CCCCTTCAGAGTAGATGTTAATGAAATGACTTTTGTCTCTCCAGAGCACCTTCCACC ATGGCCACCTC AGCAAGTTCCCACTTGAACAAAAACATCAAGCAAATGTACTTGTGCCTGCCCCAGGGTGAGAAAGTCCAAGCCATG TATATCTGGGTTGATGGTACTGGAGAAGGACTGCGCTGCAAAACCCGCACCCTGGACTGTGAGCCCAAGTGTGTAG AAG GTGAGCATGGGCAGGAGCAGGACATGTGCCTGGAAGTGGGCAAGCAGCCTGAGATTTGACCTTCCTTCTGTTTTG;

[0074] SEQ ID NO.2: Exon 3

[0075] GATATACATGCAAGTAAAACACCCCTACACACATAAAAATAAATACGTCTTTCTTAAAAGTTAATTTCCATCTTTATTTGGCCCAG AGTTACCTGAGTGGAATTTTGATGGCTCTAGTACCTTTCAGTCTGAGGGCTCCAACAG TGACATGTATCTCAGCCCTGTTGCCATGTTTCG...

Embodiment 2

[0096] Example 2: GS gene editing of CHO-S cells and isolation and identification of monoclonal cells

[0097] (1) Plasmid extraction: Use the plasmid purification kit (PureLink TM HiPure Plasmid Filter Midiprep Kit, Thermo Fisher Scientifi), referring to the method in the manual, extracted lentiCRISPRv2-GS02 and lentiCRISPRv2-GS06 plasmids to obtain high-purity, endotoxin-free high-concentration plasmids.

[0098] (2) Cell culture: resuscitated CHO-S (cGMP Banked, ) suspension cells were subcultured in CD FortiCHO complete medium (containing 8mM L-glutamine) in a conventional subculture method, and LentiCRISPRv2-GS02 and LentiCRISPRv2-GS06 transfection experiments were carried out after subculture for 3 generations.

[0099] (3) Cell transfection:

[0100] (A) 22-24 hours before transfection, the CHO-S cells were mixed with (5~6)×10 5 Cells / mL, subculture in 30ml CD FortiCHO complete medium; on the day of transfection, the cell density should be (1.2~1.5)×10 6 cells / ml, ...

Embodiment 3

[0142] Example 3: Determination of the base sequence of the GS gene edited by CRISPR / Cas9

[0143] (1) No. 1, No. 2, and No. 3 (3 GS- / - monoclonal cell lines without sgRNA integration gene, Cas9 integration gene, and puromycin resistance) extracted in Example 2) monoclonal cell lines The genome is used as a template, and the exon 2 and exon 6 CDS sequences of the GS gene are amplified by PCR. The primer sequences and PCR reaction systems are as follows:

[0144] GS02 forward primer (GS02F): 5'-CCCCTTCAGAGTAGATGTTAATGAA-3' (SEQ ID NO.18);

[0145] GS02 reverse primer (GS02R): 5'-CAAAACAGAAGGAAGGTCAAATCTC-3' (SEQ ID NO.19);

[0146] GS06 forward primer (GS06F): 5'-TATGGACTCTGATTCTTCACTG-3' (SEQ ID NO.20);

[0147] GS06 reverse primer (GS06R): 5'-ATGAGAATAAAGATGGCTCCAG-3' (SEQ ID NO. 21).

[0148] 50 μl reaction system: 3 μl (100ng) of template genomic DNA, 2 μl of primer GS02F at a concentration of 5 μM, 2 μl of primer GS02R at a concentration of 5 μM, 25 μl of PrimerSTAR Max...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CHO cell line with GS gene knockout and a preparation method and application thereof. The CHO cell line has no GS protein expression, no puromycin resistance and no integration of a Cas9 gene and an sgRNA sequence into a cell genome. A GS gene is knocked out by means of a CRISPR / Cas9 method, and the CHO cell line is obtained by optimizing a screening method. The providedpreparation method can rapidly realize GS- / - editing of CHO cells, and the CHO GS- / - cell line with GS gene knockout and no puromycin resistance and no integration of the Cas9 gene and the sgRNA sequence is screened out. The cell line is applied to recombinant protein expression without an MSX-mediated gene amplification process, so that the efficiency of screening high-yield cell lines is greatlyimproved.

Description

technical field [0001] The invention belongs to the field of biotechnology and pharmacy, and in particular relates to a CHO cell line with GS gene knockout and its preparation method and application. Background technique [0002] Chinese hamster ovary cells (CHO) are mammalian expression host cells widely used at present. Density fermentation culture is suitable for large-scale production of recombinant protein drugs. Compared with other recombinant protein expression hosts, CHO cells have irreplaceable advantages: (1) have accurate post-transcriptional modification functions, and the expression products are closest to their natural protein molecules in terms of molecular structure, physical and chemical properties and biological functions, It is especially suitable for the expression of complex macromolecular protein drugs; (2) high-density fermentation culture can be carried out, and it has high resistance to shear force and osmotic pressure; (3) foreign gene molecules ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/90C12N9/22
CPCC12N9/22C12N9/93C12N15/907C12Y603/01002
Inventor李靖贺华曹春来韦苏珍陈康月
OwnerZHUHAI UNITED LAB