241 results about "Fluorophore" patented technology

The invention discloses an immunofluorescence imaging method for driving tyramine signal amplification based on chemiluminescence and application thereof, and relates to the technical field of biomedical imaging. The immunofluorescence imaging method comprises the following steps: carrying out first incubation on a to-be-detected sample and a peroxidase-labeled antibody; performing second incubation on the to-be-detected sample after the first incubation and a tyramine substrate containing a fluorophore under a dark condition; adding a chemiluminescent substrate solution into the to-be-detected sample after the second incubation, and carrying out image acquisition; wherein the antibody can be specifically bound with a target protein; the tyramine substrate can generate active free radicals under the catalysis of peroxidase, so that the active free radicals are covalently cross-linked with tyrosine residues; the chemiluminescent substrate solution comprises hydrogen peroxide and luminol. The immunofluorescence imaging method improves imaging signal and fluorescence stability, effectively reduces background interference and phototoxicity, is suitable for long-time stable fluorescence immunoimaging, and is especially suitable for high-sensitivity detection of low-expression protein markers.

A method, in accordance with one aspect of the present invention, includes, during performance of an additive manufacturing process that includes photocuring of a resin, monitoring light output generated by a fluorophore in the resin that exhibits aggregation-induced emission (AIE) behavior. The method also includes outputting an indication of an extent of photocuring based on the monitored light output. The method also includes adjusting in real time a parameter of the additive manufacturing process based on the output indication. A method, in accordance with another aspect of the present invention, includes analyzing at least one mechanical property of a polymeric structure formed by an additive manufacturing process based on light output generated by a fluorophore in the structure.

The present disclosure provides improved and useful techniques for cross-standardization of flow cytometry instruments and, particularly, spectral flow cytometry instruments. Aspects of the disclosure include methods of calibrating a flow cytometer having a plurality of fluorescence channels. Methods of interest utilize calibration sets of bead populations, wherein each bead population of the calibration set includes a different fluorophore attached to a surface thereof and the calibration set includes a number of bead populations that is less than the number of fluorescence channels of the flow cytometer. Flow cytometers, non-transitory computer-readable storage media, and kits including, e.g., calibration sets of bead populations for carrying out the subject methods are also provided.

The invention relates to the technical field of molecular detection, in particular to a method, a system, a kit and a probe for detecting BRCA2 gene mutation. The detection method comprises the following steps: carrying out pretreatment and PCR amplification on a blood sample, carrying out a hybridization reaction with a probe to obtain a sample, detecting the sample based on an SERS technology, and collecting an SERS spectrum. Whether BRCA2 gene mutation exists or not is judged by identifying characteristic double peaks of a cy3 fluorophore at 1188 cm <-1 > and 1393 cm <-1 >, and the whole detection process can be completed within 2 hours. According to the scheme, the region, carrying the BRCA2 gene, on the DNA can be amplified through the specific primer pair, then the DNA is specifically combined through the improved oligonucleotide probe, and detection is achieved through the reporter molecule on the oligonucleotide probe; therefore, the detection method provided by the scheme has the advantages of high detection speed, high sensitivity and high detection result accuracy, and the problems of long time consumption and high cost of the traditional PCR or NGS technology are effectively solved.

This invention discloses an ERβ-targeted hydrogen peroxide-responsive near-infrared fluorescent probe, its preparation method, and its applications, belonging to the field of medical technology. The fluorescent probes of this invention are dicyanomethylene-4H-benzodihydropyran compounds P1 and P2 containing borate ester groups, with the following structural formula. These fluorescent probes use DCM-OH as a backbone, acting as both a fluorophore and an ERβ ligand. The borate ester group is the H2O2 responsive group. The introduction of the borate ester group disrupts the push-pull effect of the DCM-OH fluorophore, preventing fluorescence emission. However, in a high-concentration H2O2 environment, the borate ester group is specifically cleaved by H2O2, subsequently exhibiting strong initiation fluorescence and enabling tumor imaging in vitro and in vivo. This invention brings new opportunities for the diagnosis and research of prostate cancer.

This invention discloses a naphthimide-based fluorescent probe for detecting HClO and its preparation method. The fluorescent molecular probe uses naphthimide as the fluorophore and C=N as the specific reaction site for HClO. Due to the presence of the naphthimide fluorophore, the probe molecule exhibits two-photon properties, enabling deep tissue penetration, reducing background noise, and facilitating fluorescence imaging of biological systems. Furthermore, the introduced morpholine group allows for lysosomal targeting, enabling the monitoring of hypochlorous acid concentration levels in lysosomes, making it a valuable tool for early disease diagnosis. In addition, this type of probe molecule is simple to synthesize, operates under mild reaction conditions, exhibits stable optical properties, and has a high synthesis yield. It can detect a wide range of HClO, making it practically valuable in fields such as biochemistry and environmental science.

The invention relates to the technical field of biology, and discloses a molecular beacon and a high-throughput sequencing library absolute quantification method thereof, and a fluorescent molecular beacon oligonucleotide (Oligo) sequence comprises a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region at the 5'upstream of the nucleotide chain (Loop chain) of the sequencing library recognition region, and a second universal sequence region at the 3 'downstream of the nucleotide chain (Loop chain) of the sequencing library recognition region; 5'of the first universal sequence region is modified into a fluorophore, and 3 'of the second universal sequence region is modified into a quenching group; and a nucleotide chain of the sequencing library recognition region is from an Illumina anmena sequencing platform or an MGI Huazai sequencing platform. The invention comprises a fluorescent molecular beacon for high-throughput sequencing library sequencing before-loading quantification, a sequence applied to a high-throughput sequencing platform and a detection method for library absolute quantification based on the molecular beacon, and overcomes the defects of a current gold standard detection method in technology and efficiency. The quantitative precision of the sequencing library is ensured; meanwhile, the economic and time cost of an actual application end is greatly reduced.

Systems and methods that enable analyte detection in a multiplexed amplification process can include obtaining, at multiple time points during the amplification process, composite fluorescence signal data associated with a composite fluorescence signal from at least a first probe type comprising a first fluorophore and a second probe type comprising a second fluorophore which has substantially overlapping spectral characteristics as said first fluorophore, the first probe type and the second probe type differing in thermal and / or temporal properties; and determining, based at least partially on the composite fluorescence signal data, fluorescence signal data associated with a fluorescence signal from a given probe type of the first probe type or the second probe type during the amplification process.

The invention provides an inhibitor near-infrared fluorescent probe targeting fibroblast activation protein, a preparation method and application thereof, and belongs to the field of biotechnology and medicine preparation. The chemical structural formula of the inhibitor near-infrared fluorescent probe is shown as a formula (1), a targeting part, a near-infrared fluorophore and fatty diacid in an existing radiopharmaceutical for targeting fibroblast activating protein are innovatively coupled, and the novel fibroblast activating protein inhibitor near-infrared fluorescent probe is developed. The probe can be rapidly distributed and specifically enriched in tumor tissues, and meanwhile, due to the fact that blood removal is slowed down, fluorescence signals in tumors are remarkably enhanced and detained for a long time, so that an excellent tumor and background signal ratio is obtained, and good biological safety is shown under the effective working concentration.

Described herein are methods and systems for training image to image translation machine-learning models, wherein the image to image translation machine-learning models are trained using unpaired images. The trained image to image translation machine-learning models can be used to digitally identify markers of a fluorescent image depicting a plurality of markers in a single color channel from a single fluorophore and / or enhance a fluorescence image.

An analytical method of and system for monitoring cell status whereby excitation energy is focused to an excitation cytometry volume in a cell sample to fluoresce first and second fluorophores of a cell. Fluorescence signals from the first and second fluorescing cell fluorophores are directed to a detection subsystem. A first peak in fluorescence intensity for the first fluorophore is detected as is a second peak in fluorescence intensity for the second fluorophore. The fluorescence signals are processed to identify when the first and second peaks occur substantially simultaneously indicating the presence of a cell at the excitation cytometry volume instead of background fluorescence and in response, the cellular status of the cell is measured using the intensity of the levels of the first and second peaks.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

Techniques for measuring single synaptic signals under varying experimental conditions include controlling a video recording microscope to capture, at multiple different times, a first imaged area in a sample holder as a video frame when the sample holder is disposed on a stage and holds a sample of neuronal tissue combined with at least one fluorophore that emits a corresponding electromagnetic wavelength in a synapse during synaptic activity. At least one synaptic region of interest is determined based on a group of pixels in the first imaged area that record electromagnetic emissions from the fluorophore at the different times. An ordered time series of emission intensity is recorded in each of the synaptic region of interest. Peak emission intensity values in the time series are corrected for transmitter label transients. The ordered time series with corrected peak emission intensity values are stored in a data structure with a standard format.

This invention concerns novel oxazine-based fluorophore compounds useful in in vivo nerve imaging, as well as compositions comprising them and methods for their use.

The application discloses a fluorescence enhancement anchor agent based on a fluoroboron dipyrrin-tetrazine dye for inflation microscopy technology, and belongs to the technical field of biochemical analysis. The fluorophore of the fluorescence enhancement anchor agent is shown in formula (I), formula (II) or formula (III): the tetrazine group carried by the fluorescence enhancement anchor agent is removed from fluorescence quenching through a biological orthogonal reaction with a drug probe, and the drug probe is shown in formula (IV): the fluorescence enhancement anchor agent can covalently and non-covalently anchor small molecules in a hydrogel network based on a tetrazine biological orthogonal reaction, and realizes inflation microscopic fluorescence imaging of a double fluorescence enhancement mechanism. In addition, the drug probe selects a non-covalent drug, gefitinib, as a probe core, is modified with a BCN click handle, and successfully realizes in-situ fluorescence inflation microscopic imaging of an EGFR drug-target, thereby providing a new tool for research and clinical research on non-covalent drug target co-localization information of exosomes.

A method for characterizing a melting transition in a semicrystalline polymer is disclosed. The method includes incorporating a fluorophore into the semicrystalline polymer, changing a temperature of the semicrystalline polymer to vary across a range of temperatures including a plurality of temperatures, and capturing an emission spectrum of the incorporated fluorophore at each temperature of the plurality of temperatures. The method also includes integrating each emission spectrum to determine a temperature-dependent integrated fluorescence intensity for the semicrystalline polymer, numerically differentiating the temperature-dependent integrated fluorescence intensity, and characterizing the melting transition of the semicrystalline polymer by identifying a stepwise change in value of the differentiated intensity. The semicrystalline polymer may be a thermoplastic. Incorporating the fluorophore into the semicrystalline polymer may include physically doping the semicrystalline polymer with the fluorophore or covalently labeling the semicrystalline polymer with the fluorophore.

The invention relates to the field of fluorescent probes, in particular to a CO fluorescent probe, a preparation method of the CO fluorescent probe and application of the CO fluorescent probe in a reagent for detecting inflammatory reaction in a living body. The probe takes DBX-OH with a push-pull electronic structure as a red fluorophore, and is connected with a recognition unit allyl chloroformate through a phenolic hydroxyl group of the DBX-OH. The detection mechanism is as follows: when the probe does not react with CO, the fluorescence of the probe is in a closed state due to a photoinduced electron transfer effect; when the allyl chloroformate and CO are subjected to specific reaction under the catalysis of Pd (0), the allyl chloroformate chain is broken and separated, and the PET process is inhibited, so that the strong red fluorescence of DBX-OH is recovered, and the'open 'type detection is realized. The probe has the outstanding advantages of red light emission, excellent water solubility, extremely low detection limit and the like. The method is successfully applied to in-vivo inflammation detection of mouse and zebra fish models, and the dual application potential of the method in the field of biomedical research is highlighted.

The application discloses a fluorescence tomography reconstruction imaging method based on a physical model depth network, acquires tissue surface light intensity information through a CCD camera, performs mesh partitioning on a phantom by using Amira software, respectively partitions two meshes with different precisions, respectively solves corresponding system matrices and adjacent matrices of mesh nodes by using the mesh after partitioning and optical parameters of each region in the phantom through a finite element method, sets a transfer matrix corresponding to the power density of different meshes, then transmits surface light intensity data into a depth network, solves in a coarse mesh, and demarcates a feasible area for solving a fine mesh according to the solving result of the coarse mesh, and solves in the feasible area, so that the norm of the obtained solution is small, the result is relatively sparse, the error of the norm and the result forward and the real surface light intensity is considered during solving, the position of a fluorescent group in the tissue can be positioned more accurately, and the application has important significance for studying tumors and early diagnosis of tumors.

The disclosure concerns methods of high throughput sequencing that utilize labeled moieties comprising a fluorophore having a Stokes Shift of at least 90nm.

The invention belongs to the technical field of biological medicines, and relates to a pharmaceutical composition and application thereof in preparation of a medicine for treating tumors. The pharmaceutical composition comprises a double-end functional molecule, a catalyst and an alkynyl-modified pharmaceutical molecule, the chemical structure of the double-end functional molecule is shown as a formula I, R is a fluorophore, X is methylene or O, Y is methylene or carbonyl, and n is 1-3; the drug molecule has anti-tumor activity; the catalyst can catalyze an azide group to react with alkynyl, so that a double-end functional molecule is connected with a drug molecule. The pharmaceutical composition provided by the invention can capture drug molecules on the surface of a cell membrane in situ and realize slow release under an enzymatic reaction condition, so that the treatment effect of the drug molecules is improved.

In general, disclosed herein are fluorogenic compounds having the structure of Formula (I):Fluorogenic compounds disclosed herein may be useful in methods for visualizing a sample. The method may include conjugating the biomolecule with sample comprising a fluorogenic compound disclosed herein; incubating the biomolecule with the fluorogenic compound for a sufficient time to allow for fluorogenic bioconjugation of the fluorogenic compound; subjecting the fluorogenic compound to an oxidative condition; contacting the fluorogenic compound with a dye; and imaging the fluorogenic compound, thereby determining the fluorescence intensity change of the fluorogenic compound.

Methods, kits, and oligonucleotides used in the detection of coronavirus, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), are disclosed. In some aspects, the oligonucleotides are primers or probes used in the described methods or kits. The nucleotide sequence of the oligonucleotide consists of 300 or less, 150 or less, or 40 or less continuous nucleotides from a nucleotide sequence selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO: 5, or is a variant thereof. In some embodiments, the oligonucleotide is modified with an internal spacer or a detectable label. For example, the 5′ terminus is labeled with a fluorophore and the 3′ terminus is complexed to a quencher of fluorescence of said fluorophore. In some embodiments, the nucleotide sequence of the oligonucleotide further comprises a universal tail sequence.

The present application relates to compounds of formula (Ia) or (Ib): or a salt, solvate, or tautomer thereof; wherein R1, and R2 are independently selected from optionally substituted C1 to C 8 alkyl; or R1 and R2 together with the silicon atom to which they are attached form an optionally substituted 5- or 6-membered ring; R3, and R4 are independently selected from H, optionally substituted C1 to C 8 alkyl; optionally substituted C1 to C 8 haloalkyl; or R3 and R4 together with the nitrogen atom to which they are attached form an optionally substituted azetidine or pyrrolidine ring; R3', and R4' are independently selected from H, optionally substituted C1 to C8 alkyl; optionally substituted C1 to C 8 haloalkyl; or R3' and R4' together with the nitrogen atom to which they are attached form an optionally substituted azetidine or pyrrolidine ring;R5 is selected from a negative charge, H, C1 to C 8 alkyl, or optionally substituted aryl; a is 0 or 1; and Z is a divalent linker group; and to fluorophore compositions comprising such compounds, to assay methods and to kits using such fluorophore compositions.

This disclosure provides a method for detecting an analyte in a sample, wherein the sample is introduced into an analytical chamber along with emulsion droplets or gel beads. In another aspect, this disclosure provides designs for formulating emulsion droplets or gel beads such that they can be used for the large-scale parallel detection of analytes. Formulations containing specific combinations of fluorescent particles allow for the optical determination of the identity of each fluorescent particle. These combinations are based on the particle fluorescence emission wavelength, fluorescence excitation wavelength, and particle count.

It is disclosed herein that that certain alkylphosphocholine analogs are preferentially taken up by malignant pediatric tumor cells. The alkylphosphocholine analogs are compounds having the formula:or salts thereof, wherein n is an integer from 12 to 24; and R2 is —N+(CH3)3. The compounds can be used to treat pediatric solid tumors or to detect pediatric solid tumors. In therapeutic treatment, R1 includes a radioactive iodine isotope that locally delivers therapeutic dosages of radiation to the malignant pediatric tumor cells that preferentially take up the compound. In detection / imaging applications, R1 includes a detection moiety, such as a fluorophore or a radioactive iodine isotope.

This invention discloses an endoscopic device for thyroid surgery based on fluorescence lifetime and Raman spectroscopy imaging, comprising: a light source assembly, an endoscope probe, a fluorescence lifetime image signal acquisition module, a Raman spectroscopy signal acquisition module, and a color image acquisition module; a host unit, including a control unit and an image processing unit; and a display for displaying an image fused with the Raman spectroscopy signal, the fluorescence lifetime image signal of cancerous tissue, and the color image, as well as an image fused with the Raman spectroscopy signal and the color image. This invention utilizes Raman spectroscopy to visualize the autofluorescence of the parathyroid glands, enabling precise localization of the parathyroid glands. Raman spectroscopy can also locate regional lymph nodes and adipose tissue in the central thyroid region, and combined with fluorescence lifetime imaging, it can provide the conformational state of fluorophores in the neck tissues, marking cancerous tissues and providing real-time optical auxiliary localization for differentiating various anatomical tissues during thyroid endoscopic surgery.

A method includes applying an optical pulse to a fluorophore to drive the fluorophore from a ground singlet state to an excited singlet state. In response, the fluorophore undergoes an intersystem crossing from the excited singlet state to a metastable triplet state. A microwave pulse is then applied to the fluorophore to at least partially transfer the fluorophore from an initial spin-qubit state to an encoded spin-qubit state. A second optical pulse may be applied to the fluorophore to drive the fluorophore from the metastable triplet state to a higher-energy triplet state, wherein the fluorophore undergoes a reverse intersystem crossing to an excited singlet state. A photon emitted by the fluorophore, in response to the fluorophore decaying from the excited singlet state to the ground singlet state, is then detected.

In some instances, a system for rapid spectral unmixing using spectrally interpolated background reduction (SIBR) is provided. The system comprises a device comprising an excitation light source and a detector. The system further comprises a control system configured to: obtain a plurality of excitation spectra for a plurality of fluorophores that are used to stain a sample; determine a plurality of chosen wavelengths and a plurality of chosen light intensities for the plurality of fluorophores; obtain a first detection of the sample based on using a set of first wavelengths from the plurality of chosen wavelengths and a set of first light intensities; obtain a second detection of the sample based on using a set of second wavelengths from the plurality of chosen wavelengths and a set of second light intensities; and output a SIBR quantity.

This application discloses a fluorescent probe for labeling the outer membrane of Gram-negative bacteria, its preparation method, and its application. The fluorescent probe uses polymyxin (with its hydrophobic tail and two amino acid residue pairs removed) as a targeting group specifically targeting the outer membrane of Gram-negative bacteria. This structure can specifically bind to the lipopolysaccharide structure in the outer membrane, and is then linked to the fluorophore rhodamine, which has switching properties, to design and synthesize a fluorescent dye. This fluorescent probe, possessing fluorescent switching properties, can be applied to super-resolution imaging of the outer membrane of Gram-negative bacteria.