Conditional gene knockout method based on CRISPR/Cas9 technology

A gene knockout and positive technology, applied in the field of gene modification, can solve the problems that tissue, cell, and space-time specific knockout cannot be achieved, it is difficult to obtain double transgenic offspring mice, and the identification and screening process is complicated, reaching the test cycle Short, reduced cytotoxicity, short cycle effect

Active Publication Date: 2015-03-11

CYAGEN BIOSCI INC

2 Cites 77 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0009] Although the Cre-loxp recombinase system can mediate the conditional knockout of genes and avoid the disadvantages of traditional gene targeting techniques such as premature death of embryos caused by missing functional genes, there are still many uncertainties:

[0010] ①There is a hidden/false LoxP sequence in the mammalian genome, and its sequence may not be exactly the same as the conserved sequence of LoxP, but it can be recognized...

Method used

The Cas9 carrier of tissue-specific expression is based on the Rosa26 carrier, and the Cas9 protein is inserted into the mouse Rosa26 region, avoiding the cytotoxicity caused...

Abstract

The invention discloses a primer used for gene knockout, which comprises five groups of primer, and can be respectively shown in a SEQ NO:1, a SEQ NO:2, a SEQ NO:3, a SEQ NO:4, a SEQ NO:5, a SEQ NO:6, a SEQ NO:7, a SEQ NO:8, SEQ NO:9 and a SEQ NO:10. The invention also discloses an application of the primer in gene knockout aspect. The invention also discloses a conditional gene knockout method based on a CRISPR/Cas9 technology. The method can performing condition specificity, space-time specificity, and medicine-induced type gene modification; harm due to other cells can be reduced, function of constitutive expression gene in a specific tissue can be researched; tissue and space specificity gene knockout or induction type gene knockout can be realized by only using Cas9 tool mice; test period is short, and time and cost are saved.

Application Domain

Vector-based foreign material introductionDNA/RNA fragmentation

Technology Topic

Tool MouseGene Modification +5

Image

Examples

Experimental program(4)

Example Embodiment

[0073] Example 1:

[0074] 1. Experimental materials

[0075] ① HD Clinging Kit (639648): purchased from Clontech;

[0076] ②Premix Taq (D331A), Primerstar (DRO44A), dNTP (4030Q): purchased from Yubao Bioengineering (Dalian) Co., Ltd. (Takara);

[0077] ③ Restriction endonucleases BbsI (R0539L), AsisI (R0630L), HpaI (R0105S): purchased from Beijing Bomaisi Biotechnology Co., Ltd. (NEB); Church Cloning Vector is a commercial plasmid, purchased from Church through Addgene Laboratory; pCR-Blunt II-TOPO is also a commercial plasmid, purchased from Invitrogen through Addgene; plasmid with Cre recombinase: from Addgene, purchased from Albee Messing laboratory; Rosa26 expression vector source, from Addgene, purchased from Liqun Luo laboratory.

[0078] 2. Gene structure and sequence analysis

[0079] Target gene: mouse eukaryotic translation initiation factor 3 (Eif3h gene);

[0080] Ensembl gene coding number: ENSMUSG00000022312;

[0081] Eif3h gene structure: Eif3h gene contains 8 exons, including exon 1 starting with ATG and exon 8 ending with TAA;

[0082] Gene description: Eukaryotic translation initiation factors 3 (Eif3) is the largest and most complex factor among eukaryotic translation initiation factors. It plays an important role in the initiation of protein transcription, and it plays an important role in the initiation of protein transcription. The central protein factor in which the initiation factor is interconnected. Eif3 is a multi-subunit complex. Mammals contain at least 12 subunits. Eif3h is one of them. It is highly expressed in a variety of tumor tissues, indicating that it is closely related to the occurrence, development and malignant biological behavior of a variety of tumors. Related.

[0083] 3. Find and screen gene knockout sites

[0084] (1) Search for Eif3h gene related information on Ensembl and NCBI, and determine the knockout region;

[0085] (2) After selecting the knockout area, use Crispr software (http://crispr.mit.edu/) to design sgRNA fragments;

[0086] (3) Analyze the target selected by Crispr on the NCBI database, select the sgRNA site with fewer off-target sites, and finally locate the target on exon 4.

[0087] 4. Construction of sgRNA expression vector and mouse production

[0088] (1) sgRNA fragment design:

[0089] Upstream primer: 5’–AGTTGCTTCAGCGAGAGAGATCCTT–3’

[0090] Downstream primer: 5’–AAACAAGGATCTCTCTCGCTGAAGC–3’

[0091] (2) Anneal the synthesized sgRNA fragments into double-stranded fragments; the annealing conditions and systems are as follows:

[0092] Upstream primer (100μM) 1μl

[0093] Downstream primer (100μM) 1μl

[0094] 10*T4 connection buffer (NEB) 1μl

[0095] ddH2O 6.5μl

[0096] T4 PNK(NEB) 0.5μl

[0097] Reaction procedure: 37℃ 30min

[0098] 95°C for 5 minutes, then slowly lower the temperature to 25°C, and then react for 5 minutes.

[0099] (3) Connect the double-stranded fragment to the linearized vector digested with BbsI to obtain the ligation product, which is the Church Cloning Vector containing the Alb promoter (liver-specific expression), the map is as follows Figure 5 Shown.

[0100] (4) Transform the ligation product, select positive clones, and perform colony PCR verification;

[0101] The colony PCR process is as follows:

[0102] The primers are:

[0103] Product primer F: TGTACAAAAAAGCAGGCTTTAAAG

[0104] Product primer R:AAACAAGGATCTCTCTCGCTGAAGC

[0105] reaction system:

[0106]

[0107] Reaction procedure:

[0108]

[0109] (5) Perform agarose gel electrophoresis on the obtained product to obtain a 338bp fragment, such as Image 6 Shown.

[0110] (6) Sequencing the verified clone to ensure the correctness of the sgRNA sequence.

[0111] (7) Electrotransfer the correctly sequenced sgRNA expression plasmid into mouse ES cells; verified by Southern Blot, the results are as follows Figure 7 with Figure 8 Shown

[0112] (8) Inject the verified ES cells into the blastocysts of mice, and then transfer them to 2 surrogate mother mice, and finally 9 mice with sgRNA were obtained.

Example Embodiment

[0113] Example 2 Construction of Cas9 expression vector and production of Cas9 tool mouse

[0114] (1) Amplification of Cas9 protein

[0115] ① Design primers for amplification of Cas9 protein as follows:

[0116] Cas9-F: CGCGGTCTTTCCAGTGATCGATTAGTTATTAATAGTAATCAA

[0117] Cas9-R: CTCTAGTCCGCGGGTGCGATAGCTCACACCTTCCTCTTCTTCTTG

[0118] ② PCR amplification of the complete sequence of Cas9 protein, the system is as follows:

[0119]

[0120] The PCR program is as follows:

[0121]

[0122]

[0123] ③The PCR products are subjected to agarose gel electrophoresis, such as Picture 9 Shown.

[0124] (2) Cas9 protein is connected with Rosa26 carrier

[0125] ①Use Clontech's HD Clinging Kit connects the correct Cas9 sequence to the vector linearized by AsisI and HpaI enzymes. The vector is modified by the company, with a broad-spectrum expression promoter CMV, 5’arm of Rosa26, and Rosa26 of 3’arm. The map is as follows Picture 10 Shown.

[0126] ②The ligated vector is transformed into E. coli, clones are picked, and colonies are verified by PCR, and then sent to Suzhou Jinweizhi Company for sequencing. The colony PCR primers are as follows:

[0127] Cas9-SF: CACCATAGACAGAAAGCGGTACACC

[0128] Cas9-SR: CTAAAGCGCATGCTCCAGACTG

[0129] The reaction system is as follows:

[0130]

[0131] The reaction procedure is as follows:

[0132]

[0133] (3) Linearize the sequenced vector and transfer it to ES cells;

[0134] (4) Use neomycin-containing medium to screen out positive ES cells containing Cas9 protein; then verify with Southern Blot, the results are as follows Picture 12 with 13 Shown.

[0135] (5) Transfer the plasmid with Cre recombinase to positive ES cells to obtain positive ES cells without selection markers;

[0136] (6) The verified ES cells were microinjected into mouse blastocysts, and then transferred to 2 surrogate mother mice, and finally 10 tool mice containing Cas9 protein were obtained.

Example Embodiment

[0137] Example 3 Obtaining conditional knockout mice

[0138] The Cas9 tool mouse was crossed with sgRNA mouse, and finally 15 mice were obtained. Different tissues of the mice were taken, the genome was extracted, PCR amplification was carried out with Eif3h-F/Eif3h-R primer pair, and then sent to Suzhou Jinweizhi Company Sequencing showed that the gene knockout rate in liver tissue was over 80%, while the genes in other tissues were intact.

[0139] The above primer pair: Eif3h-F:ATCATATATTTAATTTTCAACAAGT

[0140] Eif3h-R: CTTTCCTACAGAGCTTCACCT

[0141] Analysis of gene knockout results:

[0142] Liver tissue:

[0143]

[0144] Wild type refers to the liver tissue of mice without any modification;

[0145] Samples 1 to 15 refer to different tissues of 15 mice for experiments. The genomes of different tissues were extracted, PCR amplified, and then sent for sequencing. The results showed that only the Eif3h gene of liver tissue was modified while other tissues The Eif3h gene of the liver tissue of samples 11, 12, and 14 is not modified, which is the same as the wild type.

[0146] The main peak of the wild type after sequencing is:

[0147] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0148] Sample No. 1:

[0149] Main peak:

[0150] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0151] Secondary peak:

[0152] ATCCCATAAAAACTGCCCAAG-ATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0153] (Delete 1bp)

[0154] Sample No. 2

[0155] Main peak:

[0156] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0157] Secondary peak:

[0158] ATCCCATAAAAACTGCCCAA-CTTCTCTCTCGCTGAAGGCGTACAGACTGAC

[0159] (Delete 1bp)

[0160] Sample No. 3

[0161] Main peak:

[0162] ATCCCATAAAAACTGCCCAAG-GATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0163] Secondary peak:

[0164] ATCCCATAAAAACTGCCCAAGAGATCTCTCTCGCTGAAGGCGTACAGACTGAC (insert 1bp)

[0165] Sample No. 4

[0166] Main peak:

[0167] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0168] Secondary peak:

[0169] ATCCCATAAAAACTGCCCAAG-ATCTCTCTCGCTGAAGGCGTACAGACTGAC (1bp deleted)

[0170] Sample No. 5

[0171] Main peak: ATCCCATAAAAACTGCCCAAGG---TCTCTCGCTGAAGGCGTACAGACTGAC (3bp deleted)

[0172] Secondary peak: ATCCCATAAAAACTGC-----------------TGAAGGCGTACAGACTGAC (delete 17bp)

[0173] Sample No. 6

[0174] Main peak:

[0175] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0176] Secondary peak:

[0177] ATCCCATAAAAACTGCCCAAG-ATCTCTCTCGCTGAAGGCGTACAGACTGAC (1bp deleted)

[0178] Sample No. 7

[0179] Main peak:

[0180] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0181] Secondary peak:

[0182] ATCCCATAAAAACTGCCCAAG-ATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0183] (Delete 1bp)

[0184] Sample No. 8

[0185] Main peak:

[0186] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0187] Secondary peak: ATCCCATAAAAACTGCCCAA---TCTCTCTCGCTGAAGGCGTACAGACTGAC (3bp deleted)

[0188] Sample No. 9

[0189] Main peak:

[0190] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0191] Secondary peak: ATCCCATAAAAACTGCCCAAG-ATCTCTCTCGCTGAAGGCGTACAGACTGAC (1bp deleted)

[0192] Sample No. 10

[0193] Main peak:

[0194] ATCCCATAAAAACTGCCCAAGGATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0195] Secondary peak: ATCCCATAAAAACTGCCCAA-CTTCTCTCTCGCTGAAGGCGTACAGACTGAC (1bp deleted)

[0196] Sample No. 13

[0197] Main peak:

[0198] ATCCCATAAAAACTGCCCAAG-GATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0199] Secondary peak:

[0200] ATCCCATAAAAACTGCCCAAGAGATCTCTCTCGCTGAAGGCGTACAGACTGAC (insert 1bp)

[0201] Sample 15

[0202] Main peak:

[0203] ATCCCATAAAAACTGCCCAAG-GATCTCTCTCGCTGAAGGCGTACAGACTGAC

[0204] Secondary peak:

[0205] ATCCCATAAAAACTGCCCAAGAGATCTCTCTCGCTGAAGGCGTACAGACTGAC (insert 1bp)

[0206] For the sequencing results corresponding to the above samples 1-10, 13, 15 see Figure 15~26 Shown.

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

Similar technology patents

Power plant boiler high-temperature pipe system macro displacement measurement device and method based on CCD photography

ActiveCN104990498AShort cyclegood synchronization

Owner:ELECTRIC POWER RES INST OF GUANGDONG POWER GRID +1

Classification and recommendation of technical efficacy words

Short cycle
Improve efficiency

Conditional gene knockout method based on CRISPR/Cas9 technology

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Power plant boiler high-temperature pipe system macro displacement measurement device and method based on CCD photography

Culture medium prescription for the industrial production of rhamnolipid fermentation liquor

BN (Boron nitride)-modified SiO2 composite material and preparation method thereof

Fast reproduction method for sessiie siemona root tissue culture

Preparation method of karanjin

Classification and recommendation of technical efficacy words

Near-full-spectrum fluorescent nanocarbon dots and preparation method thereof

Device and method for automatic voice synthesis

Method for mass production of seedling of Jatropha curcas L.

Simulation test device for pneumatic load of vehicle body

Method for producing semisweet or sweet yellow wine

Video coding methods and apparatuses

Dynamic player groups for interest management in multi-character virtual environments

Method and apparatus for controlling a selectable voltage audio power output stage

Wireless power transmitter and power transmission method thereof

Multi color active regions for white light emitting diode