Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant human collagen and application thereof

A technology of human-derived collagen and protein, applied in the direction of animal/human protein, application, recombinant DNA technology, etc., can solve the problems of increasing the use restrictions of animal-derived collagen, achieve short cycle, low production cost, good hydrophilicity and The effect of stability

Inactive Publication Date: 2019-09-03
郭伟
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, there are batch-to-batch variations as well as cultural reasons that add to the restrictions on the use of animal-derived collagen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human collagen and application thereof
  • Recombinant human collagen and application thereof
  • Recombinant human collagen and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction and expression of embodiment 1, RHIIIC8 gene expression vector

[0031] 1. Acquisition of human-like collagen RHIIIC8 gene

[0032] Select the peptide segment GERGGPGGPGPQGPPGKNGETGPQGPPGPT (SEQ ID NO.2) in the conserved region of human type III collagen, repeat the sequence 8 times and optimize the codons, entrust Shanghai Passino Biotechnology Co., Ltd. to carry out the whole gene synthesis, and add The Xba I and Sal I restriction sites, the nucleotide sequence is shown in SEQ ID NO.1, which is recorded as the gene RHIIIC8.

[0033]atgggagaacgaggcggccctggaggacctggccctcagggtcctcctggtaagaatggtgaaaccggacctcagggacctccaggacctactggtgagcgaggtggtccaggtggccctggcccacaaggcccacccggaaagaacggtgagactggtccacaaggtcctccaggtccaaccggcgaacgaggaggacctggaggacctggtcctcagggtccgcctgggaagaatggtgaaacaggaccgcagggacctcctggacctacgggtgagcgaggtggtccaggcggtcctggccctcaaggacctccaggcaagaacggtgagactggccctcaaggaccaccaggtccaactggcgaacgaggcggccctggaggacctggcccacagggtccgcctggaaagaatggtgaaactggacc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant human collagen and an application thereof. An amino acid sequence of the protein is shown as SEQ ID NO. 3, the nucleotide sequence of the protein-coding gene is shown as SEQ ID NO. 1. The recombinant human collagen of the invention has very good hydrophilicity and stability, and the amino acid composition thereof is 100% identical to the corresponding amino acid sequence of the natural collagen, and the amount of expressed protein can account for about 25% of the total protein of the thalline, per milliliter of the bacteria liquid precipitate contains 0.25mg of the target protein, and the production cost is very low and the cycle is short. The prepared collagen is applied to the human body without immunological rejection and allergic reaction, and canbe widely applied to the biomedicine and cosmetics industries.

Description

[0001] (1) Technical field [0002] The invention relates to a recombinant human collagen and its application. [0003] (2) Background technology [0004] Young and healthy skin is the standard of beauty and a necessity accepted by consumers of this day and age, leading to an increase in research and access to alternatives that improve skin texture to the desired smooth and youthful appearance. These market needs and solutions are all focused on a common goal of enhancing collagen production and its use in skin care products. Collagen is one of the most abundant proteins in the body. Collagen hydrolyzate has been demonstrated to have significant biological activities, such as antioxidant properties, antihypertensive activity, lipid-lowering activity, and damaged skin repair properties. Collagen has a dual role in the skin: providing the building blocks for elastin and collagen formation, acting as a ligand or binding to fibroblast receptors to stimulate the synthesis and secr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C07K1/36C07K1/34C07K1/22C12N15/12C12N15/70C12N1/21C12R1/19
CPCC07K14/78C12N15/70
Inventor 郭伟
Owner 郭伟
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com