427 results about "Expression protein" patented technology

The invention discloses a site for stably expressing protein in a CHO cell gene NW023276806.1 and application of the site, and belongs to the technical field of biological genes. The site belongs to a fixed position in a CHO cell genome, different protein genes are introduced based on a micro-homologous end connection mechanism through a CRISPR / Cas9 tool, and stable expression is carried out. By adopting a site-specific integration method, a target gene is integrated to a stable expression area in a site-specific manner, repeated high-expression monoclonal screening is effectively avoided, and an MMEJ mechanism is introduced to integrate a donor fragment, so that the research and development time for constructing a stable expression cell strain in biological pharmacy can be effectively shortened, and the cost is reduced.

The invention discloses a glycosyl transferase mutant and an application of the glycosyl transferase mutant in synthesis of rebaudioside. According to the invention, single-point mutation and multi-point mutation are carried out on the basis of a glycosyl transferase amino acid sequence as shown in SEQ ID NO: 1, and a mutant with improved catalytic activity is obtained. The catalytic activity, the substrate specificity and / or the substrate specificity of the glycosyl transferase mutant are / is changed, and the catalytic activity of enzyme to a specific substrate can be remarkably improved by mutation at a specific site. And carrying out induced expression and protein purification on the obtained mutation sequence to obtain the mutant enzyme. The mutant enzyme is used as a catalyst, and UDPG is used as a glycosyl donor, so that the catalytic reaction efficiency of substrates such as stevioside ST, rebaudioside A (RebA) and rebaudioside D (RebD) can be obviously improved. According to the glycosyl transferase UGT76G1 mutant constructed by the research, the catalytic activity of the glycosyl transferase UGT76G1 mutant is improved, and efficient production of rebaudioside M is realized by optimizing a reaction system.

The invention relates to a mulberry MaBEH1 / 2 gene for improving plant salt tolerance and application thereof, and belongs to the technical field of plant genetic engineering and biology. Wherein the coding nucleotide sequence of the mulberry MaBEH1 / 2 gene for regulating and controlling the salt tolerance of the woody plant is shown as a sequence 3; and the amino acid sequence of the MaBEH1 / 2 expression protein is shown as a sequence 4. According to the invention, MaBEH1 / 2 is transferred into 84K poplars to obtain MaBEH1 / 2-OE transgenic poplars; compared with a non-transgenic poplar, the salt stress tolerance of the MaBEH1 / 2-OE transgenic poplar can be remarkably enhanced. The invention provides key gene resources and technical support for genetic improvement of salt-tolerant forest varieties.

The invention belongs to the technical field of biological medicine, and particularly relates to a kit for breast cancer diagnosis and application thereof. The kit comprises an elisa plate coated with a captured antibody and an HRP labeled antibody working solution, the capture antibody is a monoclonal antibody T2X-1 of an anti-PSTPIP1 protein; the HRP labeled antibody is a monoclonal antibody Z4Y-2 of an anti-PSTPIP1 protein, and the HRP labeled antibody is a monoclonal antibody Z4Y-2 of an The heavy chain amino acid sequence of the monoclonal antibody T2X-1 is as shown in SEQ ID NO.1, and the light chain amino acid sequence of the monoclonal antibody T2X-1 is as shown in SEQ ID NO.2; the heavy chain amino acid sequence of the monoclonal antibody Z4Y-2 is as shown in SEQ ID NO.3, and the light chain amino acid sequence of the monoclonal antibody Z4Y-2 is as shown in SEQ ID NO.4. The kit for breast cancer diagnosis provided by the invention can be used as an auxiliary diagnosis means for breast cancer with high expression of PSTPIP1 protein, and has high diagnostic value.

The invention belongs to the technical field of genes, and discloses a method for efficiently expressing a foreign protein based on an NC048604-1 site in a CHO cell genome. A site for stably expressing protein in the CHO cell genome is located in the 94142000 to 94148000 basic group range of the CHO cell genome NC048604-1, and the nucleotide sequence of the site is as shown in SEQ ID NO: 1. According to the invention, different protein genes are introduced at fixed positions in a CHO cell genome, and stable expression is carried out.

The present invention provides a novel therapeutic drug for treating a Prom1-associated retinal disease. Specifically, the present invention provides an optimized Prom1 gene expression cassette, an rAAV viral vector, and a gene therapy drug. The drug of the present invention can specifically express the PROM1 protein in the retinal photoreceptor layer, and is suitable for the clinical treatment of a retinal disease associated with Prom1 gene mutation.

The invention discloses a mint McTTG1 gene as well as an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the mint McTTG1 gene disclosed by the invention is shown as SEQ ID NO.1, the amino acid sequence of the expression protein of the mint McTTG1 gene is shown as SEQ ID NO.2, and the mint McTTG1 gene belongs to WD40 family genes participating in regulation and control of epidermal hair development and synthesis of anthocyanin and procyanidine. Transgenic experiments show that after the McTTG1 gene is over-expressed in the arabidopsis thaliana mutant ttg1-13 with epidermal hair loss and significantly reduced accumulation of anthocyanin and procyanidine, the formation of the epidermal hair on the surface of the mutant can be recovered, and the accumulation of anthocyanin and procyanidine can be promoted. Gene resources are provided for plant variety improvement, and cultivation of new mint varieties is facilitated.

The present invention relates to pluripotent stem cell comprising an expression construct for expression of a Myo1B protein. The invention further provides for methods of producing adipocytes comprising the pluripotent stem cells and for foodstuff comprising the adipocytes or pluripotent stem cells.

A recombinant interleukin-27 (IL27) expressing virus is described. The recombinant IL27 expressing virus comprises an oncolytic virus comprising one or more exogenous nucleic acid sequences capable of expressing in IL27 protein or a biologically active portion thereof, the exogenous nucleic acid sequences being operably linked to an expression control sequence. Methods of treating cancer by in a subject by contacting a cancer cell of the subject with a recombinant IL27 expressing virus are also described.

This invention relates to the field of genetic engineering technology, and provides a ZmPHYLL gene, the full-length nucleotide sequence of which is shown in SEQ ID NO: 1, and the coding region nucleotide sequence of which is shown in SEQ ID NO: 2. This invention also provides the application of the above-mentioned ZmPHYLL gene in inhibiting the germination of *Russula multifiliis* spores and improving the resistance of maize plants to southern maize rust. Simultaneously, this invention provides a method for improving the resistance of maize plants to southern maize rust. In this study, a ZmPHYLL gene was screened, and the expressed protein of this gene can effectively inhibit the germination of *Russula multifiliis* spores. Therefore, by regulating the overexpression of this gene, the resistance of maize to southern maize rust can be improved. This invention provides new gene resources for the creation of breeding materials and provides important scientific basis for the breeding of maize varieties highly resistant to southern maize rust.

The invention discloses an NDRV [sigma] C circular RNA vaccine and application thereof, and belongs to the technical field of vaccines.Duck hepatitis A virus type 1 (DHAV-1) UTR and T4 bacteriophage I type intron self-splicing cyclization systems are adopted to construct circular RNA (CirRNA-[sigma] C) for expressing NDRV [sigma] C protein, and a vaccine preparation is prepared through a chitosan-polyethyleneimine (CS-PEI) nano delivery system. The feasibility of a circular RNA vaccine system based on DHAV-1UTR in poultry vaccines is confirmed for the first time, the established nano delivery technology and circular RNA vaccine platform have the characteristics of high stability, good safety, strong immunogenicity and the like, and an important technical path is provided for development of novel vaccines of NDRV and other viral epidemic diseases.

The invention relates to a PagNRT3.1 gene for regulating xylem development of poplar and application of the PagNRT3.1 gene, and belongs to the technical field of plant genetic engineering and biology. The nucleotide sequence of the PagNRT3.1 gene for regulating and controlling the xylem development of the poplar is shown as a sequence 1 in a sequence table; the amino acid sequence of the expression protein of the PagNRT3.1 gene is shown as the sequence 2 in the sequence table. The PagNRT3.1 gene is transferred into poplar 84K, and compared with a wild type, the transgenic poplar over-expressing the PagNRT3.1 has a phenotype with increased xylem width, which indicates that the PagNRT3.1 gene is the key for regulating and controlling the development of the xylem of the poplar and has important application value in the field of high-yield genetic engineering of forest trees.

The invention belongs to the technical field of genes, and discloses a method for efficiently expressing foreign protein based on an NC048599.1 site in a CHO cell genome. A site for stably expressing a protein in a CHO cell genome is located in a range of 69195000 to 69199000 of a CHO cell gene NC048599.1 with a sequence as shown in SEQ ID NO: 1 (Sequence Identifier Number 1), and the sequence of the CHO cell gene NC048599.1 is shown in SEQ ID NO: 1. Different protein genes are introduced at fixed positions in a CHO cell genome, and stable expression is carried out.

The invention belongs to the field of biological detection, and particularly relates to a kit for detecting the content of exosome CD82 protein. The kit comprises a standard substance, an elisa plate coated with a CA1 antibody, a CA2 antibody working solution marked by HRP, a buffer solution, a developing solution and a reaction stop solution. The kit provided by the invention can specifically detect the content of the CD82 protein in the blood exosome, has the advantages of simple and convenient detection method, high accuracy, good stability and the like as an auxiliary diagnosis means for gastric cancer with high content of the CD82 protein, and has a good application prospect.

The invention provides a novel therapeutic drug for treating Prom1 related retinal diseases. Specifically, the invention provides an optimized Prom1 gene expression cassette, an rAAV virus vector and a gene therapy drug. The medicine provided by the invention can specifically express the PROM1 protein in a retina photoreceptor layer, and is suitable for clinical application to treatment of Prom1 gene mutation related retinal diseases.

The invention belongs to the technical field of biology, and discloses a method for screening plant interaction protein by combining big data with artificial intelligence and verifying protein interaction by using yeast two-hybrid. According to the method, AI is combined with big data, and co-expression protein of family protein is obtained through big data screening and analysis; aI interaction prediction and molecular docking are carried out on the proteins, and interaction information is further analyzed and extracted. And further analyzing the condition of the screened interaction protein by using a yeast two-hybridization or fluorescence co-localization experiment. According to the method, aiming at the characteristics of complex genomes and abundant sequencing data of species such as wheat, public sequencing data is creatively utilized to carry out an interaction protein screening process of subgenomes. The problems of long protein screening period, high cost, large workload, false positive protein screening, no co-expression and the like are solved. The interaction relationship between important gene families can be quickly and conveniently obtained, the interaction structural domain can be accurately and clearly found, and technical support is provided for research on analysis of a wheat key gene functional mechanism.

The invention relates to the technical field of plant genetic engineering, in particular to an application of a poplar PtbHLH47 gene and an encoding protein thereof in improving the salt tolerance of plants. The invention discloses application of a PtbHLH47 gene to improvement of plant salt tolerance and improvement of chlorophyll content of plant leaves. The nucleotide sequence of the PtbHLH47 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the expression protein of the PtbHLH47 gene is as shown in SEQ ID NO. 2. PtbHLH47 genes are cloned from populus tomentosa leaves, overexpressed PtbHLH47 transgenic populus tomentosa is obtained through an agrobacterium tumefaciens-mediated populus genetic transformation system, salt tolerance evaluation shows that the salt tolerance of the overexpressed PtbHLH47 transgenic populus tomentosa is remarkably improved, particularly, the chlorophyll content in the populus tomentosa leaves under salt stress can be remarkably improved, and the chlorophyll content in the populus tomentosa leaves under salt stress can be remarkably reduced. And gene resources are provided for cultivating salt-tolerant plants.

Provided herein are engineered Epstein-Barr virus nuclear antigen 1 (EBNA1), coding molecules thereof, vectors and mammalian cell expression systems comprising the same, and polypeptide of interest recombinantly produced by the foregoing. Also provided are methods for the preparation of the engineered EBNAls, coding molecules thereof, vectors and mammalian cell expression systems and methods for using the same in recombinant expression.

The present invention discloses an application and method of a SPILR protein for improving plant resistance to Pseudomonas syringae, belonging to the field of agricultural science and technology. Specifically, the method comprises using Pseudomonas syringae to induce expression of the SPILR protein in Arabidopsis leaves, constructing an expression vector pCambia1300-SPILR containing the nucleotide sequence of the SPILR protein, transforming the expression vector into Agrobacterium tumefaciens GV3101 competent cells, culturing the cells, and infecting plant leaves to obtain Pseudomonas syringae-resistant plants. Therefore, genetic engineering techniques can be used to cultivate resistant varieties.

The invention relates to a PagNLP8 / 9a gene for regulating xylem development of poplar and application of the PagNLP8 / 9a gene, and belongs to the technical field of plant genetic engineering and biology. The nucleotide sequence of the PagNLP8 / 9a gene for regulating and controlling the development of the xylem of the poplar is shown as a sequence 1 in a sequence table; the amino acid sequence of the expression protein of the PagNLP8 / 9a gene is as shown in the sequence 2 in the sequence table. The PagNLP8 / 9a gene is transferred into poplar 84K, and compared with a wild type, the transgenic poplar over-expressing the PagNLP8 / 9a has a phenotype with increased xylem width, which indicates that the PagNLP8 / 9a gene is the key for regulating the development of the xylem of the poplar and has important application value in the field of high-yield genetic engineering of forest trees.

The invention discloses an immunofluorescence imaging method for driving tyramine signal amplification based on chemiluminescence and application thereof, and relates to the technical field of biomedical imaging. The immunofluorescence imaging method comprises the following steps: carrying out first incubation on a to-be-detected sample and a peroxidase-labeled antibody; performing second incubation on the to-be-detected sample after the first incubation and a tyramine substrate containing a fluorophore under a dark condition; adding a chemiluminescent substrate solution into the to-be-detected sample after the second incubation, and carrying out image acquisition; wherein the antibody can be specifically bound with a target protein; the tyramine substrate can generate active free radicals under the catalysis of peroxidase, so that the active free radicals are covalently cross-linked with tyrosine residues; the chemiluminescent substrate solution comprises hydrogen peroxide and luminol. The immunofluorescence imaging method improves imaging signal and fluorescence stability, effectively reduces background interference and phototoxicity, is suitable for long-time stable fluorescence immunoimaging, and is especially suitable for high-sensitivity detection of low-expression protein markers.

The invention discloses a gingko GbDRF2 gene as well as an expression protein and application thereof, and belongs to the field of plant molecular biology. The GbDFR2 gene is obtained by analyzing and screening based on data of a ginkgo transcriptome in the earlier stage of a research group, the nucleotide sequence of the GbDFR2 gene is shown as SEQ ID NO.1, and the amino acid sequence of expression protein of the GbDFR2 gene is shown as SEQ ID NO.2. A GbDFR2 overexpression vector is constructed and nicotiana benthamiana is transformed, so that the synthesis of flavonoid substances in a transgenic plant is obviously changed, the contents of 9 flavonoid substances such as sakuranetin and 3, 7-dimethyl quercetin are increased, and the contents of 10 metabolites such as naringin and chalcone are decreased. The invention discloses a regulation effect of the ginkgo GbDFR2 gene in synthesis of flavonoid compounds, and provides a theoretical basis and a molecular tool for improving plant secondary metabolites through genetic engineering.

The present application relates to the technical field of plant genetic breeding, and particularly relates to a Brassica campestris fatty acyl reductase BcFAR2 gene, an expression protein thereof and application, a base sequence of the Brassica campestris fatty acyl reductase BcFAR2 gene is shown as SEQ ID NO. 1, and an amino acid sequence of the expression protein is shown as SEQ ID NO. 2, the Brassica campestris fatty acyl reductase BcFAR2 gene is cloned, and BcFAR2 gene overexpression Brassica campestris sterile plants can restore pollen activity; gene knockout Brassica campestris fertile plants can significantly reduce pollen activity; in Arabidopsis thaliana, overexpression of the gene can significantly improve salt tolerance of the transgenic plants; and in Brassica campestris, overexpression of the gene can significantly enhance salt tolerance.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The present invention discloses an application of an insect virus FHV RNA1 replicon in exogenous gene amplification, wherein the application amplifies the exogenous gene at the mRNA level by utilizing the autonomous replication ability of the insect virus FHV RNA1 replicon; the present invention discloses a plasmid system based on the insect virus FHV RNA1 replicon and a method for constructing the plasmid system; the present invention also discloses a method and application of the plasmid system for expressing proteins in cells, wherein the plasmid system is used to obtain a cloning vector after double enzyme digestion, and after homologous recombination with an exogenous gene, the animal or plant protein is expressed in the cell.

The application discloses an antibody drug conjugate, which comprises the following formula 1: formula 1 wherein Ab is an antibody or antibody fragment for targeting Lewis Y, and j is 1-8, preferably 4-8. The antibody drug conjugate disclosed by the application can be combined with tumor cells expressing Lewis Y protein with high specificity, thereby achieving excellent killing effect on cells.

The present invention relates to a signal sequence for expressing a CRM197 protein in Escherichia coli and secreting same into the periplasm, and a use thereof, and more specifically, to: a signal sequence for expressing a CRM197 protein; a nucleic acid for coding the signal sequence; a nucleic acid construct or expression vector comprising the nucleic acid and a CRM197 protein gene; a recombinant microorganism having the nucleic acid construct or expression vector introduced therein; and a CRM197 protein production method comprising a step for culturing the recombinant microorganism. According to the present invention, a CRM197 protein having the same physicochemical / immunologic properties as the protein isolated from the parent bacteria may be expressed even in regular Escherichia coli of which a redox potential is not adjusted, and a CRM197 protein having high periplasmic secretion efficiency may be produced even without shifting the pH of a culture medium in order to increase secretion into the periplasm, and thus the present invention is very useful in CRM197 protein production.

The present invention relates to a dual functional domain structure and its uses. The dual functional domain according to the present invention includes a first domain that binds to a disease-site-specific expression protein and a second domain that binds to a disease-specific expression protein. In this case, the first domain serves to mask the drug's function at a non-disease site, thereby enabling disease-site-specific drug delivery. In addition, the first domain is cleaved by a proteolytic enzyme specifically expressed at the disease site to induce drug activity and exhibit drug activity in a disease-site-specific manner. Furthermore, the multispecific fusion protein comprising the dual functional domain structure can be designed in various forms to encompass various functions.Therefore, the dual functional domain structure and the multispecific fusion protein comprising the dual functional domain structure according to the present invention can be used for various applications as an alternative to conventional antibodies.

The disclosure relates to host cells comprising a nucleic acid encoding an oligopeptide transporter B (OptB) protein variant, the corresponding OptB protein variants, and to methods of use thereof, such as methods of producing a protein of interest in said host cells.

The application describes ceDNA vectors having linear and continuous structure for delivery and expression of a transgene. ceDNA vectors comprise an expression cassette flanked by two ITR sequences, where the expression cassette encodes a transgene encoding FVIII protein. Some ceDNA vectors further comprise cis-regulatory elements, including regulatory switches. Further provided herein are methods and cell lines for reliable gene expression of FVIII protein in vitro, ex vivo and in vivo using the ceDNA vectors. Provided herein are method and compositions comprising ceDNA vectors useful for the expression of FVIII protein in a cell, tissue or subject, and methods of treatment of diseases with said ceDNA vectors expressing FVIII protein. Such FVIII protein can be expressed for treating disease, e.g., hemophilia A.