Recombinant human collagen and application thereof
A technology of human-derived collagen and protein, applied in the direction of animal/human protein, application, recombinant DNA technology, etc., can solve the problems of increasing the use restrictions of animal-derived collagen, achieve short cycle, low production cost, good hydrophilicity and The effect of stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Construction and expression of embodiment 1, RHIIIC8 gene expression vector
[0031] 1. Acquisition of human-like collagen RHIIIC8 gene
[0032] Select the peptide segment GERGGPGGPGPQGPPGKNGETGPQGPPGPT (SEQ ID NO.2) in the conserved region of human type III collagen, repeat the sequence 8 times and optimize the codons, entrust Shanghai Passino Biotechnology Co., Ltd. to carry out the whole gene synthesis, and add The Xba I and Sal I restriction sites, the nucleotide sequence is shown in SEQ ID NO.1, which is recorded as the gene RHIIIC8.
[0033]atgggagaacgaggcggccctggaggacctggccctcagggtcctcctggtaagaatggtgaaaccggacctcagggacctccaggacctactggtgagcgaggtggtccaggtggccctggcccacaaggcccacccggaaagaacggtgagactggtccacaaggtcctccaggtccaaccggcgaacgaggaggacctggaggacctggtcctcagggtccgcctgggaagaatggtgaaacaggaccgcagggacctcctggacctacgggtgagcgaggtggtccaggcggtcctggccctcaaggacctccaggcaagaacggtgagactggccctcaaggaccaccaggtccaactggcgaacgaggcggccctggaggacctggcccacagggtccgcctggaaagaatggtgaaactggacc...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com