1238results about How to "Short cycle" patented technology

The embodiment of the invention relates to a method and device for processing question and answer tasks in combination with a knowledge graph. The method comprises the steps that the knowledge graph is constructed; customizing an entity extraction model on the basis of a feature extraction component of the large language model, performing automatic generation processing on a model training data set of the entity extraction model by the large language model according to the knowledge graph, and training the entity extraction model on the basis of the data set; after the training is finished, performing entity triple extraction processing on a question text input by a user by the entity extraction model to obtain a current entity triple, and performing knowledge retrieval processing according to the current entity triple and the knowledge graph to obtain a current knowledge text; and the current question text and the current knowledge text are substituted into the question and answer instruction template for question and answer instruction text splicing to obtain a corresponding question and answer instruction text, and the question and answer instruction text is input into a large language model for answer text generation processing. Through the method, the processing performance of the question and answer task can be improved, the improvement efficiency can be improved, and the improvement cost is reduced.

The invention discloses an intelligent auxiliary system and method for regular inspection of a pressure vessel, and aims to improve the intelligence, efficiency and accuracy of inspection of the pressure vessel. The system comprises a data acquisition module, a data processing module, a risk assessment module, an inspection plan generation module, a report generation module, a remote monitoring module and a historical data management module. Operation parameters of the pressure vessel are collected in real time through the sensor, the data processing module carries out elimination and trend analysis on abnormal data, and the risk assessment module assesses the operation state of the pressure vessel through machine learning and a fuzzy logic algorithm. The system dynamically generates an inspection plan according to an evaluation result and adjusts an inspection period through Bayesian updating, and a generated inspection report has a digital signature to ensure safety. The historical data management module stores and analyzes long-term data and supports trend prediction of equipment health conditions, and the remote monitoring module provides real-time state checking and early warning.

The invention relates to the technical field of microorganisms, in particular to a viable bacterium preparation of a lactobacillus paracasei strain as well as a preparation method and application of the viable bacterium preparation. The viable bacterium preparation comprises a lactobacillus paracasei strain and auxiliary materials, and the preservation number of the lactobacillus paracasei strain is CGMCC (China General Microbiological Culture Collection Center) No.27974. The viable bacterium preparation can inhibit the growth of streptococcus mutans, reduce the formation of a dental plaque biofilm caused by the streptococcus mutans, reduce the content of a mature dental plaque biofilm, inhibit the level of water-insoluble exopolysaccharides generated by the streptococcus mutans, reduce the expression quantity of cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of the streptococcus mutans, improve the cariogenic activity of the streptococcus mutans and improve the cariogenic activity of the streptococcus mutans. The adhesion rate of streptococcus mutans on a hydroxyapatite tooth model is reduced, and a beneficial in-vitro probiotic function is achieved.

The invention provides a financial bill risk value calculation method and device, equipment and a storage medium, relates to the technical field of financial bill risk assessment, and can comprehensively and deeply mine potential risks in financial bills by integrating various anomaly detection models and classification models. The anomaly detection model can accurately identify the anomaly in the data, and provides a high-quality risk data sample for the classification model, thereby ensuring the accuracy and reliability of risk probability calculation. The risk probability is predicted by using the pre-trained risk classification model, so that the calculation efficiency is greatly improved. Compared with a traditional risk assessment method, the method does not need to manually carry out tedious data analysis and judgment, and the risk identification period is remarkably shortened. And the risk probability is converted into the corresponding risk value, so that the risk assessment result is more visual and easy to understand. Risk management and decision making of related financial departments are facilitated, and comprehensive control of financial risk conditions of enterprises is facilitated.

The invention discloses a three-way pipe arc core-pulling structure, an injection mold and a demolding method.The arc core-pulling structure comprises a driving rack and a sliding limiting seat, an arc-shaped sliding block is arranged on the sliding limiting seat, an arc-shaped core-pulling insert is arranged on the arc-shaped sliding block, the arc-shaped core-pulling insert and the arc-shaped sliding block are the same in bending rate, and the circle centers of the arc-shaped core-pulling insert and the arc-shaped sliding block coincide; a rotatable transmission gear is arranged on the sliding limiting base, arc-shaped meshing teeth are arranged on the arc-shaped sliding block, and the transmission gear is connected with the driving rack and the arc-shaped meshing teeth in an engaged mode. The driving rack is driven to move linearly to drive the transmission gear to rotate, and then the transmission gear is matched with the arc-shaped meshing teeth to drive the arc-shaped sliding block to rotate and slide on the sliding limiting seat, so that the arc-shaped core-pulling insert can stretch into or stretch out of a product cavity. Core pulling of the arc hole is achieved through mold opening force, an external oil cylinder is not needed, the manufacturing cost of the mold can be reduced, the injection molding period can be shortened, and therefore the machining efficiency of the mold is improved.

The invention provides a KASP molecular marker related to a corn ear height character under a drought condition and application of the KASP molecular marker, and belongs to the technical field of molecular genetics. The SNP marker site related to the ear height character under the drought condition and having polymorphism is obtained through whole genome association analysis, the SNP marker site refers to a corn B73 RefGenv4 genome, when nucleotide polymorphism T / C exists at the position 147243591 of a 10 # chromosome, the SNP marker site is a dominant character, and nucleotide sequences used for amplifying a KASP molecular marker primer group are shown as SEQ ID NO.1-3. Gene typing identification can be rapidly, simply and efficiently carried out by utilizing a KASP typing technology, enzyme digestion and electrophoresis are not needed, accurate identification and selection can be carried out in a seedling stage, a large amount of breeding workload can be reduced, the period of high-ear-position breeding selection can be shortened, and the method can be used for high-ear-position molecular marker-assisted breeding of corn.

The invention discloses a preparation method of a small-size defective cerium-based MOFs supported metal catalyst for hydrogenation, and belongs to a preparation technology of a nano composite catalytic material. The preparation method comprises the following steps: in a cerium-based MOFs synthesis process, introducing a proper amount of monocarboxylic acid as a regulator to synthesize a cerium-based MOFs carrier with adjustable defects and size, then loading a metal active component to the cerium-based MOFs carrier, and combining adjustment of reduction conditions to prepare the cerium-based MOFs loaded metal composite catalyst with small-size defects for DCPD hydrogenation. The defects and the size of the cerium-based MOFs carrier are effectively regulated and controlled through the monocarboxylic acid regulator, controllable regulation of the electronic state, the size and the catalytic activity of the loaded metal active component can be achieved by combining regulation and control of the reduction condition of the loaded metal nanoparticle active component, the process is simple, parameters are controllable, the period is short, and the method is suitable for DCPD hydrogenation large-scale production.

The invention relates to a high-toughness corrosion-resistant aluminum alloy and a preparation method thereof. The high-toughness and corrosion-resistant aluminum alloy is prepared from the following components in percentage by mass: 3.5 to 4.6 weight percent of Mg, 1.3 to 1.5 weight percent of Zn, 0.1 to 0.4 weight percent of Sc, 0.4 to 0.5 weight percent of Zr, 0.4 to 0.5 weight percent of Cu and the balance of Al. The optimized preparation method comprises the steps that aluminum alloy mixed powder serves as a raw material, laser additive manufacturing is adopted, and a printed product is obtained through printing; during printing, the laser power is controlled to range from 250 W to 350 W, the laser scanning speed ranges from 800 mm / s to 1200 mm / s, the laser spot diameter ranges from 60 micrometers to 80 micrometers, the scanning interval ranges from 0.02 mm to 0.05 mm, and the powder laying thickness ranges from 0.03 mm to 0.05 mm. Based on a cross alloy design strategy, the in-situ alloying powder manufacturing technology and the laser powder bed melting technology are combined, collaborative optimization of the mechanical property and the corrosion resistance is achieved, meanwhile, the material development and preparation cost is effectively reduced, and the application requirements of multiple fields are met.

The invention discloses an amorphous forming ability prediction method based on Transform and table data conversion. The amorphous forming ability prediction method comprises the following steps: acquiring basic attributes and amorphous forming ability attributes of amorphous alloy composition elements in a metal alloy sample; the basic attributes refer to element properties simulated based on an experiment or a density functional theory and comprise atomic basic properties, chemical properties and physical properties, and the amorphous forming ability attributes comprise a critical casting diameter Dmax; generating an amorphous alloy data set; wherein the data set comprises an independent variable and a response variable, the independent variable comprises element composition and mixing enthalpy Hmix, and the response variable is a critical casting diameter Dmax; defining a relation model, wherein the relation model is an integrated model formed by three types of models; and training the integrated model by using an amorphous alloy data set, and constructing an amorphous forming ability evaluation model. According to the technical scheme, various relation models for predicting the critical casting diameter can be trained, and the various relation models are combined to construct the optimal amorphous forming ability evaluation model.

The invention discloses a core rock sampling automatic identification system and method based on image processing and machine learning. The system comprises a drilling assembly, a sensor assembly, a measurement and control lamp assembly, an identification assembly, a relay assembly and a control and display assembly. The method comprises the steps that core rock drilling is conducted, and a core rock sample is obtained through extraction; core rock sample images are collected, and parameters in the drilling process are monitored; sorting physical and appearance characteristics of the obtained core rock sample and the core rock sample image, and storing the physical and appearance characteristics in a database; preprocessing the acquired core rock sample image, and extracting key features; training by using a machine learning algorithm to obtain a core rock category recognition model; and applying the core rock category identification model obtained by training to newly obtained core rock sample image data to obtain classification and identification results. According to the method, the sensor, image processing and the convolutional neural network are combined, automatic and real-time rock core recognition is realized, the recognition efficiency and accuracy are improved, and the method can be flexibly applied to a field environment.

The invention discloses a method for preparing synthetic quartz sand by a sol-gel method, which comprises the following steps: mixing silicon alkoxide and an alcohol solvent, and stirring to form a homogeneous solution marked as L1; mixing an acidic catalyst, an alcohol solvent and ultrapure water to form a mixed solution, and recording the mixed solution as L2; dropwise adding the L1 solution into the L2 solution, and continuously stirring and hydrolyzing to obtain sol; dropwise adding ammonia water into the sol until the pH value is 5-10, and standing in a vacuum drying oven to obtain wet gel; and drying and sintering the wet gel to obtain the high-purity synthetic quartz sand. The gelation time is accurately controlled through acid-base two-step catalysis, the production period is shortened, and the production efficiency is improved; meanwhile, the size and uniformity of silicon dioxide particles are controlled by controlling the dripping speed of a silicon source, so that the sintering temperature of the synthesized quartz sand is greatly reduced, and the solvent is recycled through distillation when wet gel is dried, so that the production cost is reduced, and the pollution to the environment is reduced.

The medium-temperature radial forging method comprises the steps that pretreatment is conducted, specifically, a niobium-tungsten alloy extrusion bar blank is heated for 60-180 minutes at the temperature of 750-950 DEG C, rapid forging and straightening are conducted, and a medium-temperature radial forging bar blank is obtained and annealed for 60-120 minutes at the temperature of 1250-1450 DEG C; medium-temperature radial forging is conducted, specifically, a two-step method is adopted, in the first step, a bar blank is preheated to 80-100 DEG C and coated with Ta1350 high-temperature glass powder, heat preservation is conducted for 90-180 minutes at the temperature of 1050-1150 DEG C, and the bar blank is forged into a bar with the diameter of 70 + / -1 mm in the mode that the diameter is reduced by 7-10 mm every time; and in the second step, the heating and coating processes are repeated, the diameter is reduced by 5-7 mm every time, and the bar with the required specification is manufactured. By optimizing the medium-temperature forging and annealing process, the fine grain structure is controlled, the high-temperature mechanical property, creep resistance and oxidation resistance of the material are improved, and the material is suitable for aerospace engines and other high-temperature and high-pressure scenes. Compared with a traditional method, the technology improves the yield, shortens the production period, reduces the labor intensity, is suitable for large-scale production, reduces surface air suction, oxidation and burning loss, and improves the production efficiency and the finished product quality.

The invention relates to the technical field of logging evaluation of a shale gas reservoir geologic model, and discloses a logging evaluation method suitable for the shale gas reservoir geologic model, which comprises the following steps: collecting and arranging logging data, including natural gamma, resistivity, interval transit time, density and neutron logging curves, based on geological data and logging data of adjacent wells, an initial geological model of the shale gas reservoir is established, a logging curve is preprocessed, including depth correction, environment correction, data smoothing, utilization of response characteristics of the logging curve, identification of cracks and stratification in the shale gas reservoir, and utilization of the logging data to calculate physical property parameters of the shale gas reservoir. According to the logging evaluation method, a plurality of reservoir parameters including the organic carbon content, the thermal maturity, the porosity, the permeability, the water saturation, the fracture development degree and the like can be obtained, and the comprehensive analysis of the parameters can more comprehensively reflect the reservoir characteristics, so that the accuracy of a geologic model is improved.

The invention discloses an NK cell culture system and an in-vitro amplification method. The invention firstly discloses a culture system of the NK cells, wherein the culture system comprises a coating solution, an activation culture medium and an amplification culture medium. The invention further discloses a method for in-vitro amplification of NK cells by using the culture system. According to the method for amplifying the NK cells in vitro, the use of protein cell factors is simplified, only two factors of IL-2 and IL-15 are matched with CD16 and progesterone to directly culture mononuclear cells, and the required cost can be reduced to a great extent; sorting is not needed, all mononuclear cells can be used for culture, the operation procedure is simplified, and the culture cost is reduced; the process is simplified, and pollution is avoided to the greatest extent; meanwhile, the cultured NK cells are stable, safe, high in activity, enhanced in expansion, high in purity, short in period, strong in killing ability, high in cost performance and suitable for industrial production.

The invention discloses an application of non-therapeutic GLYR1 protein in regulating and controlling proliferation and / or migration of renal clear cell carcinoma cells, which is characterized in that the expression of GLYR1 is knocked down so as to promote the proliferation and / or migration of the renal clear cell carcinoma cells, a reagent adopted for knocking down the expression of the GLYR1 is si-GLYR1 # 1, a positive-sense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGUCGAAGA, an antisense strand of the si-GLYR1 # 1 is UCUUCGACAGCAUCUACCG, the antisense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGCAUCUACCG is The kit has the characteristics of high sensitivity, strong specificity, short period and the like, is beneficial to early diagnosis and treatment of the clear cell renal carcinoma, and has the potential of becoming a novel biomarker and an effective treatment target in the clear cell renal carcinoma.

The invention discloses a net cage state simulation method and system and a removable storage medium, and relates to the technical field of aquaculture, and the net cage state simulation method comprises the following steps: employing a two-dimensional plate unit to carry out simulation analysis on a thin-wall structure of a net cage body, and simulating the acting force of waves and ocean currents on the thin-wall structure; performing simulation analysis on the net rack structure and the netting structure of the net cage body by adopting a Morison model, and simulating the acting force of waves and ocean currents on the net rack structure and the netting structure; and utilizing a neural network model to evaluate local area deformation conditions and stress conditions of the net cage body under different sea conditions. According to the technical scheme, by combining different simulation methods and cooperating with the neural network model, the accuracy of net cage state simulation is improved, the performance of the net cage body under different marine environment conditions is evaluated, the method has the advantages of being short in period and low in cost, and the net cage body can be optimized and iterated in the design stage.

The invention relates to a spaceflight-carried schizophragma integrifolium strain Kungsu No.3 and application thereof, and belongs to the technical field of strain breeding. The spaceflight-carried schizophyllum commune strain No.3 is preserved in the China General Microbiological Culture Collection Center (CGMCC) on August 9, 2024, the preservation number is CGMCC No.41428, the classification name of the spaceflight-carried schizophyllum commune strain is schizophyllum commune, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. Compared with cultivation of strains which are not subjected to spaceflight carrying, the Kunzhou No.3 strain is fast in hypha germination, fast in growth, crisp in sporocarp, free of or few in spores, light pink to pink, high in conversion rate, short in period and suitable for industrial cultivation.

The invention relates to the field of battery electrode materials, in particular to a doped lithium aluminum titanium phosphate solid electrolyte material, a preparation method and a lithium ion battery containing the doped lithium aluminum titanium phosphate solid electrolyte material. The chemical composition of the doped solid electrolyte material is Li1 + zMyAlxTi2-x-yP3O12-bFa, wherein x is greater than or equal to 0 and less than or equal to 0.4, a is greater than or equal to 0 and less than or equal to 0.8, and b is greater than or equal to 0 and less than or equal to 0.8. Z is less than or equal to 0.8, and M is one or more of Zn, Mg, Ca, Sr, Si and Sn. Raw materials containing doping elements are added in the process of preparing lithium titanium aluminum phosphate (LATP), doping type lithium titanium aluminum phosphate is synthesized through calcination, then crushing and smashing are conducted, and the solid electrolyte material with high conductivity and particle density is obtained. According to the solid electrolyte material, the ionic conductivity and the particle density are improved, and the requirements of the market for high ionic conductivity and high particle density are met; the preparation method and modification steps are simple, the period is short, and the method is suitable for industrial large-scale production.

The invention relates to the technical field of maintenance and management of industrial automation equipment, and discloses a control cabinet intelligent inspection and preventive maintenance and management method, which comprises the following steps: S10, data acquisition and preprocessing; s20, extracting features and constructing a database; s30, training an AI prediction model; s40, performing intelligent inspection and anomaly detection; and S50, performing maintenance and effect evaluation. By integrating sensor data, historical fault records and the AI prediction model, efficient and accurate routing inspection and maintenance plan making of the control cabinet are realized, so that the equipment reliability is improved, and the non-planned downtime is shortened.

The invention discloses a soluble expression and purification method of recombinant human bone morphogenetic protein in a prokaryotic system. A gene sequence of a recombinant human bone morphogenetic protein (rhBMP) is spliced at the 3'terminal of a His-Linker-GB1 gene sequence, inserted into a prokaryotic expression system expression vector and transferred into a prokaryotic competent cell to be highly expressed in the cell in a soluble form, and finally, the expressed His-Linker-GB1-BMP fusion protein does not need to be subjected to inclusion body renaturation, so that the recombinant human bone morphogenetic protein (rhBMP) is obtained. The high-purity fusion protein can be obtained through one-step metal chelating chromatography (adsorption-elution mode), and the GB1 tag has small molecular weight and hardly affects the spatial structure and biological activity of rhBMP, so that the situation that an inclusion body is formed by expression of rhBMP in a traditional escherichia coli system and expression is performed in a structure-free and activity-free inclusion body form is avoided, and the expression efficiency is greatly improved. The method is simple and convenient to operate, is suitable for large-scale amplification, and has the characteristics of short period, high purity, stable process and the like.

The invention provides a photoresponse water photovoltaic power generation device based on nano tungsten oxide and a preparation method of the photoresponse water photovoltaic power generation device, and relates to the field of water evaporation induced new energy power generation and novel photoelectric detection. The water photovoltaic power generation device is composed of a substrate, a positive electrode, a negative electrode and a slurry layer, wherein the slurry layer is obtained by drying slurry formed by mixing tungsten oxide, a Nafion solution and deionized water; the water photovoltaic power generation device can generate an open-circuit voltage of 1.4-1.8 V and a short-circuit current of 100-140 nA under the evaporation induction of deionized water. Under the illumination with the wavelength of 435 nm, the output voltage and current change along with the illumination intensity, and the material has the obvious light response characteristic and is expected to be used for optical detection and hydrovolt generator theory research.

The invention belongs to the technical field of saline-alkali soil improvement, and relates to a coastal moderate-severe saline-alkali soil rain-fed dry-farming early-spring sesbania planting method which comprises the following steps: S1, deep rotation is performed on saline-alkali soil; s2, ridging, wherein ditching and ridging are conducted on the saline-alkali soil subjected to deep rotation; s3, punching holes in the ridge sides and forming water gathering pits arranged in a duckbilled shape, and then paving a mulching film on the water gathering pits; s4, holes are drilled in the side face of the water gathering pit in the vertical direction, a seeding channel is formed, then the sesbania seeds are sown into the seeding channel, the peripheries of the holes of the mulching film are covered with soil, a duckbilled structure is formed, and rainwater is guided by means of the mulching film to flow into the water gathering pit to be gathered; s5, forming a straw interlayer after the whole sesbania is returned to the field. Rainwater is gathered to the seeding channel through the mulching film, the amount of water capable of being absorbed by the sesbania seeds is increased, in addition, the mulching film can also achieve the effects of improving the soil temperature and preserving soil moisture, so that the sesbania can be planted in a rain-fed dry farming mode at the end of March, and the saline-alkali soil improvement period is shortened.

The invention relates to a cooling medium heat exchange and flow resistance coefficient testing device and method, and the method comprises the steps: constructing a cooling medium testing device, and determining a to-be-tested cooling medium which is used for inputting the cooling medium testing device; the cooling medium testing device comprises a connecting flange, a single-path cooling flow channel, a temperature sensor and a pressure sensor, the temperature sensors are arranged on the single-path cooling flow channel at equal intervals in the circumferential direction of the connecting flange; the pressure sensors are arranged on the single-path cooling flow channel at equal intervals in the circumferential direction of the connecting flange; connecting the connecting flange to an outlet of an engine combustion chamber and inputting a to-be-tested cooling medium to the one-way cooling flow channel so as to heat the connecting flange based on high-temperature fuel gas output by the engine combustion chamber; the temperatures and the pressures of adjacent positions of the interval sections on the single-path cooling flow channel are collected based on the temperature sensor and the pressure sensor respectively, and the heat exchange coefficient and the flow resistance coefficient of the cooling medium to be measured are obtained through calculation based on the temperatures and the pressures.

The invention discloses a high-speed backboard system and method for achieving LVDS communication based on an FPGA, the high-speed backboard system comprises a controller and a communication assembly, the communication assembly comprises a plurality of communication modules, the communication assembly specifically comprises a master station module and at least one slave station module, the controller is connected with the master station module, and the slave station module is connected with the controller. An FPGA chip is arranged in each of the master station module and the slave station module, and the FPGA chip in the master station module is electrically connected with an MCU; each of the master station module and the slave station module at least comprises a sending interface and a receiving interface, and data frame interaction is carried out between the master station module and the slave station module through an interface assembly composed of the sending interface and the receiving interface. The master station module and the slave station module achieve data exchange through the interface assembly, the purpose that the master station module controls the slave station module and obtains information of the slave station module is achieved, the structure is simple, connection between the modules is stable and reliable, the use efficiency of the system on site is improved, and cost is reduced.

The invention discloses a foamed polypropylene bead capable of being quickly formed by microwaves, the foamed polypropylene bead has a core-shell structure, a core layer material comprises high-melting-point high-modulus polypropylene, a shell layer material comprises a low-melting-point propylene copolymer and / or a polypropylene blend and a certain amount of a microwave heating aid, and the interior or surface of the foamed bead shell layer also contains a surfactant. The microwave heating aid can be rapidly heated under relatively low microwave heating power, so that the low-melting-point polypropylene material on the surface layer is rapidly melted and is fused and sintered with other surrounding foamed polypropylene bead shell layers, and the surface active agent can further improve the heating efficiency; the interior of the foamed polypropylene bead does not contain a microwave heating aid and a surfactant, low-power microwaves cannot enable the internal temperature of the foamed bead to rise too much, an original independent closed-pore structure can be kept, an obtained molded part is high in curing degree and good in surface sintering, the whole molding process is short in time and low in energy consumption, a large amount of cost is saved, and the method is suitable for large-scale production. The environment is protected.

The invention discloses a method for preparing a powder high-speed steel billet, the powder high-speed steel billet and application, and relates to the technical field of advanced manufacturing of metal materials. The powder high-speed steel billet is prepared through the high-frequency induction hot pressing sintering method, rapid manufacturing of the powder high-speed steel billet can be achieved, and the performance of the obtained product can reach the product level of traditional hot isostatic pressing sintering. And compared with a traditional hot isostatic pressing preparation method, the technological process is simple, the period is short, preparation of a sheath is avoided, the cost can be reduced, and the safety can be improved. The density of the prepared powder high-speed steel can reach 98.5%, the microhardness reaches 365 Hv, the tensile strength and the yield strength reach 723 MPa and 687 MPa correspondingly, short-process and low-cost preparation of the powder high-speed steel billet can be achieved, and the obtained powder high-speed steel billet can be used for manufacturing hardware knives and scissors, mechanical molds and the like.

The invention discloses a siloxane modified terpyridyl corrosion-resistant auxiliary agent and application thereof in preparation of an intrinsic metal corrosion-resistant epoxy resin coating, the structural formula of the siloxane modified terpyridyl corrosion-resistant auxiliary agent is # imgabs0, a terpyridyl structure is introduced, and the siloxane modified terpyridyl corrosion-resistant auxiliary agent has an efficient metal corrosion-resistant effect; the physical state of metal in the corrosion process can be changed by taking the strong coordination effect of terpyridyl as driving force, so that long-term corrosion prevention is realized; a terpyridyl structure is introduced into the epoxy resin, a rigid structure of a benzene ring and heterocyclic nitrogen atoms can form hydrogen bonds with side hydroxyl groups of the epoxy resin, the durability and corrosion resistance of the epoxy resin are greatly improved, and a siloxane structure on a main chain improves the flexibility of a molecular chain and improves the hydrophobicity of the epoxy resin.

The invention discloses a preparation method of red-mud-based artificial soil, which comprises the following steps: A, mixing and stirring red mud, calcium-based solid waste, industrial ferric salt, manganese slag and water according to a mass ratio, and fully stirring to fully react to obtain dealkalized red mud; wherein the mass ratio of the red mud to the calcium-based solid waste to the industrial ferric salt to the manganese slag to the water is 100: (1-5): (0.1-1): (0.1-1): (10-50); b, mixing the dealkalized red mud with the fly ash, the biomass and the stable organic solid waste, and fully and uniformly stirring to obtain a mixture; and C, naturally stacking the mixture and fertilizing. The method can accelerate the red mud harmlessness and soil treatment process, and reduces the environmental pollution risk of the storage yard.

The invention discloses a preparation method of a flexible magneto-optical composite material which is low in cost and easy to form, Fe3O4 or CoFe2O4 or NiFe2O4 nanoparticles which have a strong magneto-optical effect but are extremely easy to agglomerate are uniformly dispersed in ZIF-8 with fixed pores by adopting an in-situ symbiosis technology, and PgC5Cu is used for modifying the surface of the ZIF-8 to serve as a bridging agent, so that the ZIF-8 is uniformly dispersed in PMMA (Polymethyl Methacrylate); and the composite material with excellent magneto-optical characteristics is successfully constructed. The innovative design not only maintains the original structural stability and optical transparency of the material, but also endows the material with unprecedented flexibility and machinability, and provides possibility for realizing light weight, portability and flexibility of magneto-optical devices. Compared with traditional pure inorganic magneto-optical crystals, magneto-optical glass and other materials, the preparation method is simple, the production period is short, energy consumption and cost are remarkably reduced, and the material has the advantages of being easy to form, high in flexibility and the like and can adapt to wider application scenes.

The invention relates to the field of drug effect simulation, in particular to a drug effect simulation system, which comprises a data input module for receiving drug information and patient information and carrying out structured storage on the information; the data preprocessing module is used for performing cleaning, standardization and feature extraction on the input data; the intelligent model selection module automatically selects the most suitable PK and PD models through a machine learning algorithm in combination with historical data; the personalized parameter adjusting module is used for dynamically adjusting simulation parameters according to the specific data of the patient; the drug effect simulation module is used for simulating the action process of the drug in the virtual environment and adjusting the simulation in real time through the real-time feedback module; the calculation module is used for executing simulation calculation and generating a drug effect prediction result; and the result analysis module is used for carrying out statistical analysis on the simulation result and generating a drug effect prediction curve and a detailed report.