109 results about "Fluorescein" patented technology

This invention discloses an AfBPP-based active molecular probe for thiostreptin, its preparation, and its application, belonging to the field of chemical biology. This invention introduces a bifunctional tag integrating a photocrosslinking group (bisacrididine) and a bioorthogonal reactive group (alkynyl group) into the structure of thiostreptin. While retaining the original biological activity of the parent compound, it endows the probe with highly efficient probe function, solving the technical problem of target loss during washing and purification of traditional non-covalent probes. After target labeling, the probe can specifically connect to reporter groups such as fluorescein or biotin through click-chemical reactions, achieving efficient enrichment of drug targets. Combined with mass spectrometry analysis, it enables global identification of potential targets in cells or complex biological samples at the omics level, such as chemical proteomics, providing a powerful molecular tool for in-depth revelation of the potential targets and pharmacological mechanisms of thiostreptin.

The invention discloses preparation and visual detection application of an Ag / {001} Bi2Fe4O9 nanosheet, relates to the technical field of visual ultra-sensitive detection of 2, 4-dichlorophenol, and aims to realize an in-situ and ultra-sensitive visual detection method for the 2, 4-dichlorophenol. The method comprises the following steps: uniformly mixing a xanthene dye fluorescein aqueous solution, an Ag / {001} Bi2Fe4O9 nanosheet suspension and a 2, 4-dichlorophenol aqueous solution to obtain a solution to be detected; the method comprises the following steps: putting a solution to be detected into a Pomfiley multi-channel photocatalytic reactor, carrying out dark adsorption by stirring without illumination, then starting visible light, carrying out sufficient illumination, filtering by adopting a 22-micron water-phase filtering membrane, and finally testing by adopting an ultraviolet and visible spectrophotometer, thereby completing photosensitization detection of 2, 4-dichlorophenol. According to the invention, the Ag / {001} Bi2Fe4O9 nanosheet can be prepared and applied to visual detection.

The application discloses a tryptamine detection method based on triple emission MOFs and a smart phone. A rare earth metal organic framework (AP-Eu) is used as a luminescent matrix, and a fluorescent guest molecule fluorescein-5-isothiocyanate (FITC) is post-modified to obtain a ratio fluorescent material with triple emission characteristics. Competitive absorption of ligands and tryptamine, pH response of FITC and hydrogen bonding are used to realize fluorescence signal regulation, and then high-sensitivity and high-selectivity fluorescence recognition of tryptamine is realized. The method is further applied to quantitative detection of tryptamine in beer samples, visualization detection of foam and on-site rapid detection assisted by a mobile phone APP. The application provides a safe and efficient tryptamine detection and fluorescence sensing method, and significantly improves detection accuracy and on-site applicability.

This specification describes a dental imaging and / or curing system and methods of using it, optionally in combination with a fluorescent imaging aid applied to a tooth. In some examples, a system or kit described in this specification combines a fluorescent compound with an intra-oral device. The intra-oral device includes a light source to excite the fluorescent compound. The intra-oral device further includes a sensor to produce an image of fluorescent light emitted from the fluorescent compound. Optionally, the fluorescent compound can include positively charged nanoparticles including a fluorophore, for example fluorescein. Optionally, the intra-oral device can include a blue LED, a bandpass emission filter and a digital camera sensor. This specification also describes an intra-oral device and a method of producing an image of plaque, calculus or active carious lesions in the mouth of a person or other animal.

The utility model discloses quick-drying type thermal dye sublimation transfer printing body paper which comprises an antistatic layer, a thermal dye sublimation layer fixedly connected to the lower surface of the antistatic layer, a water absorption layer fixedly connected to the lower surface of the thermal dye sublimation layer, pores formed in the outer surface of the water absorption layer, a filler layer fixedly connected to the lower surface of the water absorption layer, and an anti-static layer fixedly connected to the filler layer. The lower surface of the filler layer is fixedly connected with the aluminum foil layer, the lower surface of the aluminum foil layer is fixedly connected with the body paper, moisture is absorbed through the water absorption layer, meanwhile, pores are formed in the surface of the water absorption layer, rapid drying is achieved, the drying time is shortened, the filler layer is further arranged between the water absorption layer and the body paper, and coating moisture is prevented from permeating into the body paper layer; humidity-sensitive fluorescein of the humidity-sensitive layer displays different colors under the condition of high and low humidity, so that people can directly observe the humidity of the body paper, and meanwhile, the hydrophobic layer is arranged on the surface of the humidity-sensitive layer, so that the influence of external moisture is reduced.

The invention discloses an APC-Cy7 buffer solution, composite fluorescein APC-Cy7 and a method for labeling an antibody with the composite fluorescein. The APC-Cy7 buffer solution is prepared from 50 mmol / L of MES, 1% of trehalose and 2 mmol / L of EDTA, the pH of the buffer solution is 6.0 + / -0.2, and the main molecular structure of Cy7 is triethylamine salt. The problems of poor solubility and low fluorescence intensity of the composite fluorescein APC-Cy7 are solved by screening an APC-Cy7 preservation buffer solution and a Cy7 structure, and the problems that the antibody structure is damaged and a marker / fluorescent antibody is easy to precipitate by the traditional DTT, TCEP and other reduction methods are solved by a non-reducing sulfydryl modification strategy. And the preparation yield and batch consistency of the composite fluorescein APC-Cy7 marker / fluorescent antibody are remarkably improved while the process is simplified.

The invention provides a specific probe for detecting perfluorinated compounds in a water body and a detection method thereof, and belongs to the technical field of detection. The probe provided by the invention is a compound formed by cucurbituril and fluorescein; the detection method provided by the invention comprises the following steps: adding a cucurbituril and fluorescein conjugate into a to-be-detected water sample containing the perfluorinated compounds, carrying out equilibrium reaction for a period of time, and then detecting the fluorescence response intensity in the water body so as to quantitatively evaluate the concentration of the specific perfluorinated compounds in the water sample. Compared with the prior art, the probe equipment provided by the invention is small in size, convenient to carry, capable of simultaneously detecting multiple samples and short in reaction time; the whole material of the probe is green and harmless, and chemical agents such as sulfate which easily cause secondary pollution are not used; other impurity removal and enrichment small columns and complex masking agents do not need to be used. In addition, the detection method provided by the invention has a lower detection limit, the sensitivity and convenience of novel perfluorinated compound detection are remarkably improved, and the application range is wider.

The invention relates to novel biocompatible hybrid nanoparticles of very small size, useful in particular for diagnostics and / or therapy.The purpose of the invention is to offer novel nanoparticles which are useful in particular as contrast agents in imaging (e.g. MRD and / or in other diagnostic techniques and / or as therapeutic agents, which give better performance than the known nanoparticles of the same type and which combine both a small size (for example less than 20 nm) and a high loading with metals (e.g. rare earths), in particular so as to have, in imaging (e.g. MRI), strong intensification and a correct response (increased relaxivity) at high frequencies.Thus, the nanoparticles according to the invention, with diameter d1 between 1 and 20 nm, each comprise a polyorganosiloxane (POS) matrix including gadolinium cations optionally associated with doping cations; a chelating graft C1 DTPABA (diethylenetriaminepentaacetic acid bisanhydride) bound to the POS matrix by an —Si—C— covalent bond, and present in sufficient quantity to be able to complex all the gadolinium cations; and optionally another functionalizing graft Gf* bound to the POS matrix by an —Si—C— covalent bond (where Gf* can be derived from a hydrophilic compound (PEG); from a compound having an active ingredient PA1; from a targeting compound; from a luminescent compound (fluorescein).The method for the production of these nanoparticles and the applications thereof in imaging and in therapy also form part of the invention.

The application discloses a preparation method of a fluorescein probe with specific selectivity and application thereof, and relates to the fluorescein probe field. The fluorescein probe with specific selectivity is prepared through the following steps: mixing a compound of formula (III) with 1,6-naphthylpyridine-2-methyl aldehyde in a solvent, adding triethylamine to obtain a compound of formula (II); mixing the compound of formula (II) with 1-pyrene carboxylic acid in a solvent, and adding dicyclohexyl carbodiimide and 4-dimethylaminopyridine to obtain the fluorescein probe with specific selectivity. The fluorescein probe with specific selectivity prepared by the application has excellent fluorescence performance, specific selectivity to copper ions, and extremely low detection limit, and has important application significance in copper ion detection.

The invention discloses a method for detecting aortic dissection through peripheral blood BRD4 based on flow cytometry and application. The invention belongs to the technical field of biology, and particularly relates to a method for detecting aortic dissection through peripheral blood BRD4 based on flow cytometry and application. The method for detecting the content or expression level of the bromodomain-containing protein 4 in the sample to be detected comprises the following steps: 1) treating the sample to be detected to obtain mononuclear cells; the method comprises the following steps of (1) determining a mononuclear cell, (2) determining a fluorescein coupling antibody composition of a detection index according to a flow cytometry color matching scheme, (3) uniformly mixing the mononuclear cell in the step (1) and the fluorescein coupling antibody in the step (2), incubating in a dark place and dyeing, (4) loading and testing a sample by a spectrum flow cytometry, and (5) analyzing a data result, and the detection indexes in the step (2) are CD45, CD11B, CD66B, CD14, CC16 and BRD4.

The application belongs to the technical field of food safety rapid detection, and discloses a fluorescence and colorimetric dual-signal biosensor for acetamiprid detection, a preparation method and application thereof.The application uses aptamer (Apts) functionalized Fe3O4@Au@Pt (Fe3O4@Au@Pt@Apt) and fluorescence-labeled (FAM, 6-carboxyfluorescein) aptamer complementary strand (cDNA) functionalized SiO2 (SiO2@cDNA-FAM) as a recognition probe, uses specific recognition of the aptamer to a target, and uses enzyme catalytic activity of Fe3O4@Au@Pt and quenching effect of the fluorescence, and cooperates with a magnetic separation technology to construct a colorimetric and fluorescence dual-signal output high-sensitivity aptamer sensor for acetamiprid detection.

The utility model discloses a portable SO3 < 2-> / S < 2-> form analysis device in an environmental water sample. The device comprises a chemical gas phase generation assembly, a micro-plasma reactor and a visual colorimetric detector, the chemical gas phase generation assembly comprises a reaction bottle with an open end and a cover body covering the open end of the reaction bottle in a sealing manner, the reaction bottle is provided with an argon introducing pipe and a gas phase discharging pipe, and the other end of the gas phase discharging pipe is connected to the gas inlet end of the micro-plasma reactor; the exhaust end of the micro-plasma reactor is connected with an exhaust pipe, and the other end of the exhaust pipe is connected to the air inlet end of the visual colorimetric detector; the visible colorimetric detector comprises a transparent colorimetric reaction chamber, and a fluorescein derivative which is subjected to a color fading reaction with SO2 is arranged in the transparent colorimetric reaction chamber. The portable SO3 < 2-> / S < 2-> morphological analysis device in the environmental water sample can be used for field detection, and is simple and quick to operate.

The present invention relates to a method for treating Gram-negative bacteria that are resistant to colistin (MIC > 50 mg / mL), an antibacterial compound, excluding those of the genera Burkholderia, Proteus, and Serratia, comprising contacting the bacteria with an aqueous pharmaceutical composition containing a rose bengal (RB) compound of formula I, dissolved or dispersed at a concentration of about 0.01 to about 15 mg / mL, and irradiating the contacted bacteria with light of a wavelength of about 500 nm to about 600 nm for a period of about 1 to about 10 minutes, at a concentration of about 16 to about 160 J / cm². 2 The aim is to create a method that involves obtaining a certain amount of light to treat and kill irradiated bacteria. [Formula 1] JPEG2026511692000028.jpg5864 (where X, R 1 , R 2 (and M+ are defined herein)

The present application relates to a kind of HER2 gene and FGFR2 gene fluorescence in situ hybridization combined detection probe and its application, belong to biological medicine technical field.The present application provides a kind of probe and probe composition for tumor diagnosis and prognosis evaluation, including the first probe for detecting HER2 gene, and the second probe and the third probe for detecting FGFR2 gene;First probe, second probe and third probe are respectively marked with the first fluorochrome, second fluorochrome and third fluorochrome that can produce different colors;By the present application, a kind of fluorescence in situ hybridization combined detection method and its kit for simultaneously detecting HER2 and FGFR2 gene variation are provided;Wide application range can be used in various tissue and cell samples needing simultaneously detecting HER2 and FGFR2 gene state, one detection, two results, meet the goal of clinical test quality improvement and efficiency improvement;It has quite extensive application prospect.

The invention provides an interleukin 33 detection kit as well as a preparation method and application thereof. The interleukin 33 detection kit comprises a first antibody coupled to a magnetic fluorescent light-emitting microsphere, a second antibody labeled with biotin and fluorescein-labeled streptavidin, the first antibody strain and the second antibody strain are monoclonal antibodies for resisting interleukin 33, and interleukin 33 specific binding sites recognized by the first antibody strain and the second antibody strain are different. According to the kit disclosed by the invention, the interleukin 33 antigen is specifically combined with the magnetic fluorescent luminous microsphere formed by coupling the interleukin 33 capture antibody, then the magnetic fluorescent luminous microsphere is specifically combined with the biotin-labeled interleukin 33 detection antibody, the conjugate is combined with fluorescein-labeled streptavidin, fluorescence is emitted, and the content of the interleukin 33 in a sample to be detected is determined. The method is high in sensitivity, good in repeatability, short in reaction time, simple to operate and high in anti-interference performance.

The invention discloses a primer and a probe for digital PCR (polymerase chain reaction) detection of environmental DNA (deoxyribonucleic acid) abundance of aurelia aurita, a primer pair and a probe combination comprise an upstream primer with a sequence of SEQ ID NO: 15 'GCGGTAACTCTGACCGTGAT 3', a downstream primer with a sequence of SEQ ID NO: 25 'GTCGGCTTGCAATTTGTAT 3', a probe with a sequence of SEQ ID NO: 35 'FAM-ATGGCTAAACGAATCCTCCCTGTCT-BHQ 3', and a fluorophore added to the probe is 5-carboxyl fluorescein. The primer and the probe have strong specificity, high sensitivity and good repeatability, so that the time sequence change of the abundance of the aurelia in an environmental water body can be detected by using a digital PCR technology, and the time sequence change is used as an index for evaluating the change condition of an aurelia population and has potential application value in early warning and forecasting of disaster-causing aurelia of a coastal nuclear power plant. A control group does not need to be set, reference genes are not needed, and the application limitation of a traditional fluorescent real-time quantitative PCR detection method is broken through.

Systems for customized visual field (VF) testing use machine learning models (15) trained on retinal images (12A, 12C, 12D) including optical coherence tomography (OCT), optical coherence tomography angiography (OCTA), fundus, and / or fluorescein angiography images. In operation, when a particular VF test (13) is to be prepared for a patient, a retinal image of the patient is submitted to the current machine model, which responds by synthesizing a VF for the patient. The synthesized VF can be used to optimize the particular VF test prior to performing the particular VF test on the patient.

The invention discloses a Cu < 2 + > ion fluorescence chemical sensor as well as a synthesis method and application thereof. The Cu < 2 + > ion fluorescence chemical sensor comprises a polyvinylamine molecular skeleton, polyether and an isothiocyanate fluorescein fluorophore. The invention also provides a preparation method of the Cu < 2 + > ion fluorescence chemical sensor and an application of the Cu < 2 + > ion fluorescence chemical sensor in detection of Cu < 2 + > ions in a solution, which are further expanded to the field of cell imaging and realize the application of Cu < 2 + > ion detection in an intracellular environment. The invention provides application of fluorescein isothiocyanate in preparation of a Cu < 2 + > ion fluorescence chemical sensor. The Cu < 2 + > ion fluorescence chemical sensor is based on a polyvinylamine molecular skeleton, polyether macromolecules and a fluorophore are introduced at the same time, the Cu < 2 + > ion change in cells can be responded, and a new application way of fluorescein isothiocyanate is provided.

The present invention contemplates a topical ophthalmic system for treating a Gram-positive bacterially-infected mammalian eye. The system comprises an ophthalmic composition containing a halogenated fluorescein or a pharmaceutically acceptable salt or ester thereof dissolved or dispersed in an aqueous ophthalmic carrier and present in an anti-bacterial keratitis-treating effective concentration of about 0.2 μg / mL to about 50 μg / mL. The ophthalmic composition has a pH value of about 6.5 to about 7.6, a viscosity of about 10 to about 300 cps and an osmolality of about 270 mOsm / kg to about 340 mOsm / kg. The ophthalmic composition is present in a vessel opaque to actinic light. Also contemplated is a method of treating a mammal having a Gram-positive bacterial infection of an eye by administering the ophthalmic composition to the infected eye and maintaining the treated eye in the substantial absence of actinic light for about 3 hours to about 12 hours.

The invention discloses a multiplex fluorescence immunohistochemical detection kit for rare lymphoma and application of the multiplex fluorescence immunohistochemical detection kit. The multiplex fluorescence immunohistochemical detection kit for rare lymphoma comprises a primary antibody reagent and a fluorescence staining reagent, the primary antibody reagent is prepared from a rabbit anti-human CD15 monoclonal antibody, a rabbit anti-human CD30 monoclonal antibody, a KI-67 monoclonal antibody, a rabbit anti-human CD79b monoclonal antibody, a rabbit anti-human CD3 monoclonal antibody and a rabbit anti-human CD20 monoclonal antibody. When the multiplex fluorescence immunohistochemical detection kit for the rare lymphoma is used, a false positive result caused by channel spectrum crosstalk is avoided to the greatest extent through a specific staining sequence of each target protein and fluorescein matching, and the purpose of detecting the rare lymphoma, especially the rare type of lymphoma, is achieved. The kit can be used for synchronous detection of lymphoma, such as hodgkin lymphoma, mantle cell lymphoma and marginal region lymphoma, and provides a reliable basis for lymphoma immune targeted therapy.

The application discloses a curcumin photoaffinity probe molecule and a preparation method and application thereof, and the preparation method comprises the following steps: taking curcumin (compound II) as raw material, and reacting with 3-but-3-alkynyl-3-(2-iodoethyl) diazole alkene (compound III) under alkaline conditions to obtain the curcumin photoaffinity probe molecule (compound I), wherein a photo-crosslinking group and a biological orthogonal group are introduced at the 4th position of the curcumin photoaffinity probe molecule, the diazirine photo is the crosslinking group, can in-situ crosslink the adjacent binding protein under the condition of ultraviolet light, the alkynyl group is the biological orthogonal group, and the probe is coupled with fluorescein or biotin through a biological orthogonal coupling reaction, so that the probe is used for fluorescence detection on curcumin target protein in cells and identification of the curcumin target protein.

The invention relates to the technical field of wafer COP defect identification methods based on detection before polishing, particularly discloses a wafer COP defect identification method based on detection before polishing, and aims to solve the problems of high invalid processing cost and low screening accuracy caused by the fact that traditional COP defect identification depends on a polished surface. The method comprises the following steps: carrying out alkali corrosion treatment on a silicon wafer to expose crystal original particle defects; selectively marking the defect area by adopting a fluorescein aqueous solution with specific wavelength and concentration; after cleaning with high-purity water and drying with compressed air, analyzing the peak position, the peak width and the strength of a defect luminescence peak through photoluminescence spectrum, and realizing accurate identification of the defect by combining a support vector machine model. By adopting the technical scheme, the wafer COP defect can be efficiently and accurately identified before polishing, the invalid polishing cost is remarkably reduced, and the process economy and the detection flux of regenerated wafer screening are improved.

The invention provides a detection kit, application, a marker detection system and a marker detection method. The detection kit comprises carrier particles, a detection function substance, a peroxidase conjugate and a substrate solution, the carrier particles have magnetism, the surfaces of the carrier particles are coated with a capture function substance, the capture function substance can be specifically combined with a target substance, each carrier particle is provided with a fluorescent point, and the detection function substance is used for detecting the peroxidase conjugate. The fluorescent dots with the same color correspond to the same capture function substance, the substrate solution comprises a dendrimer, a plurality of fluoresceins are marked on the dendrimer, and the dendrimer is covalently coupled with a plurality of tyramine molecules. The detection kit disclosed by the invention can be used for detecting low-concentration markers, and is low in lower detection limit, simple to operate and relatively low in detection cost.

The application discloses a nitrite fluorescent probe and a preparation method and application thereof. + The reaction makes the spiro ring open, the conjugated system recovers, the fluorescence emission signal is enhanced, a fluorescence-on detection mode is realized, a boronic acid group is introduced in the probe design, a benzene ring is activated, electrophilic substitution reactivity is improved, the coordination of an amine group and a metal ion is eliminated, the anti-interference ability of the probe to the coordination of metal ions is improved, and rapid, high-selectivity and high-sensitivity detection of nitrite in a complex food matrix is realized. The application also discloses application of the fluorescent probe. The prepared fluorescent probe has the technical effects of good water solubility, high sensitivity, high specificity and strong anti-interference ability.

The application belongs to the field of environmental micro-interface two-dimensional pH monitoring technology, and discloses a planar optical electrode fluorescence sensing film with an acidic pH response range, a preparation method and application. Specifically, the application provides a pH-sensitive fluorescent indicator, the pH-sensitive fluorescent indicator is 2', 7'-dihalo-5(6)-N-octadecyl carboxamide fluorescein or 2', 4', 5', 7'-tetrahalo-5(6)-N-octadecyl carboxamide fluorescein, the molecular structural formula of the pH fluorescent indicator is shown as formula I; in the formula, X is selected from Cl or F; Y is selected from H, Cl or F; by introducing electron-withdrawing halogen atoms at the halogenated sites of fluorescein, the pKa value of the indicator is reduced, and the deficiency that the traditional planar optical electrode sensing film does not cover the acidic region is solved, wherein the tetrachloro derivative can realize the response in the strong acid interval of pH 1.70~4.96, and the tetrafluoro derivative can cover the acid-base interval of pH 2.75~7.68.

The invention discloses a zinc alginate tampon with a biological fluorescent pull line and a preparation method of the zinc alginate tampon. The tampon comprises a non-woven fabric cotton piece wound into a strip shape, and a biological fluorescent pull wire is arranged in the middle of the non-woven fabric cotton piece. Wherein the non-woven fabric cotton piece is formed by compounding a zinc alginate fiber net and a degreasing cotton fiber net through a light spunlace process, the structure of the non-woven fabric cotton piece is that a degreasing cotton light spunlace non-woven fabric layer and a zinc alginate light spunlace non-woven fabric layer are formed on two sides, the two sides are slightly entangled, the middle is fluffy, and in addition, a biological fluorescent pull wire is arranged in the middle of the non-woven fabric cotton piece. The bioluminescence pull wire is dipped in fluorescein labeled chitosan and is used for fluorescence safety prompt. The tampon has the functions of efficient antibiosis, high water absorption, retention prevention and biosafety (non-toxicity), solves the problems that an existing tampon is difficult to consider both the antibiosis property and the water absorption property, gel blockage and use safety, and has good application prospects and market values.

The invention discloses an efficient fluorescein probe as well as a preparation method and application thereof, and relates to the field of fluorescein probes. The high-efficiency fluorescein probe prepared by the invention has an extremely low detection limit on cathepsin B, has excellent fluorescence performance and good biocompatibility, is suitable for detection of tumor-related cathepsin B, and has important application significance in the aspect of early diagnosis of tumors.

The invention provides a preparation method and application of a multi-target enzymatic self-assembly fluorescence activated nanoprobe, and belongs to the field of pharmacy. According to the method, an Fmoc solid-phase peptide synthesis strategy is adopted, an N end is connected with a fluorescence quencher Dabcyl, a C end is marked with fluorescein, a near C end is a self-assembly sequence Y (pY) YG capable of generating self-assembly behavior through dephosphorylation of alkaline phosphatase, and a middle section is a cleavage sequence KGGFLGK capable of being cleaved into a fluorescent'switch 'by cathepsin B; the near N end is a functional polypeptide F-pY-LyP-1 of a targeting sequence CGNKRTRGC or LyP-1 which can be highly combined with a p32 receptor on the surface of a foam cell. The fluorescence activated nanoprobe accurately reaches a plaque part under the synergistic effect of multiple target points and is self-assembled into spherical nanoparticles, so that the aggregation and retention effects of the probe in the plaque are improved, the non-specific signal interference is reduced, and the early atherosclerotic plaque is more accurately identified.

The application belongs to the field of fluorescent probes, and relates to a lysosome-targeting fluorescent probe and a preparation method and application thereof. An intermediate is prepared by mixing an aldehyde compound, 5-amino fluorescein and 7-bromoheptanoic acid, and then performing a reaction; the intermediate is mixed with morpholine, and then a reaction is performed, so that the lysosome-targeting fluorescent probe is obtained. The application belongs to the construction of a complex molecular system with flexible and modular Ugi four-component reaction, adopts a one-pot method, and is synthesized by a framework template conjugation method, and the yield of the product is between 60% and 80%. The fluorescent probe prepared in the application can target lysosomes, and can be used as a lysosome-targeting imaging agent for living cancer cells. The fluorescent probe containing ferrocene prepared in the application can target lysosomes, and can be used as a lysosome-targeting imaging agent and a therapeutic agent for living cancer cells. The fluorescent probe containing ferrocene prepared in the application can effectively inhibit the growth of Hela and other cancer cells.