Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

114 results about "Peste-des-Petits-Ruminants" patented technology

A highly fatal contagious disease of goats and sheep caused by PESTE-DES-PETITS-RUMINANTS VIRUS. The disease may be acute or subacute and is characterized by stomatitis, conjunctivitis, diarrhea, and pneumonia.

Kit for detecting antibody against Peste des petits ruminants virus b-ELISA and preparation method thereof

The invention relates to the technical field of biology, particularly the field of viral antibody detection. A kit for detecting the antibody against Peste des petits ruminants virus b-ELISA comprises the following ingredients which are arranged respectively: Peste des petits ruminants nucleoprotein antigen, Peste des petits ruminants monoclonal antibody, diluent, strong positive serum, weak positive serum, negative serum, HRP sheep anti-mouse secondary antibody, 20 times the concentration of washing liquid, substrate liquid, stopping solution and enzyme-linked immunosorbent plate. The optimum proportion of each ingredient in the kit is determined by experiments. The kit can be used for rapid diagnosis and detection of animal Peste des petits ruminants virus antibody, especially for the antibody detection of a lot of samples in the epidemiological survey of Peste des petits ruminants. The detection method of Peste des petits ruminants virus b-ELISA has different detection principle and experiment operating procedures and the like from those of a c-ELISA detection method in a BIRAD laboratory. The Peste des petits ruminants nucleoprotein antigen and Peste des petits ruminants monoclonal antibody in the kit are self-developed. The detection sensitivity, singularity and other indexes of the kit are the same with those of the c-ELISA detection method in the internationally recognized BIRAD laboratory.
Owner:CHECKOUT & QUARANTINE TECH CENT YUNNAN ENTRY &EXIT CHECKOUT & QUARANTINE BUR +1

Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof

Belonging to the field of biotechnologies, the invention discloses a competitive ELISA kit for detection of a peste-des-petits-ruminants virus antibody. The kit comprises a detection system composed of a coating antigen reaction solution and a monoclonal antibody reaction solution. The kit adopts prokaryotically expressed peste-des-petits-ruminants Nigeria 75 / 1 strain N protein as the coating antigen and employs a monoclonal antibody against N protein as the competitive antibody. The antibody against a peste-des-petits-ruminants virus in sheep serum is detected according to a competitive ELISA principle. The kit provided in the invention can rapidly and specifically detect the peste-des-petits-ruminants virus antibody in serum, and simultaneously has the advantages of large-scale production of monoclonal antibodies, good reaction specificity, high sensitivity, simple operation, low cost, stable, reliable and easily observable reaction results, thus being very suitable for import and export quarantine of sheep, food hygiene and screening of large batches of samples in livestock breeding farms, and being easy for large-scale popularization and application.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Kit for detecting peste des petits ruminants virus hemagglutinin protein antibody and application method of kit

The invention provides a kit for detecting a peste des petits ruminants virus hemagglutinin protein (H protein) antibody. The kit takes recombinant protein of extracellular region sequence code of peste des petits ruminants virus hemagglutinin protein gene as an envelope antigen. The invention further provides an application method of the kit. The kit can quickly specifically detect the peste des petits ruminants virus H protein antibody in serum, and is good in reaction specificity and high in sensitivity. The operation is simple; the cost is low; and the reaction result is stable and reliable, and is easy to observe. The kit is suitable for monitoring the vaccine immunity effect of import and export immunity, food sanitation, and a livestock farm of peste des petits ruminants.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Multiplex PCR kit for simultaneously detecting four viruses carried by ruminants

The invention discloses a multiplex PCR kit for simultaneously detecting four viruses carried by ruminants. The kit comprises four pairs of specific primers. The experiment proves that bluetongue, foot-and-mouth disease, peste des petits ruminants and vesicular stomatitis virus nucleic acid in clinical samples of ruminants can be simultaneously detected. The kit has the characteristics of high sensitivity, high specificity and simplicity in operation, the detection time can be saved, and the condition that DNA contamination occurs in detection is reduced.
Owner:艾军 +2

ELISA (enzyme linked immunosorbent assay) kit for detecting PPRV (peste des petits ruminants virus) antibody

The invention discloses an ELISA (enzyme linked immunosorbent assay) kit for detecting a PPRV (peste des petits ruminants virus) antibody. The ELISA kit for detecting the PPRV antibody comprises an envelope antigen, wherein the envelope antigen is a recombinant PPRV H-F fusion protein which is a protein of a) or b) as follows: a) protein formed by an amino acid sequence shown in SEQ ID No.2; b) soluble protein obtained from the amino acid sequence shown in SEQ ID No.2 through substitution and / or deletion and / or addition of one or several amino acid residues. The ELISA kit for detecting the PPRV antibody not only can be used for diagnosing PPR (peste des petits ruminants), but also can be used for evaluating a vaccine immunity effect, further can detect PPR rapidly and accurately and is beneficial to clinical monitoring of PPR, thereby playing a positive role in better control of spread of PPR in China.
Owner:CHINA ANIMAL DISEASE CONTROL CENT

Peste des petits ruminants virus (PPRV) reverse genetic operating system and application thereof

The invention relates to a peste des petits ruminants virus (PPRV) reverse genetic operating system and an application thereof. The PPRV reverse genetic operating system comprises a transcription plasmid and one or more helper plasmids, wherein the transcription plasmid can express the genome full-length cDNA (complementary deoxyribonucleic acid) sequence of the PPRV; and the helper plasmid(s) can express nucleoprotein (N), phosphoprotein (P) and polymerase large protein (L) of the PPRV, and virus replication-permitting host cells of the PPRV. By using the PPRV reverse genetic operating system, the recombined PPRV is successfully saved. The establishment of the PPRV reverse genetic operating technical platform provides an excellent technical platform for the development of PPRV live vector vaccines and the fundamental research related to PPRV.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Peste des petits ruminants virus recombinant protein antigen and rapid test strip for peste des petits ruminants virus antibody

The invention discloses a peste des petits ruminants virus recombinant protein antigen and a rapid test strip for detecting a peste des petits ruminants virus antibody by using the recombinant protein antigen as a detection line reagent. The peste des petits ruminants virus recombinant protein antigen can be obtained by the following steps: selecting main antigenic epitope-containing amino acid segment SEQ IDNo.1 through analyzing the N protein antigenic epitope of the peste des petits ruminants virus, optimizing a codon and artificially synthesizing the codon-optimized gene sequence SEQIDNo.2, constructing a recombinant expression carrier and transforming Escherichia coli for protein expression. The purified peste des petits ruminants virus recombinant protein antigen can be used for detecting the peste des petits ruminants virus antibody. The rapid test strip established based on the peste des petits ruminants virus recombinant protein antigen has the advantages of being convenient to operate, fast to detect, free from special laboratories, equipment and the like, overcomes the limit of the existing detection method, and can be used for rapid detection of the peste des petits ruminants virus antibody and investigation of serum epidemiology.
Owner:SHENZHEN AUDAQUE DATA TECH

Peste des petits ruminants virus H-F fusion protein, biological material related to same and application of peste des petits ruminants virus H-F fusion protein

The invention discloses a peste des petits ruminants virus H-F fusion protein, a biological material related to the same and application of the peste des petits ruminants virus H-F fusion protein. The peste des petits ruminants virus H-F fusion protein is a protein a) or a protein b). The protein a) comprises amino acid sequences shown as SEQ ID No.2; the protein b) is a soluble protein, and each amino acid sequence shown as SEQ ID No.2 is substituted and / or deleted and / or added by an amino acid residue or a plurality of amino acid residues to obtain the soluble protein. The peste des petits ruminants virus H-F fusion protein, the biological material and the application have the advantages that indirect ELISA (enzyme-linked immunosorbent assay) detection methods for peste des petits ruminants virus antibodies are created by the aid of the peste des petits ruminants virus H-F fusion protein which is used as an envelope antigen, are high in specificity and sensitivity and good in accuracy and can be quickly, easily and conveniently implemented, and accordingly the peste des petits ruminants virus H-F fusion protein, the biological material and the application are favorable for clinically monitoring peste des petits ruminants.
Owner:CHINA ANIMAL DISEASE CONTROL CENT

Gene chip and detection method for detecting FMDV, VSV, SVDV, PPRV and BTV

The invention discloses a gene chip and a detection method for detecting FMDV, VSV, SVDV, PPRV and BTV. The detection method comprises the step of detecting foot and mouth disease viruses (type A, Asian type I and type O), vesicular stomatitis virus, swine vesicular disease virus, Peste des petits ruminants virus and bluetongue virus. The method comprises the following specific steps: designing a PCR primer by virtue of sequence analysis of standard strain genome, and performing cloning and sequence analysis on target genes; designing a specific probe, and simultaneously detecting the foot and mouth disease viruses, vesicular stomatitis virus, swine vesicular disease virus, Peste des petits ruminants virus and bluetongue virus. The invention aims at establishing a method for detecting the foot and mouth disease viruses, vesicular stomatitis virus, swine vesicular disease virus, Peste des petits ruminants virus and bluetongue virus by adopting a microarray chip which is high in sensitivity and high in specificity and through which the time and labor are saved and the result is easily observed.
Owner:INSPECTION & QUARANTINE TECH CENT OF CHONGQING ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique

InactiveCN105018485AObvious amplification curveAmplification curve noMicrobiological testing/measurementDNA/RNA fragmentationForward primerMycoplasma capricolum
The invention aims at providing a primer and a probe for detecting peste des petits ruminants virus by virtue of a RPA (Recombinase Polymerase Amplification) technique. According to the primer and the probe, a forward primer sequence is represented by SEQ ID NO:1, a reverse primer sequence is represented by SEQ ID NO:2, and a probe sequence is represented by SEQ ID NO:3. According to a method, a large number of primers and probes are designed according to genomic sequences of the peste des petits ruminants virus, and a pair of primer and probe combinations capable of rapidly detecting nucleic acid of the peste des petits ruminants virus are screened out; obvious amplification curves can be obtained by carrying out rapid detection by virtue of the primer and the probe and taking nucleic acid RNA of the peste des petits ruminants virus of domestically separated Tibet strains and Xinjiang strains as a template, and no amplification curve is obtained through a reaction by taking other pathogenic nucleic acids such as foot and mouth disease virus, contagious pustular dermatitis virus, mycoplasma capricolum and bluetongue disease virus as the template.
Owner:CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT

Live vector vaccine for expressing peste des petits ruminants virus (PPRV) H gene and preparation method thereof

The invention provides a live vector vaccine for expressing a peste des petits ruminants virus (PPRV) H gene and a preparation method thereof. In the invention, the prepared recombinant virus has good genetic stability so that a goat can be induced to generate a specific antiviral neutralizing antibody after being immunized by the vaccine prepared from the virus. The live vector vaccine has the advantages of good immune protective effect, no toxic side effect, long shelf life and simple production process, and is easy for preservation and convenient for transportation, thus being applicable to industrialized production.
Owner:MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI

Cell line for stable expression of peste des petits ruminants virus receptor Nectin-4 and construction method of cell line

The invention discloses a cell line for stable expression of a peste des petits ruminants virus receptor Nectin-4 and a construction method of the cell line. According to the invention, by virtue of asynthetic Nectin-4 gene and on the basis of a lentiviral vector system, a recombinant plasmid pLOV-eGFP-Nectin-4 is constructed. The recombinant plasmid, together with pSPAX2 and pMD2.G plasmid, is applied to co-transfection of a 293T cell, so that retrovirus-like particles are obtained. A supernatant-infected MDBK cell is cultivated by virtue of cells containing the retrovirus-like particles, and puromycin screening and purifying are conducted, so that the MDBK cell for stable expression of Nectin-4 protein is obtained, and the MDBK cell is named as MDBK-Nectin-4. Through the construction ofthe cell line, an experimental material is provided for deep research of an interaction between PPRV and the receptor Nectin-4 and for the clinical rapid isolation of the PPRV is provided.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses

The invention provides a primer sequence and a probe sequence for the real-time fluorescent RT-PCR assay of peste des petits ruminant vaccine strain viruses, the primer sequence includes a primer pair consisting of an upstream primer PPrV-YM1 and a downstream primer PPrV-YM2, the sequences of the upstream primer PPrV-YM1 and the downstream primer PPrV-YM2 are AGGCAGCAAGCCGCAGA and TCCGGTGGTG TCGGATGTGT, or the primer sequence includes a primer pair consisting of the complementary sequence TCCGTCGTTCGGCGTCT of the upstream primer and the complementary sequence AGGCCACCACAGCCTACACA of the downstream primer. The sequence of the probe PPrV-YMp is CCTGTTTACCGCTGGCGTCTCCG, or the complementary sequence of the probe PPrV-YMp is GGACAAATGGCGACCGCAGAGGC. The invention has the advantages of reliable, accurate and sensitive result, time and labor saving, assay cost reduction, assay efficiency increase and the like, is easy to operate, and is particularly suitable for the rapid assay of a large quantity of samples and the rapid diagnosis of emergency epidemics.
Owner:SHENZHEN AUDAQUE DATA TECH

Primers and probe for detecting peste des petits ruminants virus and kit

The invention provides a genetic marker, real-time fluorescence quantitative PCR (polymerase chain reaction) primers and a probe used for detecting peste des petits ruminants through the N gene sequencing and comparison of the peste des petits ruminants, and the nucleotide sequences of the genetic marker, the primers and the probe are respectively disclosed in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention also provides a quantitive detection method and a detection kit for the peste des petits ruminants virus. The detection method and the detection kit disclosed by the invention have the advantages of accuracy in detection, high flexibility, strong specificity, easiness and rapidness, and the specimen detection capacity is good.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Anti-peste des petits ruminants virus N protein monoclonal antibody and application thereof

The invention belongs to the technical field of biological immunoassay, and more specifically relates to an anti-peste des petits ruminants virus N protein monoclonal antibody and an application thereof. The invention discloses the anti-peste des petits ruminants virus N protein monoclonal antibody, which is secreted by a hybridoma cell strain with a preservation number being CCTCC C2016135. The invention also discloses a preparation method and a purpose of the monoclonal antibody. The monoclonal antibody has strong specificity and good biological binding activity, can be reacted with Vero cells infected by peste des petits ruminants virus, and cannot be reacted with the normal Vero cells. The monoclonal antibody can be used for preparing a kit for detecting the peste des petits ruminantsvirus, is used for detecting peste des petits ruminants virus, and has the advantages of high detection specificity and high reaction sensitivity.
Owner:HUAZHONG AGRI UNIV

Recombinant peste des petits ruminants virus N protein and expression method and application thereof

The invention provides a recombinant peste des petits ruminants virus N protein and an expression method and an application thereof. The recombinant peste des petits ruminants virus N protein has the amino acid sequence shown in SEQ ID NO:1. The invention also provides a CHO-PPRV-N cell line for stably expressing the recombinant peste des petits ruminants virus N protein, wherein the CHO-PPRV-N cell line has the preservation number of CGMCC No.12281. The invention further provides a kit used for detecting peste des petits ruminants and containing the recombinant peste des petits ruminant virus N protein.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Peste des petits ruminant virus antibody detection kit based on IPMA

The invention provides a peste des petits ruminants virus antibody detection kit based on an immunoperoxidase monolayer assay (IPMA). The kit comprises a 96-well cell culture plate containing intracellular positive antigens and intracellular negative antigens, positive control serum, negative control serum, sample diluents, saline scrubbing solutions, HRP labeled mouse anti-goat McAb, two-component AEC colorimetric solutions, stop solutions, a serum diluting plate and an operating instruction. The intracellular positive antigens are BHK-gSLAM cells infected by a peste des petits ruminant virus rPPRV / GFP, the intracellular negative antigens are BHK-gSLAM cells not infected by the peste des petits ruminant virus, the positive control serum is immune positive serum obtained through blood sampling and separating after a goat is immunized by peste des petits ruminants virus vaccine strains PPRV N75 / 1, and the neutralizing titer is above 1:160; the negative control serum is negative serum obtained through direct blood sampling and separating from a non-immunized peste des petits ruminants negative goat.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Primer group for identifying peste des petits ruminant virus wild strain and vaccine strain and application thereof

The invention discloses a diagnostic kit for identifying a peste des petits ruminant virus wild strain and a vaccine strain and an application thereof. The diagnostic kit provided by the invention comprises two pairs of primers, i.e. a primer pair which is combined with an H gene in a peste des petits ruminant virus Nigeria 75 / 1 vaccine strain genome (GenBank Accession Number X74443) and a primer pair which is combined with the H gene in a peste des petits ruminant virus Tibet 07 wild strain genome (GenBank Accession Number JF939201). The diagnostic kit for identifying the peste des petits ruminant virus wild strain and the vaccine strain has high detection sensitivity, can detect 200 replicated target ribonucleic acids (RNA) to the minimum extent, has good specificity, is simple and convenient to operate, can effectively identify peste des petits ruminant virus vaccine immune sheep and wild virus infected sheep, and is in particular suitable for monitoring and detecting peste des petits ruminants.
Owner:CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT

Kit for detecting peste des petits ruminants virus by utilizing pyrophosphoric-acid sequencing technology

The invention provides a kit for detecting peste des petits ruminants virus by a pyrophosphoric-acid sequencing technology. The kit comprises a general primer for detecting peste des petits ruminants and a pyrophosphoric-acid sequencing primer, and the nucleotide sequences are respectively shown in SEQ ID NO.2-4. The kit adopts the following steps of by extracting the RNA of a sample to be detected, carrying out RT-PCR amplification by the general primer; if the length of the amplified fragment of the primer is 78bp, carrying out pyrophosphoric-acid sequencing reaction; if the sequencing fragment is completely the same as N gene target fragments (SEQ ID NO.1), determining to be the peste des petits ruminants virus; if one or more than one basic groups of the sequencing fragment are different from those of the target fragment, determining that the sample is negative. The kit provided by the invention can be used for rapidly detecting the peste des petits ruminants virus, has the characteristics of high flux and low cost, and has the advantages that the products can be directly used for sequencing, secondary treatment is not needed, the operation is extremely convenient, and the needed sample amount is less, so that the application prospect is good.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

Primer composition for detecting mycoplasma sheep pneumoniae and peste des petits ruminants virus, kit and application

The invention provides a primer composition for detecting mycoplasma sheep pneumoniae and peste des petits ruminants virus, a kit and application, and belongs to the field of biotechnology and molecular biology. The primer composition for detecting mycoplasma sheep pneumoniae and peste des petits ruminants virus includes a primer pair A and a primer pair B, the primer pair A includes a primer 1 and a primer 2, the primer pair B includes a primer 3 and a primer 4, and the nucleotide sequences of the primers 1-4 are shown as SEQIDNO:1-4. The primer composition can be used for detecting mycoplasma sheep pneumoniae and peste des petits ruminants virus simultaneously or individually, operation is simple, the specificity is high, the sensitivity is high, and the detection efficiency is remarkably improved. The situation is avoided that one pathogen can only be detected at a time, the time is saved, pollution is avoided, rapid detection of clinical respiratory disease samples is facilitated,and the primer composition has broad application prospects.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Gene-modified peste des petits ruminants N gene and modification method and chemical synthesis thereof

ActiveCN102108359AQuick and easy synthetic reactionBacteriaFermentationChemical synthesisGene
The invention provides a modified coded nucleic acid of peste des petits ruminants virus N protein which has a sequence of SEQ ID NO:41, and also provides its PCR amplification method and a kit used for the method.
Owner:杨凌金海生物技术有限公司

Method for constructing peste des petits ruminant transgenic plant vaccine efficient expression vector

InactiveCN104498527APrevention of Peste des Petits RuminantsVector-based foreign material introductionGenetic engineeringGMO Plants
The invention relates to recombinant vector construction in the technical field of genetic engineering, in particular to construction used for recombining an efficient expression vector used for preventing and treating peste des petits ruminants. The expression vector comprises F protein genes of F proteins in PPRV and five kinds of recombinant plasmids connected with the genes, wherein the five recombinant plasmids include the pBI121-F, the 121-C-F-M12-M34, the 121-C-FKDEL-M12-M34, the 121-C-G-F-M12-M34 and the 121-C-G-FKDEL-M12-M34; and the gene sequence can be seen in a sequence table.
Owner:QINGDAO AGRI UNIV

Peste des petits ruminants virus CH/GDDG/2014 strain whole genome sequence and amplification primer pair thereof

The invention discloses a peste des petits ruminants virus CH / GDDG / 2014 strain whole genome sequence and an amplification primer pair thereof. The virus genome sequence is divided into 11 segments, corresponding cDNA is amplified by using a one-step RT-PCR method, and amplified PCR segments are cloned onto a pGM-T carrier for nucleic acid sequencing. By the virus genome sequence, target segments can be amplified effectively; the whole genome sequence is provided, and studying of genetics, molecular epidemiology and reverse genetics of peste des petits ruminants virus is facilitated.
Owner:INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI

Gold standard test paper for detecting antigens of peste des petits ruminants and preparation method thereof

The invention discloses gold standard test paper for detecting antigens of peste des petits ruminants and a preparation method thereof. The gold standard test paper contains a bottom plate, as well as a sample adding absorption pad, an immunogold standard pad constituted by a glass cellulose membrane adsorbing a gold standard antigen, a nitrocellulose membrane and a water absorption pad which are sequentially linked on the bottom plate, wherein a detection line and a quality control line are contained on the nitrocellulose membrane, the detection line on the immunogold standard pad is constituted by part of recombinant proteins N1-N4 of N genes after optimization of prokaryotic expression, and the quality control line is an anti-N1-N4 recombinant protein rabbit IgG antibody. The gold standard test paper disclosed by the invention has the characteristics of fast speed, simplicity, convenience, intuition, sensitivity, accuracy and relatively low detection cost.
Owner:祁光宇

Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus

The invention discloses a reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of the peste des petits ruminants virus. The reagent kit comprises amplification premixed solution, negative control, positive control and a mixture of SEQIDNO.1 to SEQIDN0.2 amplification primers and an SEQIDNO.3 probe primer. The reagent kit has the advantages that variation of each circular amplicon in PCR (polymerase chain reaction) is tested in real time by the aid of variation of fluorescence signals, a starter template is subjected to quantitative analysis through the relation of Ct values and a standard curve, and the test kit used for testing the peste des petits ruminants virus is high in specificity, good in stability and easy to operate; the test kit has higher sensitivity than common PCR and can be used for testing the peste des petits ruminants virus of low and micro-content samples; the test kit is applicable to not only quantitative analysis of research units but also pathogen testing analysis of prevention and control units at all levels, base veterinary stations and large and medium-sized livestock farms and the like, thereby having good application prospect.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Peste des petits ruminant virus HN protein epitope peptide as well as determination and preparation method and application thereof

The invention relates to peste des petits ruminant virus HN protein epitope peptide. The amino acid sequences of the epitope peptide are as follows: H123: <123>KFLNPDREYDFRDLR<137>, or / and H185: <185>GTGCLGRTVTRA<196>, or / and H487: <487>IRGPRGRCH<495>, or / and H569: <569>ECFPWYHKVWCYHDCLI<585>. B cell epitopes of a target protein are predicted by virtue of multiple immunoinformatic software, the different predicted epitopes are respectively artificially synthesized, the reactogenicity of the predicted epitopes is verified by virtue of an indirect ELISA method, an aminated ELISA Plate is coated with different polypeptides, and the reactogenicity with an antibody of HN protein is detected, and therefore, the B cell epitopes of the PPRV HN protein are authenticated.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Nanometer immunogold labeling probe for detecting peste des petits ruminants virus (PPRV) and detection kit

The invention provides a nanometer immunogold labeling probe for detecting a peste des petits ruminants virus (PPRV) and a detection kit. Two specific oligonucleotide probes are designed by aiming at a highly conserved region of an N gene of the PPRV. The nucleotide sequence of the 5' modified biotin of one of the probes and the nucleotide sequence of the 3' modified sulfydryl of the other probe are respectively shown by SEQ ID NO.2 and SEQ ID NO.3. The invention also provides a method for detecting the nucleic acid of the PPRV by utilizing the nanometer immunogold labeling oligonucleotide probe. The sulfhydrylated probes are respectively connected onto nanometer gold particles through Au-S bonds; both ends of the targeted nucleic acid are respectively bonded with the two probes to form a hybrid compound, and the targeted nucleic acid is quantitatively detected through bonding the hybrid compound with a solid-phase carrier and performing silver staining on an amplifying signal. According to the detection method provided by the invention, the minimum concentration of the nucleic acid reaches 10fmol / L. The method is high in sensitivity and strong in specificity. A novel method is provided for clinically detecting the PPRV.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants

The invention discloses methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of a V protein of peste des petits ruminants. The methods include: establishing a prokaryotic expression vector pGEX-4T-V for a V gene of a peste des petits ruminant virus; identifying recombined pGEX-4T-V protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gelelectrophoresis) and western-blot; purifying the pGEX-4T-V protein and testing concentration; preparing the monoclonal antibody for a recombined pGEX-4T-V protein-immunized mice; preparing ascitic fluid of the monoclonal antibody; preparing the monoclonal antibody through polypeptide synthesis of a segment (a known sequence) of the V gene of the peste des petits ruminants; expressing the V protein of the peste des petits ruminants in eukaryotic expression; subjecting three monoclonal antibodies to indirect immunofluorescence, classification test and the like. The methods provide a reliable technical guarantee and support for diagnosis of the genetic engineering vaccine of the peste des petits ruminants.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI

Primer and method for detecting peste des petits ruminant virus and bluetongue virus

The invention provides a primer and method for detecting a peste des petits ruminant virus and a bluetongue virus. According to the invention, a screened primer combination is designed, and finally itis achieved for the first time that in the same reaction tube, the peste des petits ruminant virus (PPRV) and the bluetongue virus (BTV) are simply, rapidly and accurately identified through a multiple-fluorescence RT-LAMP detection method. The multiple-fluorescence RT-LAMP primer and the method for detecting the peste des petits ruminant virus and the bluetongue virus are good in specificity, high in sensitivity and small in interference, can detect 100 mixed template copies / reactions at the minimum, and can effectively inhibit false positive results. By adopting the primer and the method, visual and accurate result judgment is achieved through differences of colors displayed by fluorescent groups, amplification can be completed only by one water bath kettle, the cost is low, the operation is convenient, the method is simple, convenient, rapid and low-cost diagnosis method, and the primer and the method are suitable for large-scale epidemiological investigation of the BTV and PPRV.
Owner:GUANGXI VETERINARY RES INST