Porcine epidemic diarrhea recombinant baculovirus gene engineering subunit vaccine, preparation method and application thereof

A recombinant baculovirus, porcine epidemic diarrhea technology, applied in genetic engineering, botanical equipment and methods, microorganism-based methods, etc., can solve the problems of low expression, low effective antigen content, poor immunogenicity, etc. , to achieve the effect of high expression level, good immunogenicity and high expression

Inactive Publication Date: 2014-02-19
SOUTH CHINA AGRI UNIV
View PDF5 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above expression strategies have disadvantages: the S protein is a glycosylated protein, and the prokaryotic expression system cannot be modified accordingly, resulting in poor immunogenicity of the expressed recombinant S1 protein or M protein; the expression level is generally not high, resulting in an effective antigenic amount The content is too low to prepare subunit vaccines; all of them are expressed in a single way, and the biological activities of S1 protein and M protein are not simultaneously exerted by the dual expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine epidemic diarrhea recombinant baculovirus gene engineering subunit vaccine, preparation method and application thereof
  • Porcine epidemic diarrhea recombinant baculovirus gene engineering subunit vaccine, preparation method and application thereof
  • Porcine epidemic diarrhea recombinant baculovirus gene engineering subunit vaccine, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction of recombinant vectors Bacmid-S1p-M and Bacmid-S1

[0031] 1. Acquisition of PEDV S1 gene, S1 partial antigen gene and M gene: Design a pair of specific primers according to the gene sequence of newly isolated PEDV strains. The primer sequences are as follows:

[0032] S1-P1: 5'CGGAATTCCAAGATGTCACTAGGTGCCAGTCTA 3'

[0033] S1-P2: 5' CCCTCGAGCTATCTAATACTCATACTAAAGTTGGTGGG 3'

[0034] M-P1: 5' GAAGGCCTATGCATCACCATCACCATCACGATTA 3'

[0035] M-P2: 5' CCAAGCTT TTA GACTAAATGAAGCACTTTCTC 3'

[0036] S1p-P1: 5' CCCTCGAG ATG GTACTTCTAACACTTAGCCTACCAC 3'

[0037] S1p-P2: 5' CATGCATGC CTAs AGGATCTGAGGAATTACTGCAAACA 3'

[0038] The total RNA was extracted from the positive PEDV disease material, and each downstream primer P2 was used as the specific primer for RT; then the cDNA product was used as the template to amplify the whole S1 gene, S1p (partial epitope of S1 gene) by PCR technology. ) and M gene; wherein the nucleotide sequence of the gene S1...

Embodiment 2

[0043] Obtaining of Recombinant Baculovirus Bacmid-S1p-M and Bacmid-S1

[0044] 1.1 Recovery and subculture of Sf9 insect cells

[0045] 2. Transfect Sf9 cells with recombinant Bacmid-S1p-M and Bacmid-S1 plasmids by 2×10 5 Inoculate Sf9 cells on a 12-well cell culture plate at a density of 12, and transfect when the cells grow to 80-90% full, discard the old cell culture medium, and replace it with serum-free Grace cell culture medium; in sterile 1.5 Prepare the following solutions in a mL centrifuge tube: Solution A: Dilute 1.6 μg DNA to 100 μL with GRACE Incomplete Cell Culture Medium; Solution B: Dilute 4.0 μL Lipofectanmine2000 to 100 μL with GRACE Incomplete Cell Culture Medium; Mix Solution A and Solution B, stand at room temperature for 20 minutes to form a complex of liposomes and DNA; slowly add the complexes of liposomes and DNA to the cell surface drop by drop (do not discard the nutrient solution); after 4 to 6 hours, it will contain the transfection solution ...

Embodiment 3

[0046] The preparation of embodiment 3 vaccine:

[0047] After the recombinant baculovirus Bacmid-S1p-M and recombinant baculovirus Bacmid-S1 were obtained through Example 2, the M protein and the S1 protein were expressed using a virus expression system. The step is to expand the culture of recombinant baculovirus Bv-S1p-M or recombinant baculovirus Bv-S1, purify and recover to obtain S1 protein or S1p protein and M protein; expand the culture to obtain recombinant baculovirus Bv-S1 with a suitable titer After the virus, when the cells are in the mid-log phase (the density is 1-2×10 6 Cells / mL) were inoculated with infected cells, and the insect cells were cultivated under serum-free conditions, which would facilitate the purification of the target protein in the later stage. However, generally according to needs, 0.1-0.5% FBS or BSA should be added at the late stage of infection to protect the recombinant protein from hydrolysis. After the cells were inoculated with th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological vaccine preparation, and particularly relates to a porcine epidemic diarrhea (PED) recombinant baculovirus gene engineering subunit vaccine, a preparation method and an application thereof. According to the present invention, S1 gene and M gene of the current new PEDV epidemic strain are selected as reference sequences, a baculovirus expression system is adopted to express S1 protein or partial S1 protein and M protein, and the obtained recombinant protein is prepared into a subunit vaccine for effectively controlling PED occurrence; with the PED recombinant baculovirus gene engineering subunit vaccine produced by using the method, the defect of the current PEDV traditional vaccine is solved; and the PED recombinant baculovirus gene engineering subunit vaccine can be used for prevention and treatment of PEDV infections and related diseases caused by PEDV, and can further be used for preparation of coating antigen of PEDV detection antibody ELISA kits.

Description

technical field [0001] The invention belongs to the technical field of biological vaccine preparation, in particular to a porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application. Background technique [0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric infectious disease caused by porcine epidemic diarrhea virus (PEDV), characterized clinically by watery diarrhea, vomiting, and dehydration . Pigs of all ages are susceptible, especially suckling piglets. PED is widely distributed in the world, the United Kingdom, Belgium, France, Hungary, Canada and other countries have reported the occurrence of this disease. According to reports, PED has occurred quite seriously in Asian countries in recent years. Japan, South Korea, and Thailand have all experienced pandemics, with high mortality and serious harm, causing huge economic losses to the pig industry. [0003] PEDV was isol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/215C12N15/50C12N15/86A61P31/14C12R1/93
Inventor黄毓茂谭博敏项林盛
OwnerSOUTH CHINA AGRI UNIV