Conditional gene knockout method based on CRISPR/Cas9 technology

A gene knockout and positive technology, applied in the field of gene modification, can solve the problems that tissue, cell, and space-time specific knockout cannot be achieved, it is difficult to obtain double transgenic offspring mice, and the identification and screening process is complicated, reaching the test cycle Short, reduced cytotoxicity, short cycle effect

Active Publication Date: 2015-03-11
CYAGEN BIOSCI INC
View PDF2 Cites 77 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although the Cre-loxp recombinase system can mediate the conditional knockout of genes and avoid the disadvantages of traditional gene targeting techniques such as premature death of embryos caused by missing functional genes, there are still many uncertainties:
[0010] ①There is a hidden/false LoxP sequence in the mammalian genome, and its sequence may not be exactly the same as the conserved sequence of LoxP, but it can be recognized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Conditional gene knockout method based on CRISPR/Cas9 technology
  • Conditional gene knockout method based on CRISPR/Cas9 technology
  • Conditional gene knockout method based on CRISPR/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0073] Example 1:

[0074] 1. Experimental materials

[0075] ① HD Clinging Kit (639648): purchased from Clontech;

[0076] ②Premix Taq (D331A), Primerstar (DRO44A), dNTP (4030Q): purchased from Yubao Bioengineering (Dalian) Co., Ltd. (Takara);

[0077] ③ Restriction endonucleases BbsI (R0539L), AsisI (R0630L), HpaI (R0105S): purchased from Beijing Bomaisi Biotechnology Co., Ltd. (NEB); Church Cloning Vector is a commercial plasmid, purchased from Church through Addgene Laboratory; pCR-Blunt II-TOPO is also a commercial plasmid, purchased from Invitrogen through Addgene; plasmid with Cre recombinase: from Addgene, purchased from Albee Messing laboratory; Rosa26 expression vector source, from Addgene, purchased from Liqun Luo laboratory.

[0078] 2. Gene structure and sequence analysis

[0079] Target gene: mouse eukaryotic translation initiation factor 3 (Eif3h gene);

[0080] Ensembl gene coding number: ENSMUSG00000022312;

[0081] Eif3h gene structure: Eif3h gene contains 8 exons, inc...

Example Embodiment

[0113] Example 2 Construction of Cas9 expression vector and production of Cas9 tool mouse

[0114] (1) Amplification of Cas9 protein

[0115] ① Design primers for amplification of Cas9 protein as follows:

[0116] Cas9-F: CGCGGTCTTTCCAGTGATCGATTAGTTATTAATAGTAATCAA

[0117] Cas9-R: CTCTAGTCCGCGGGTGCGATAGCTCACACCTTCCTCTTCTTCTTG

[0118] ② PCR amplification of the complete sequence of Cas9 protein, the system is as follows:

[0119]

[0120] The PCR program is as follows:

[0121]

[0122]

[0123] ③The PCR products are subjected to agarose gel electrophoresis, such as Picture 9 Shown.

[0124] (2) Cas9 protein is connected with Rosa26 carrier

[0125] ①Use Clontech's HD Clinging Kit connects the correct Cas9 sequence to the vector linearized by AsisI and HpaI enzymes. The vector is modified by the company, with a broad-spectrum expression promoter CMV, 5’arm of Rosa26, and Rosa26 of 3’arm. The map is as follows Picture 10 Shown.

[0126] ②The ligated vector is transformed into E. coli, clo...

Example Embodiment

[0137] Example 3 Obtaining conditional knockout mice

[0138] The Cas9 tool mouse was crossed with sgRNA mouse, and finally 15 mice were obtained. Different tissues of the mice were taken, the genome was extracted, PCR amplification was carried out with Eif3h-F / Eif3h-R primer pair, and then sent to Suzhou Jinweizhi Company Sequencing showed that the gene knockout rate in liver tissue was over 80%, while the genes in other tissues were intact.

[0139] The above primer pair: Eif3h-F:ATCATATATTTAATTTTCAACAAGT

[0140] Eif3h-R: CTTTCCTACAGAGCTTCACCT

[0141] Analysis of gene knockout results:

[0142] Liver tissue:

[0143]

[0144] Wild type refers to the liver tissue of mice without any modification;

[0145] Samples 1 to 15 refer to different tissues of 15 mice for experiments. The genomes of different tissues were extracted, PCR amplified, and then sent for sequencing. The results showed that only the Eif3h gene of liver tissue was modified while other tissues The Eif3h gene of the liv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer used for gene knockout, which comprises five groups of primer, and can be respectively shown in a SEQ NO:1, a SEQ NO:2, a SEQ NO:3, a SEQ NO:4, a SEQ NO:5, a SEQ NO:6, a SEQ NO:7, a SEQ NO:8, SEQ NO:9 and a SEQ NO:10. The invention also discloses an application of the primer in gene knockout aspect. The invention also discloses a conditional gene knockout method based on a CRISPR/Cas9 technology. The method can performing condition specificity, space-time specificity, and medicine-induced type gene modification; harm due to other cells can be reduced, function of constitutive expression gene in a specific tissue can be researched; tissue and space specificity gene knockout or induction type gene knockout can be realized by only using Cas9 tool mice; test period is short, and time and cost are saved.

Description

technical field [0001] The invention belongs to the technical field of gene modification, in particular to a conditional gene knockout method based on CRISPR / Cas9 technology. Background technique [0002] With the advancement of science and technology and the continuous exploration of the field of life sciences, it is more urgent to study the expression of a gene in a specific tissue, cell and time in vivo. The site-specific recombination technology developed rapidly in recent years is a key gene manipulation tool to meet this need. It can induce target gene inactivation at a certain developmental stage or in a specific tissue, avoiding embryonic damage caused by target gene deletion. In case of early death or complex phenotype, delete the screening marker gene, so as to make a complete functional analysis of the target gene. Currently widely used recombinase systems include Cre-LoxP system, FLP-FRT system, R-RS system and I-SceI system, but the most widely used system is C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/85
Inventor 郑敦武营婷姜莎莎俞晓峰欧阳应斌徐文静黎妃凤朱道云王正龙
Owner CYAGEN BIOSCI INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap