213 results about "Fluorescein" patented technology

The invention relates to the technical field of biological detection, and provides an inflammatory factor detection kit based on a liquid-based chip technology, and the inflammatory factor detection kit comprises six fluorescent microspheres coupled with capture antibodies, and six detection antibodies labeled by report fluorescence; in the six fluorescent microspheres containing the captured antibodies, the fluorescence intensities of all the fluorescent microspheres are different; according to the detection kit provided by the invention, on the basis of a liquid-based chip technology, fluorescein is adopted to carry out fluorescence coding on microspheres, and a captured antibody is connected to the fluorescent microspheres through a chemical reaction; a detection target is captured through the fluorescent microspheres, and then a signal is displayed through the detection antibody, so that the detection of the inflammatory factors is completed, the defects of large demand quantity of soluble inflammatory factor detection samples, long detection time, tedious detection steps and the like in the prior art are overcome, and great convenience is brought to scientific researchers at a hospital end and an industrial end.

The invention discloses a method for detecting soil active organic carbon based on fluorescence spectrometry, and belongs to the technical field of soil detection. The method comprises the following steps: sequentially drying, sieving and grinding fresh soil to obtain a soil sample, and sequentially performing active organic carbon extraction, purification, decoloration and pH regulation on the soil sample to obtain a soil liquid to be detected. The method comprises the following steps: adding fluorescein into a soil liquid to be detected to form a soil internal standard detection liquid, obtaining a soil fluorescence spectrum through three-dimensional fluorescence spectrum scanning, carrying out background deduction and correction coefficient correction, and calculating the active organic carbon concentration of the soil by using tryptophan, tyrosine and SMP fluorescence concentration standard curves. According to the method, an internal standard method is combined with a fluorescence spectrum technology, and through multi-step sample pretreatment and spectrum correction, the detection accuracy and the anti-interference capability are improved, the active organic carbon concentration of the soil can be rapidly and accurately determined, and an effective means is provided for soil carbon cycle research and quality evaluation.

The present invention belongs to the technical field of immunochromatography. Provided are a streptavidin multimer, and a preparation method therefor and the use thereof. The prepared streptavidin multimer has a strong affinity for a biotin / fluorescein nucleic acid probe. A nucleic acid test strip prepared with the prepared streptavidin multimer can realize rapid and high-sensitivity detection of a sample to be detected. Results can be obtained in 5 minutes, the false positive rate can be reduced, and the cost of the nucleic acid probe is reduced, which is convenient for non-professional technicians to easily and accurately judge the results.

Provided is a coating composition capable of forming a coating film layer, which has low coefficient of linear expansion at low dielectricity, excellent adhesive properties even when the surface of a counterpart material is smooth, and few coating film defects such as cracks and holes. A coating composition including 2 or more kinds of fluororesin emulsions, wherein at least 1 kind of the fluororesin, a fluororesin (I), has a number of functional groups of 30 to 1,000 per 106 main-chain carbon atoms, and the coating composition further includes an anisotropic filler, a surfactant, and a liquid medium.

The invention provides a quadruple test method for inflammatory factor markers CRP, SAA, PCT and IL-6, and belongs to the technical field of biological detection. According to the present invention, the digital fluorescence immunoassay technology is adopted, the antibodies are immobilized on the detection plate, and after the antigen in the sample is combined with the immobilized antibodies, the fluorescein-labeled antibody is combined with the other antigen determinant on the antigen so as to detect the antigen in the sample; therefore, a sandwich type compound structure is constructed between the immobilized antibody and the fluorescein labeled antibody, the higher the antigen concentration is, the more the fluorescent particles are, and the content of the antigen is quantified through the number of the fluorescent particles. By means of the unique design, high-sensitivity and high-precision detection of antigens can be achieved, the content of the antigens can be accurately quantified by accurately counting the number of the fluorescent particles, the influence of lipemia / hemolysis on the detection result can be avoided, the detection range is wide, sensitivity is high, accuracy is high, and detection is automatic, convenient and rapid.

In one embodiment, a method of building an optimized color flow cytometry panel is disclosed using a full spectrum flow cytometer with five excitation lasers and five corresponding detection modules. In another embodiment, a graphical user interface is disclosed generated by a server computer from a fluorochrome database and displayed by a client computer to assist in the selection of a set of fluorochromes for use in an assay to analyze biological samples. The GUI can display spectra graphs to visually show how fluorochromes may overlap and can generate similarity indexes for the paired fluorochrome interference and a complexity index for overall many to many interferences generated by a selected group or set of fluorochromes.

The invention discloses a kit for joint detection and a preparation method thereof, and relates to the field of medical detection. The kit for joint detection comprises a magnetic bead coated with a capture antibody, an enzyme-labeled antibody compound, a fluorescein-labeled antibody and a luminous substrate, and the magnetic bead coated with the capture antibody comprises a first antibody specifically bound with Tau217 and a first antibody specifically bound with NfL. The method comprises the following steps: mixing and incubating an object to be detected with captured antibody-coated magnetic beads, an enzyme-labeled antibody compound and a fluorescein-labeled antibody, injecting 630nm exciting light into an instrument, automatically collecting a light signal 1, carrying out a contact reaction on the compound and a luminous substrate, automatically collecting a 470nm light signal 2 emitted by an enzyme catalysis substrate by the instrument, and determining whether the light signal 2 is 470nm or not. The content of two to-be-detected substances, namely Tau217 and NfL, is identified through different optical signals, two items, namely phosphorylated Tau 217 and neural light chain protein, are jointly detected, the detection sensitivity is improved, the time required by the two items of detection is shortened to the time required by one item of detection, and the detection efficiency of the Alzheimer's disease marker is improved.

The invention relates to a streptavidin polymer as well as a preparation method and application thereof, and belongs to the technical field of immunochromatography. The prepared streptavidin polymer has strong affinity with a biotin / fluorescein nucleic acid probe, nucleic acid test paper prepared from the prepared streptavidin polymer can realize rapid and high-sensitivity detection on a detected sample, a result can be obtained within 5 minutes, the false positive rate can be reduced, the cost of the nucleic acid probe is reduced, and the method is suitable for popularization and application. And non-professional technicians can conveniently, easily and accurately judge the result.

This invention discloses an AfBPP-based active molecular probe for thiostreptin, its preparation, and its application, belonging to the field of chemical biology. This invention introduces a bifunctional tag integrating a photocrosslinking group (bisacrididine) and a bioorthogonal reactive group (alkynyl group) into the structure of thiostreptin. While retaining the original biological activity of the parent compound, it endows the probe with highly efficient probe function, solving the technical problem of target loss during washing and purification of traditional non-covalent probes. After target labeling, the probe can specifically connect to reporter groups such as fluorescein or biotin through click-chemical reactions, achieving efficient enrichment of drug targets. Combined with mass spectrometry analysis, it enables global identification of potential targets in cells or complex biological samples at the omics level, such as chemical proteomics, providing a powerful molecular tool for in-depth revelation of the potential targets and pharmacological mechanisms of thiostreptin.

The invention relates to the technical field of determination of enzymes or microorganisms, in particular to a single-molecule fluorescence detection device which comprises a shell, a detection main body, a display screen and a cleaning assembly, the detection main body comprises a reactor module, a pipeline module, an adjusting module, an optical module, a temperature early warning module, a detection module and an image data processing module; the reactor module fixes a large number of primer DNA sequences; the pipeline module is used for adding each component of the extension reaction system into the reactor module for sequencing circulation such as DNA chain extension and breakage, after the DNA chain is extended, specific basic groups participating in extension are detected through a total internal reflection microscope, then fluorescein is removed, next extension is carried out, and multiple sequencing circulation is completed; data obtained through the optical module are processed through the image data processing module in the computer, finally sequence information of the DNA chain to be detected is obtained, and when the temperature of the reactor module is abnormal, the temperature early warning module discovers the temperature abnormality in time and gives an alarm.

The invention discloses a method for detecting perfluorinated compounds by using a sensor array composed of dyes, comprising the following steps: S1, preparing a fluorescent dye solution: preparing a fluorescein diluent, a coumarin 7 diluent, and a cyanine diluent; S2, preparing a pollutant solution: preparing diluted PFBA solution, PFOA solution, PFDA solution, PFUdA solution, and PFDoA solution; S3, constructing a fluorescent sensor array and detecting perfluorinated compounds: placing a sample in a fluorescence spectrometer for detection. The dyes used in the detection method of the invention are easy to obtain and have strong fluorescence stability. The sensor array can detect perfluorinated compounds with similar structures, and the operation is simple.

The invention discloses preparation and visual detection application of an Ag / {001} Bi2Fe4O9 nanosheet, relates to the technical field of visual ultra-sensitive detection of 2, 4-dichlorophenol, and aims to realize an in-situ and ultra-sensitive visual detection method for the 2, 4-dichlorophenol. The method comprises the following steps: uniformly mixing a xanthene dye fluorescein aqueous solution, an Ag / {001} Bi2Fe4O9 nanosheet suspension and a 2, 4-dichlorophenol aqueous solution to obtain a solution to be detected; the method comprises the following steps: putting a solution to be detected into a Pomfiley multi-channel photocatalytic reactor, carrying out dark adsorption by stirring without illumination, then starting visible light, carrying out sufficient illumination, filtering by adopting a 22-micron water-phase filtering membrane, and finally testing by adopting an ultraviolet and visible spectrophotometer, thereby completing photosensitization detection of 2, 4-dichlorophenol. According to the invention, the Ag / {001} Bi2Fe4O9 nanosheet can be prepared and applied to visual detection.

The invention relates to a method for rapidly measuring the degreasing degree of the surface of a vehicle body. The method comprises the following steps: a) dissolving fluorescein in a first organic solvent to provide a first reagent; b) providing a bromine-containing second organic solvent as a second agent; c) applying a first reagent to the surface of the metal panel to ensure that the surface of the metal panel is completely covered by the first reagent; and d) putting the metal panel treated in the step c) into a container filled with a second reagent, enabling the fluorescein in the first reagent to be in contact with bromine, especially bromine steam in the second reagent to show color change from crimson to red to pink, and then irradiating the metal panel through an ultraviolet lamp. When grease exists on the metal panel, an unsaturated compound in the grease and bromine are subjected to an addition reaction, except that the dark red changes to red to pink, fluorescence phenomenon occurs, and when grease does not exist on the metal panel, the dark red changes to red to pink, and fluorescence phenomenon does not occur.

The invention relates to the field of biomedical instrument sterilization, and particularly discloses an instrument sterilization transfer cabinet suitable for a biological clean environment, the instrument sterilization transfer cabinet comprises a box body, the box body is internally provided with a disinfection bin, a drying bin and a detection bin, the disinfection bin is internally provided with a disinfection nozzle for spraying a fluorescein-containing disinfectant, and the drying bin is internally provided with a high-temperature gas nozzle; an ultraviolet lamp for enabling fluorescein to emit light and a light sensor for receiving the light emitted by the fluorescein are arranged in the detection bin; a first moving mechanism and a second moving mechanism are also arranged on the box body; the first moving mechanism and the second moving mechanism can clamp and move instruments in the box body, the instruments can rotate in different directions through switching of the first moving mechanism and the second moving mechanism during moving, disinfection dead angles of the instruments are reduced, and the drying effect of the instruments can be improved through rotary centrifugation; when the instrument is detected, if the light sensor detects fluorescent light spots, the drying is incomplete or the cleaning is not thorough.

The application describes chromogenic conjugates for color-based detection of targets. The conjugate includes a chromogenic moiety such as rhodamine, rhodol or fluorescein. The chromogenic moiety is linked to a peroxidase substrate. The chromogenic conjugate can be used for immunohistochemical analysis and in situ hybridization. The conjugate can be used to detect 1, 2, 3 or more targets in a sample by color.

The application discloses a tryptamine detection method based on triple emission MOFs and a smart phone. A rare earth metal organic framework (AP-Eu) is used as a luminescent matrix, and a fluorescent guest molecule fluorescein-5-isothiocyanate (FITC) is post-modified to obtain a ratio fluorescent material with triple emission characteristics. Competitive absorption of ligands and tryptamine, pH response of FITC and hydrogen bonding are used to realize fluorescence signal regulation, and then high-sensitivity and high-selectivity fluorescence recognition of tryptamine is realized. The method is further applied to quantitative detection of tryptamine in beer samples, visualization detection of foam and on-site rapid detection assisted by a mobile phone APP. The application provides a safe and efficient tryptamine detection and fluorescence sensing method, and significantly improves detection accuracy and on-site applicability.

This specification describes a dental imaging and / or curing system and methods of using it, optionally in combination with a fluorescent imaging aid applied to a tooth. In some examples, a system or kit described in this specification combines a fluorescent compound with an intra-oral device. The intra-oral device includes a light source to excite the fluorescent compound. The intra-oral device further includes a sensor to produce an image of fluorescent light emitted from the fluorescent compound. Optionally, the fluorescent compound can include positively charged nanoparticles including a fluorophore, for example fluorescein. Optionally, the intra-oral device can include a blue LED, a bandpass emission filter and a digital camera sensor. This specification also describes an intra-oral device and a method of producing an image of plaque, calculus or active carious lesions in the mouth of a person or other animal.

The utility model discloses quick-drying type thermal dye sublimation transfer printing body paper which comprises an antistatic layer, a thermal dye sublimation layer fixedly connected to the lower surface of the antistatic layer, a water absorption layer fixedly connected to the lower surface of the thermal dye sublimation layer, pores formed in the outer surface of the water absorption layer, a filler layer fixedly connected to the lower surface of the water absorption layer, and an anti-static layer fixedly connected to the filler layer. The lower surface of the filler layer is fixedly connected with the aluminum foil layer, the lower surface of the aluminum foil layer is fixedly connected with the body paper, moisture is absorbed through the water absorption layer, meanwhile, pores are formed in the surface of the water absorption layer, rapid drying is achieved, the drying time is shortened, the filler layer is further arranged between the water absorption layer and the body paper, and coating moisture is prevented from permeating into the body paper layer; humidity-sensitive fluorescein of the humidity-sensitive layer displays different colors under the condition of high and low humidity, so that people can directly observe the humidity of the body paper, and meanwhile, the hydrophobic layer is arranged on the surface of the humidity-sensitive layer, so that the influence of external moisture is reduced.

The invention discloses an APC-Cy7 buffer solution, composite fluorescein APC-Cy7 and a method for labeling an antibody with the composite fluorescein. The APC-Cy7 buffer solution is prepared from 50 mmol / L of MES, 1% of trehalose and 2 mmol / L of EDTA, the pH of the buffer solution is 6.0 + / -0.2, and the main molecular structure of Cy7 is triethylamine salt. The problems of poor solubility and low fluorescence intensity of the composite fluorescein APC-Cy7 are solved by screening an APC-Cy7 preservation buffer solution and a Cy7 structure, and the problems that the antibody structure is damaged and a marker / fluorescent antibody is easy to precipitate by the traditional DTT, TCEP and other reduction methods are solved by a non-reducing sulfydryl modification strategy. And the preparation yield and batch consistency of the composite fluorescein APC-Cy7 marker / fluorescent antibody are remarkably improved while the process is simplified.

The invention provides a specific probe for detecting perfluorinated compounds in a water body and a detection method thereof, and belongs to the technical field of detection. The probe provided by the invention is a compound formed by cucurbituril and fluorescein; the detection method provided by the invention comprises the following steps: adding a cucurbituril and fluorescein conjugate into a to-be-detected water sample containing the perfluorinated compounds, carrying out equilibrium reaction for a period of time, and then detecting the fluorescence response intensity in the water body so as to quantitatively evaluate the concentration of the specific perfluorinated compounds in the water sample. Compared with the prior art, the probe equipment provided by the invention is small in size, convenient to carry, capable of simultaneously detecting multiple samples and short in reaction time; the whole material of the probe is green and harmless, and chemical agents such as sulfate which easily cause secondary pollution are not used; other impurity removal and enrichment small columns and complex masking agents do not need to be used. In addition, the detection method provided by the invention has a lower detection limit, the sensitivity and convenience of novel perfluorinated compound detection are remarkably improved, and the application range is wider.

The invention relates to novel biocompatible hybrid nanoparticles of very small size, useful in particular for diagnostics and / or therapy.The purpose of the invention is to offer novel nanoparticles which are useful in particular as contrast agents in imaging (e.g. MRD and / or in other diagnostic techniques and / or as therapeutic agents, which give better performance than the known nanoparticles of the same type and which combine both a small size (for example less than 20 nm) and a high loading with metals (e.g. rare earths), in particular so as to have, in imaging (e.g. MRI), strong intensification and a correct response (increased relaxivity) at high frequencies.Thus, the nanoparticles according to the invention, with diameter d1 between 1 and 20 nm, each comprise a polyorganosiloxane (POS) matrix including gadolinium cations optionally associated with doping cations; a chelating graft C1 DTPABA (diethylenetriaminepentaacetic acid bisanhydride) bound to the POS matrix by an —Si—C— covalent bond, and present in sufficient quantity to be able to complex all the gadolinium cations; and optionally another functionalizing graft Gf* bound to the POS matrix by an —Si—C— covalent bond (where Gf* can be derived from a hydrophilic compound (PEG); from a compound having an active ingredient PA1; from a targeting compound; from a luminescent compound (fluorescein).The method for the production of these nanoparticles and the applications thereof in imaging and in therapy also form part of the invention.

The application discloses a preparation method of a fluorescein probe with specific selectivity and application thereof, and relates to the fluorescein probe field. The fluorescein probe with specific selectivity is prepared through the following steps: mixing a compound of formula (III) with 1,6-naphthylpyridine-2-methyl aldehyde in a solvent, adding triethylamine to obtain a compound of formula (II); mixing the compound of formula (II) with 1-pyrene carboxylic acid in a solvent, and adding dicyclohexyl carbodiimide and 4-dimethylaminopyridine to obtain the fluorescein probe with specific selectivity. The fluorescein probe with specific selectivity prepared by the application has excellent fluorescence performance, specific selectivity to copper ions, and extremely low detection limit, and has important application significance in copper ion detection.

The invention discloses a method for detecting aortic dissection through peripheral blood BRD4 based on flow cytometry and application. The invention belongs to the technical field of biology, and particularly relates to a method for detecting aortic dissection through peripheral blood BRD4 based on flow cytometry and application. The method for detecting the content or expression level of the bromodomain-containing protein 4 in the sample to be detected comprises the following steps: 1) treating the sample to be detected to obtain mononuclear cells; the method comprises the following steps of (1) determining a mononuclear cell, (2) determining a fluorescein coupling antibody composition of a detection index according to a flow cytometry color matching scheme, (3) uniformly mixing the mononuclear cell in the step (1) and the fluorescein coupling antibody in the step (2), incubating in a dark place and dyeing, (4) loading and testing a sample by a spectrum flow cytometry, and (5) analyzing a data result, and the detection indexes in the step (2) are CD45, CD11B, CD66B, CD14, CC16 and BRD4.

The application belongs to the technical field of food safety rapid detection, and discloses a fluorescence and colorimetric dual-signal biosensor for acetamiprid detection, a preparation method and application thereof.The application uses aptamer (Apts) functionalized Fe3O4@Au@Pt (Fe3O4@Au@Pt@Apt) and fluorescence-labeled (FAM, 6-carboxyfluorescein) aptamer complementary strand (cDNA) functionalized SiO2 (SiO2@cDNA-FAM) as a recognition probe, uses specific recognition of the aptamer to a target, and uses enzyme catalytic activity of Fe3O4@Au@Pt and quenching effect of the fluorescence, and cooperates with a magnetic separation technology to construct a colorimetric and fluorescence dual-signal output high-sensitivity aptamer sensor for acetamiprid detection.

The utility model discloses a portable SO3 < 2-> / S < 2-> form analysis device in an environmental water sample. The device comprises a chemical gas phase generation assembly, a micro-plasma reactor and a visual colorimetric detector, the chemical gas phase generation assembly comprises a reaction bottle with an open end and a cover body covering the open end of the reaction bottle in a sealing manner, the reaction bottle is provided with an argon introducing pipe and a gas phase discharging pipe, and the other end of the gas phase discharging pipe is connected to the gas inlet end of the micro-plasma reactor; the exhaust end of the micro-plasma reactor is connected with an exhaust pipe, and the other end of the exhaust pipe is connected to the air inlet end of the visual colorimetric detector; the visible colorimetric detector comprises a transparent colorimetric reaction chamber, and a fluorescein derivative which is subjected to a color fading reaction with SO2 is arranged in the transparent colorimetric reaction chamber. The portable SO3 < 2-> / S < 2-> morphological analysis device in the environmental water sample can be used for field detection, and is simple and quick to operate.

The present invention relates to a method for treating Gram-negative bacteria that are resistant to colistin (MIC > 50 mg / mL), an antibacterial compound, excluding those of the genera Burkholderia, Proteus, and Serratia, comprising contacting the bacteria with an aqueous pharmaceutical composition containing a rose bengal (RB) compound of formula I, dissolved or dispersed at a concentration of about 0.01 to about 15 mg / mL, and irradiating the contacted bacteria with light of a wavelength of about 500 nm to about 600 nm for a period of about 1 to about 10 minutes, at a concentration of about 16 to about 160 J / cm². 2 The aim is to create a method that involves obtaining a certain amount of light to treat and kill irradiated bacteria. [Formula 1] JPEG2026511692000028.jpg5864 (where X, R 1 , R 2 (and M+ are defined herein)

The present application relates to a kind of HER2 gene and FGFR2 gene fluorescence in situ hybridization combined detection probe and its application, belong to biological medicine technical field.The present application provides a kind of probe and probe composition for tumor diagnosis and prognosis evaluation, including the first probe for detecting HER2 gene, and the second probe and the third probe for detecting FGFR2 gene;First probe, second probe and third probe are respectively marked with the first fluorochrome, second fluorochrome and third fluorochrome that can produce different colors;By the present application, a kind of fluorescence in situ hybridization combined detection method and its kit for simultaneously detecting HER2 and FGFR2 gene variation are provided;Wide application range can be used in various tissue and cell samples needing simultaneously detecting HER2 and FGFR2 gene state, one detection, two results, meet the goal of clinical test quality improvement and efficiency improvement;It has quite extensive application prospect.

The invention provides an interleukin 33 detection kit as well as a preparation method and application thereof. The interleukin 33 detection kit comprises a first antibody coupled to a magnetic fluorescent light-emitting microsphere, a second antibody labeled with biotin and fluorescein-labeled streptavidin, the first antibody strain and the second antibody strain are monoclonal antibodies for resisting interleukin 33, and interleukin 33 specific binding sites recognized by the first antibody strain and the second antibody strain are different. According to the kit disclosed by the invention, the interleukin 33 antigen is specifically combined with the magnetic fluorescent luminous microsphere formed by coupling the interleukin 33 capture antibody, then the magnetic fluorescent luminous microsphere is specifically combined with the biotin-labeled interleukin 33 detection antibody, the conjugate is combined with fluorescein-labeled streptavidin, fluorescence is emitted, and the content of the interleukin 33 in a sample to be detected is determined. The method is high in sensitivity, good in repeatability, short in reaction time, simple to operate and high in anti-interference performance.

The invention discloses a primer and a probe for digital PCR (polymerase chain reaction) detection of environmental DNA (deoxyribonucleic acid) abundance of aurelia aurita, a primer pair and a probe combination comprise an upstream primer with a sequence of SEQ ID NO: 15 'GCGGTAACTCTGACCGTGAT 3', a downstream primer with a sequence of SEQ ID NO: 25 'GTCGGCTTGCAATTTGTAT 3', a probe with a sequence of SEQ ID NO: 35 'FAM-ATGGCTAAACGAATCCTCCCTGTCT-BHQ 3', and a fluorophore added to the probe is 5-carboxyl fluorescein. The primer and the probe have strong specificity, high sensitivity and good repeatability, so that the time sequence change of the abundance of the aurelia in an environmental water body can be detected by using a digital PCR technology, and the time sequence change is used as an index for evaluating the change condition of an aurelia population and has potential application value in early warning and forecasting of disaster-causing aurelia of a coastal nuclear power plant. A control group does not need to be set, reference genes are not needed, and the application limitation of a traditional fluorescent real-time quantitative PCR detection method is broken through.