257 results about "Expression protein" patented technology

The invention discloses a glycosyl transferase mutant and an application of the glycosyl transferase mutant in synthesis of rebaudioside. According to the invention, single-point mutation and multi-point mutation are carried out on the basis of a glycosyl transferase amino acid sequence as shown in SEQ ID NO: 1, and a mutant with improved catalytic activity is obtained. The catalytic activity, the substrate specificity and / or the substrate specificity of the glycosyl transferase mutant are / is changed, and the catalytic activity of enzyme to a specific substrate can be remarkably improved by mutation at a specific site. And carrying out induced expression and protein purification on the obtained mutation sequence to obtain the mutant enzyme. The mutant enzyme is used as a catalyst, and UDPG is used as a glycosyl donor, so that the catalytic reaction efficiency of substrates such as stevioside ST, rebaudioside A (RebA) and rebaudioside D (RebD) can be obviously improved. According to the glycosyl transferase UGT76G1 mutant constructed by the research, the catalytic activity of the glycosyl transferase UGT76G1 mutant is improved, and efficient production of rebaudioside M is realized by optimizing a reaction system.

The invention belongs to the technical field of biological medicine, and particularly relates to a kit for breast cancer diagnosis and application thereof. The kit comprises an elisa plate coated with a captured antibody and an HRP labeled antibody working solution, the capture antibody is a monoclonal antibody T2X-1 of an anti-PSTPIP1 protein; the HRP labeled antibody is a monoclonal antibody Z4Y-2 of an anti-PSTPIP1 protein, and the HRP labeled antibody is a monoclonal antibody Z4Y-2 of an The heavy chain amino acid sequence of the monoclonal antibody T2X-1 is as shown in SEQ ID NO.1, and the light chain amino acid sequence of the monoclonal antibody T2X-1 is as shown in SEQ ID NO.2; the heavy chain amino acid sequence of the monoclonal antibody Z4Y-2 is as shown in SEQ ID NO.3, and the light chain amino acid sequence of the monoclonal antibody Z4Y-2 is as shown in SEQ ID NO.4. The kit for breast cancer diagnosis provided by the invention can be used as an auxiliary diagnosis means for breast cancer with high expression of PSTPIP1 protein, and has high diagnostic value.

The invention relates to a PagNRT3.1 gene for regulating xylem development of poplar and application of the PagNRT3.1 gene, and belongs to the technical field of plant genetic engineering and biology. The nucleotide sequence of the PagNRT3.1 gene for regulating and controlling the xylem development of the poplar is shown as a sequence 1 in a sequence table; the amino acid sequence of the expression protein of the PagNRT3.1 gene is shown as the sequence 2 in the sequence table. The PagNRT3.1 gene is transferred into poplar 84K, and compared with a wild type, the transgenic poplar over-expressing the PagNRT3.1 has a phenotype with increased xylem width, which indicates that the PagNRT3.1 gene is the key for regulating and controlling the development of the xylem of the poplar and has important application value in the field of high-yield genetic engineering of forest trees.

Provided herein are engineered Epstein-Barr virus nuclear antigen 1 (EBNA1), coding molecules thereof, vectors and mammalian cell expression systems comprising the same, and polypeptide of interest recombinantly produced by the foregoing. Also provided are methods for the preparation of the engineered EBNAls, coding molecules thereof, vectors and mammalian cell expression systems and methods for using the same in recombinant expression.

The invention relates to a PagNLP8 / 9a gene for regulating xylem development of poplar and application of the PagNLP8 / 9a gene, and belongs to the technical field of plant genetic engineering and biology. The nucleotide sequence of the PagNLP8 / 9a gene for regulating and controlling the development of the xylem of the poplar is shown as a sequence 1 in a sequence table; the amino acid sequence of the expression protein of the PagNLP8 / 9a gene is as shown in the sequence 2 in the sequence table. The PagNLP8 / 9a gene is transferred into poplar 84K, and compared with a wild type, the transgenic poplar over-expressing the PagNLP8 / 9a has a phenotype with increased xylem width, which indicates that the PagNLP8 / 9a gene is the key for regulating the development of the xylem of the poplar and has important application value in the field of high-yield genetic engineering of forest trees.

The invention discloses an immunofluorescence imaging method for driving tyramine signal amplification based on chemiluminescence and application thereof, and relates to the technical field of biomedical imaging. The immunofluorescence imaging method comprises the following steps: carrying out first incubation on a to-be-detected sample and a peroxidase-labeled antibody; performing second incubation on the to-be-detected sample after the first incubation and a tyramine substrate containing a fluorophore under a dark condition; adding a chemiluminescent substrate solution into the to-be-detected sample after the second incubation, and carrying out image acquisition; wherein the antibody can be specifically bound with a target protein; the tyramine substrate can generate active free radicals under the catalysis of peroxidase, so that the active free radicals are covalently cross-linked with tyrosine residues; the chemiluminescent substrate solution comprises hydrogen peroxide and luminol. The immunofluorescence imaging method improves imaging signal and fluorescence stability, effectively reduces background interference and phototoxicity, is suitable for long-time stable fluorescence immunoimaging, and is especially suitable for high-sensitivity detection of low-expression protein markers.

The present application relates to the technical field of plant genetic breeding, and particularly relates to a Brassica campestris fatty acyl reductase BcFAR2 gene, an expression protein thereof and application, a base sequence of the Brassica campestris fatty acyl reductase BcFAR2 gene is shown as SEQ ID NO. 1, and an amino acid sequence of the expression protein is shown as SEQ ID NO. 2, the Brassica campestris fatty acyl reductase BcFAR2 gene is cloned, and BcFAR2 gene overexpression Brassica campestris sterile plants can restore pollen activity; gene knockout Brassica campestris fertile plants can significantly reduce pollen activity; in Arabidopsis thaliana, overexpression of the gene can significantly improve salt tolerance of the transgenic plants; and in Brassica campestris, overexpression of the gene can significantly enhance salt tolerance.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The application discloses an antibody drug conjugate, which comprises the following formula 1: formula 1 wherein Ab is an antibody or antibody fragment for targeting Lewis Y, and j is 1-8, preferably 4-8. The antibody drug conjugate disclosed by the application can be combined with tumor cells expressing Lewis Y protein with high specificity, thereby achieving excellent killing effect on cells.

The present invention relates to a dual functional domain structure and its uses. The dual functional domain according to the present invention includes a first domain that binds to a disease-site-specific expression protein and a second domain that binds to a disease-specific expression protein. In this case, the first domain serves to mask the drug's function at a non-disease site, thereby enabling disease-site-specific drug delivery. In addition, the first domain is cleaved by a proteolytic enzyme specifically expressed at the disease site to induce drug activity and exhibit drug activity in a disease-site-specific manner. Furthermore, the multispecific fusion protein comprising the dual functional domain structure can be designed in various forms to encompass various functions.Therefore, the dual functional domain structure and the multispecific fusion protein comprising the dual functional domain structure according to the present invention can be used for various applications as an alternative to conventional antibodies.

The invention belongs to the technical field of biology, and particularly relates to a porcine pseudorabies virus gB-gD recombinant fusion protein subunit vaccine as well as a preparation method and application thereof. According to the invention, the PRV gB and gD genes are selected to serially express the gBgD protein to prepare the vaccine, the gB and gD proteins which are respectively expressed are replaced, and the vaccine is high in safety and good in immunogenicity, can effectively prevent the occurrence of a pseudorabies virus virulence enhancement event when being clinically used, provides a powerful space for purification of pseudorabies, and has a wide application prospect.

Provided is a technique relating to codon optimization. A method for optimizing a nucleic acid sequence for expression of a protein in a host comprises: obtaining a protein subsequence-nucleic acid subsequence pair according to collected highly expressed protein sequences and encoding nucleic acid sequences thereof, so as to form a training set; using the training set to train a neural machine translation model, wherein the neural machine translation model is used to realize translation from an amino acid sequence to a codon sequence; cleaving the protein sequence requiring codon optimization into protein subsequences; using the trained neural machine translation model to translate the protein subsequences from amino acid sequences to codon sequences; and overlapping the translated subsequences, so as to combine same into a full-length codon sequence, wherein during overlapping to synthesize the codon sequence, the synonymous codon with the highest occurrence frequency or number is selected as the optimal codon for the position according to the frequency or the number of the synonymous codon corresponding to each amino acid position of the protein sequence.

In the present invention, an antibody or antigen-binding fragment thereof that specifically binds to an extracellular region of the CD179b protein expressed on a cell surface and has the ability to be internalized into cells expressing the CD179b protein on the cell surface can be used as an intracellular drug delivery agent for delivering a drug into cells expressing the CD179b protein on the cell surface.

The invention discloses a method for improving salt resistance of plants. According to the method, an LSU3 gene coding sequence shown in SEQ ID NO: 1 is introduced into a plant cell and an LSU3 protein is expressed, so that the viability and the growth condition of the plant in a salt stress environment are remarkably enhanced. The invention further provides a recombinant expression vector containing the gene, a construction method of the recombinant expression vector and a specific application scheme of the recombinant expression vector in improvement of the salt resistance of arabidopsis thaliana, and effective gene resources and technical means are provided for salt-resistant breeding of crops.

The invention discloses application of a TaSMAX1 protein and a coding gene thereof in improving the gelatinization characteristic of wheat starch, and belongs to the technical field of biology. The protein is shown as SEQ ID NO: 2, and the coding gene of the protein is 58th to 3123th sites of SEQ ID NO: 1. Experiments prove that compared with receptor wheat Fielder, the stability index breakdown value and low ebb viscosity of TaSMAX1 protein overexpressed strain starch are obviously improved, the gelatinization temperature is reduced, the food processing performance is improved, and it is proved that overexpressed TaSMAX1 protein can effectively improve the gelatinization characteristic of wheat starch. The invention provides an excellent gene resource and a technical path for cultivating high-yield and high-quality wheat varieties, and has a wide application prospect.

The application discloses a codon-optimized Cas12i3 protein coding gene and application thereof. Specifically disclosed is a DNA molecule, and a nucleotide sequence of the DNA molecule is SEQ ID No. 3. The application also discloses a gene editing system containing the DNA molecule and a method for improving the efficiency of Cas12i3 protein-mediated gene editing. In order to better apply the Cas12i3 protein to mammalian gene editing, different codon optimization schemes are designed, and through software evaluation and experimental verification, a codon optimization scheme with good Cas12i3 expression and editing effect is compared and screened. The application screens the codon optimization scheme for efficiently expressing the Cas12i3 protein in mammals, which can greatly improve the editing efficiency of the Cas12i3 protein, lays a foundation for the wide application of the Cas12i3 protein in mammals, and has great practical application value.

The application discloses a novel double-carrier expression system for protein expression and a construction method and application thereof. The novel double-carrier expression system for protein expression comprises a first carrier containing a nucleotide sequence for coding a first functional domain of glutamine synthetase and a nucleotide sequence of light chain and heavy chain of a protein to be expressed; and a second carrier containing a nucleotide sequence for coding a second functional domain of glutamine synthetase and a nucleotide sequence of a ScFv sequence of the protein to be expressed, and an amino acid sequence of the glutamine synthetase is composed of the first functional domain and the second functional domain. By using the expression system, the transfection efficiency and screening efficiency are greatly improved, and the expression amount of the target protein is obviously increased.

The invention belongs to the technical field of bacterial plasmid editing, and particularly relates to miniature DNA nuclease as well as a preparation method and application thereof. The preparation method of the micro DNA nucleotidase comprises the following steps: carrying out expression on a p15A-IscB-2. 0 plasmid, so as to obtain the micro DNA nucleotidase. Wherein the nucleotide sequence of the p15A-IscB-2 plasmid is shown as SEQ ID NO.2, and the p15A-IscB-2 plasmid is obtained by performing synonymous mutation on a 5 '-AACNNNNNNGYGC-3' sequence in an IscB gene in p15A-IscB. The p15A-IscB-2 plasmid disclosed by the invention is non-toxic to escherichia coli, can express an IscB protein, and is high in conversion efficiency, so that the p15A-IscB-2 plasmid can be directly used for gene editing of escherichia coli.

This invention discloses a laccase gene PmLAC31 derived from *Pinus massoniana* and its applications, belonging to the field of plant genetic engineering technology. The nucleotide sequence of the *PmLAC31* laccase gene is shown in SEQ ID NO.1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.2. This invention also provides biomaterials containing the gene, and the application of this gene or biomaterials in improving plant drought resistance and / or lignin content. Experiments show that heterologous overexpression of the PmLAC31 gene in poplar significantly promotes lignin deposition and enhances the plant's drought tolerance. This invention provides important gene resources and application pathways for molecular breeding of forest trees for stress resistance.

This invention relates to the interdisciplinary field of smart healthcare and digital twin technology, specifically to a dynamic medical twin system and interactive prediction method based on a physiological double helix driven and four-dimensional linkage modalities. The system continuously collects and fuses multi-source biophysical data through a physical entity helix, while a digital virtual helix solves a network of physiological equations coupled with metabolic and stress fields in real time. Both systems achieve endogenous synchronous mapping of gene loci and expressed proteins through a built-in base pairing engine. The four modalities of mirroring, deduction, intervention, and knowledge are responsible for high-fidelity real-time presentation, disease progression prediction, virtual intervention deduction, and clinical knowledge accumulation, respectively, forming a complete closed loop of "observation-deduction-intervention-learning." This invention elevates the system architecture from a static hierarchical stack to a dynamic life-body metaphor, supporting users to perform virtual operations on the twin and receive real-time feedback on multi-scale physiological responses across the entire system, achieving a leap from "morphological simulation" to "life mechanism simulation."

The present application relates to a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line in the field of variation or genetic engineering and application thereof.The construction of the CRISPR-mediated immortalized sheep fetal skin fibroblast cell line of the present application comprises the following steps: step one, constructing a Cas9 site-directed knockout plasmid containing an FGF5 gene target sequence; step two, constructing a homologous repair plasmid Donor-2 kb HA-SV40LT containing an FGF5 gene homologous arm; step three, constructing a donor DNA containing an SV40LT protein expression frame; and step four, preparing a sheep fetal fibroblast cell line stably expressing SV40LT protein.The immortalized SFF-FGF5 / SV40LT monoclonal cell strain created by the present application can become an ideal tool cell line for genome editing researches such as sheep CRISPR library screening, multiple gene editing and mutation gene function exploration.

The invention discloses a recombinant foot-and-mouth disease virus carrying a HiBiT luciferase reporter gene as well as a construction method and application of the recombinant foot-and-mouth disease virus. According to the invention, based on a reverse genetics technology, on the basis of full-length cDNA infectious clone of an FMDV O / BY / CHA / 2010 strain, a recombinant foot-and-mouth disease virus carrying a HiBiT luciferase reporter gene is constructed, and the recombinant foot-and-mouth disease virus is successfully rescued in a BSR / T7 cell. Experimental results show that the recombinant foot-and-mouth disease virus has no significant difference from parent viruses in the aspects of replication ability and pathogenicity, and good biological characteristics are maintained. Meanwhile, a cell line capable of stably expressing the LgBiT protein is successfully constructed, real-time detection of light-emitting signals in the virus infection process is achieved through specific binding of the LgBiT and the HiBiT protein, and an effective technical means is provided for virus research and rapid detection.

The invention discloses application of a gene RrZFP1 in regulation and control of rose plant flower fragrance, and belongs to the technical field of plant genetic engineering, the nucleotide sequence of the gene RrZFP1 is shown as SEQ ID NO.1, and the amino acid sequence of expression protein of the gene RrZFP1 is shown as SEQ ID NO.2. The RrZFP1 gene of the Fenghua rose is separated, after VIGS in the Chinese rose is silenced, the content of geraniol serving as an important aroma component of a transgenic Chinese rose flower is remarkably reduced, and experiments verify that the RrZFP1 gene can activate RrNUDX1 gene expression of a geraniol synthesis pathway, and indicate that the RrZFP1 is a positive regulation factor of the rose fragrance, and the RrZFP1 gene can be used for preparing the rose essential oil. The important application value is realized in the aspect of regulating and controlling the fragrance of the rosa flowers.

The invention relates to a breast cancer diagnosis probe, in particular to a fluorescence / magnetic resonance enhanced bimodal breast cancer imaging polypeptide probe as well as a preparation method and application thereof. The polypeptide probe is prepared from a fluorescence imaging unit, a magnetic resonance imaging unit, a self-assembly imaging unit and a TROP-2 targeted recognition unit. According to the invention, the polypeptide probe for enhancing fluorescence / magnetic resonance signals through in-situ self-assembly is constructed, and the polypeptide probe synthesized through modular optimization can realize in-situ self-assembly mediated by high-expression TROP-2 protein of triple negative breast cancer cells; self-assembly along with fluorescence and magnetic resonance unit aggregation can significantly enhance fluorescence and magnetic resonance bimodal imaging signals of triple-negative breast cancer tissues, improve imaging sensitivity and enhance triple-negative breast cancer imaging effects.

The invention discloses a homologous recombination system, a transposition system, a fruit fly animal gene high-throughput screening method and application. The screening method comprises the following steps: firstly, separating and establishing a stable cell line from a fruit fly animal; then co-transfecting a CRISPR / Cas9 mediated homologous recombination system, and obtaining a cell line for stably expressing Cas9 protein through puromycin screening and a limited dilution method; the sgRNAs plasmid library constructed by combining a PiggyBac transposon system can realize efficient screening and functional analysis of a target gene in the Cas9 cell line. The high-throughput screening method provided by the invention is widely applicable to gene function research and target gene screening, is simple in preparation process and convenient to operate, has good universality, and provides effective technical support and solution for related fields.

The present application relates to a kind of based on chemotactic factor CXCL12 mutant modification double specific fusion protein and its application as immune checkpoint molecule targeted degradation platform in tumor immunotherapy, belong to biological medicine field.The specific problem of the present application is how to effectively enhance the effect of tumor immunotherapy, especially solve the problem of immune escape phenomenon in tumor microenvironment in traditional immunotherapy.To this end, the present application proposes a new KineTAC targeted degradation platform, specifically designs a new chemotactic factor CXCL12 and target protein binding polypeptide (such as anti-PD-1 / PD-L1 monoclonal antibody, anti-LAG-3 monoclonal antibody, etc.) Fusion expression protein molecule, enhance its binding affinity with receptor CXCR4 and CXCR7, and avoid stimulating tumor cell growth proliferation.The fusion protein can target and degrade the immunosuppressive molecules on the surface of tumor cells and immune cells, thereby enhancing the immune response of immune cells and improving the anti-tumor effect.

The application provides a method for constructing an immortalized bovine nasopharyngeal tonsil epithelial cell line and application, and belongs to the technical field of cell engineering. The healthy yellow bovine nasopharyngeal tonsil is used as a material, and the primary epithelial cells are separated by enzyme digestion. The 3rd to 4th generation cells are taken, infected with SV40 T lentivirus (MOI=80), and screened by 1.5 μg / mL puromycin to obtain a stable immortalized cell line. The cell line is continuously passaged to the 50th generation and still stably expresses SV40LT protein and epithelial specific markers CD326, CD324 and KRT8, maintains a typical pavement stone-like morphology, normal proliferation and no malignant transformation. Infection experiments show that the cell is highly sensitive to FMDV, supports efficient replication, and the virus titer can reach 10 7.5 TCID 50 / mL. The application overcomes the defects of the existing immortalized bovine nasopharyngeal tonsil epithelial cell model, such as limited source, large batch difference, low sensitivity and poor persistence, and provides a stable and reliable in vitro model for the research of foot-and-mouth disease prevention and control related mechanisms, drug screening and vaccine development.

The invention discloses a method for analyzing serum differential expression protein characteristics of an AQP4-IgG positive NMOSD patient, and relates to the technical field of differential expression protein characteristic analysis, and the method comprises the following steps: S1, collecting a serum sample of a to-be-detected subject; s2, carrying out protein detection on the serum sample to obtain expression level data of at least one or more of PRDX2, CLU, ECM1, CFD, GPI and S100A8, wherein the expression level data is one or more of PRDX2, CLU, ECM1, CFD, GPI and S100A8; s3, carrying out comparative analysis on the expression level of the serum protein and a pre-established AQP4-IgG positive NMOSD serum protein expression characteristic reference standard; according to the method for auxiliary diagnosis of the AQP4-IgG positive neuromyelitis optica pedigree disease provided by the invention, a judgment mode capable of reflecting molecular characteristics of the AQP4-IgG positive neuromyelitis optica pedigree disease is constructed by carrying out conjoint analysis on various serum protein expression characteristics related to immunoregulation, inflammatory response, complement activation and metabolism; therefore, the problem of insufficient detection stability of a single biomarker is avoided.

A tumor-targeting protein or a fragment thereof, an antibody binding thereto and a use thereof are disclosed. A vector containing a nucleic acid coding for protein A56 or a fragment thereof, and a use thereof are disclosed. An antibody binding to protein A56 or a fragment thereof, and a use thereof are disclosed. The vector containing A56-encoding nucleic acid, a fragment thereof or a mutant thereof uses an oncolytic virus as the vector, and thus, when administered in an individual, specifically kills only cancer cells, primarily. In addition, cancer cells which have survived even after being infected with the oncolytic virus express the protein A56 on the cell surfaces thereof, and thus may be targeted for secondary anticancer therapy employing protein A56-encoding nucleic acid or protein A56 or a fragment thereof, or an antibody binding to A56.

This invention discloses a glycosyltransferase mutant and its application in the synthesis of rebaudioside. Based on the amino acid sequence of the glycosyltransferase shown in SEQ ID NO:1, this invention performs single-point and multi-point mutations to obtain mutants with enhanced catalytic activity. The catalytic activity, substrate specificity, and / or substrate specificity of the glycosyltransferase mutant are altered; mutations at specific sites can significantly improve the enzyme's catalytic activity for specific substrates. The mutant enzyme is obtained by inducing expression and purifying the protein from the obtained mutant sequence. Using the mutant enzyme as a catalyst and UDPG as a glycosyl donor, the catalytic reaction efficiency for the substrates steviol glycoside ST, rebaudioside A (RebA), and rebaudioside D (RebD) can be significantly improved. The glycosyltransferase UGT76G1 mutant constructed in this study improves its catalytic activity, and the efficient production of rebaudioside M is achieved through optimization of the reaction system.