Patents
Literature
336 results about "Biosensor" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
A biosensor is an analytical device, used for the detection of a chemical substance, that combines a biological component with a physicochemical detector. The sensitive biological element, e.g. tissue, microorganisms, organelles, cell receptors, enzymes, antibodies, nucleic acids, etc., is a biologically derived material or biomimetic component that interacts, binds, or recognizes with the analyte under study. The biologically sensitive elements can also be created by biological engineering. The transducer or the detector element, which transforms one signal into another one, works in a physicochemical way: optical, piezoelectric, electrochemical, electrochemiluminescence etc., resulting from the interaction of the analyte with the biological element, to easily measure and quantify. The biosensor reader device with the associated electronics or signal processors that are primarily responsible for the display of the results in a user-friendly way. This sometimes accounts for the most expensive part of the sensor device, however it is possible to generate a user friendly display that includes transducer and sensitive element (holographic sensor). The readers are usually custom-designed and manufactured to suit the different working principles of biosensors.
Space thermal microclimate multi-target regulation and control method, device and system, medium and product
PendingCN120863288AAir-treating devicesSeat heating/ventillating devicesOptical radiationThermal comfort
The invention relates to the crossing field of biothermodynamics and dynamic environment control, and discloses a space thermal microclimate multi-target regulation and control method, device and system, a medium and a product. The method comprises the following steps: acquiring physiological parameters (including effective dressing thermal resistance and local sweat gland density of posture correction) of a passenger, environment space-time parameters and light environment parameters through a biological characteristic sensor, an environment sensor and an optical sensor; constructing a dynamic human body thermal comfort model library, and adopting a feature coding-parameter decoding mechanism to match a target thermal comfort model; generating a hierarchical regulation strategy based on the difference between the local comfortable temperature and humidity interval and the real-time thermal environment sensing parameter; and the refrigerant circulation system, the fluid circulation system and the optical radiation system are cooperatively controlled to realize local microclimate regulation and control. According to the method, the problems of inaccurate thermal comfort modeling and low multi-system cooperation efficiency in a transient environment are solved, the energy efficiency ratio is improved, and the comfort of passengers in a cabin is remarkably improved.
Owner:CHONGQING CHANGAN AUTOMOBILE CO LTD
Intelligent early warning system and bracelet for Parkinson / epilepsy recognition based on multi-modal sensor
The invention discloses an intelligent pre-warning system for Parkinson / epilepsy recognition based on a multi-modal sensor and a bracelet, and relates to the technical field of biosensors. The intelligent early warning system for Parkinson / epilepsy recognition based on the multi-modal sensor comprises a multi-modal acquisition interference judgment module, a multi-modal interference processing optimization module and a multi-modal fusion input early warning module. According to the method, whether the multi-modal interference processing optimization is carried out or not is judged according to the multi-modal interference early warning result, if yes, the multi-modal fusion instruction is sent after the multi-modal interference processing optimization, and if not, multi-modal biological data fusion is directly executed, and the multi-modal fusion early warning result is obtained. Finally, whether multi-modal fusion input early warning is carried out or not is judged based on the multi-modal fusion early warning result, the effect of carrying out physical condition early warning more accurately is achieved, and the problem that in the prior art, in the process of carrying out physical condition early warning through wearable equipment, multi-modal biological data collection and fusion association are not sufficient is solved.
Owner:JIANGSU JINLING ZHISHU MEDICAL TECHNOLOGY CO LTD
Paper microfluidic wearable screen printed biosensor for sweat analysis
An apparatus, system, and method for providing a moisture supplementation detection device. The moisture replenishment detection device includes: a flexible substrate having a circuit screen-printed therein, the circuit including a plurality of conductive ink layers and a dielectric ink layer; a sensor on the flexible substrate, wherein the sensor is capable of detecting element data indicative of a characteristic of sweat; an untreated chromatographic paper placed in contact with the skin of the user and capable of wicking sweat from the skin to the sensor along the micro-sized fluid channel; and a Bluetooth antenna on the flexible substrate and in communication with the sensor, and capable of wirelessly communicating the element data to an application capable of indicating to the user the user the suitability of moisture replenishment based on the element data.
Owner:JABIL INC
Construction and application of confinement-enhanced photoelectrochemistry-electrochemiluminescence dual-mode biosensor
PendingCN121454049AMaterial nanotechnologyTransportation and packagingPeroxidaseElectrochemiluminescence
The invention discloses construction and application of a confinement enhanced photoelectrochemistry-electrochemiluminescence dual-mode biosensor, and relates to the technical field of biosensing and analytical chemistry. The preparation method of the biosensor comprises the following steps: taking a CdS (at) SiO2 (at) NaYF4: Yb / Tm nano composite material as a substrate to obtain a confinement enhanced photoelectrochemistry (PEC) and electrochemiluminescence (ECL) sensing interface; in combination with a DNA wheel nanostructure triggered by target acetamiprid, signal amplification is realized; and synchronous dual-mode quenching detection of PEC and ECL signals is realized by virtue of peroxidase-like catalytic precipitation and wide-spectrum absorption characteristics of the PtPd-CoSnO3 nanocube. The biosensor prepared by the invention has the advantages of high sensitivity, strong reliability, good selectivity and the like, can be applied to accurate detection of acetamiprid in samples such as agricultural products and the like, and has important application value in the aspects of environmental monitoring and food safety control.
Owner:XUZHOU NORMAL UNIVERSITY
DNAzyme-based gene chip biosensor and application thereof
ActiveCN120310956BMicrobiological testing/measurementMaterial electrochemical variablesNucleotideGenotyping
The application relates to a DNAzyme-based gene chip biosensor and application thereof, and belongs to the technical field of electrochemical sensors. In order to solve the technical problems of low specificity and accuracy, long processing time and high cost in the single nucleotide polymorphism detection method in the prior art, a DNAzyme-based gene chip biosensor is provided, which comprises a DNAzyme molecular probe SNP recognition system and a solid-liquid phase mixed catalytic network system. The application provides a proteinase-free and space-oriented biosensing strategy, utilizes a molecular switch based on a DNAzyme probe to realize accurate SNP recognition, utilizes a space steric hindrance parallel amplification system to enhance signal amplification and simultaneously inhibit background noise, so that the detection performance is remarkably improved; and the gene chip biosensor can be applied to genotyping and trait selection in crop improvement and other applications.
Owner:CHANGCHUN DONGYI YUXIN BIOTECHNOLOGY CO LTD
Electrochemical biosensor of light-driven nanopore channel and application of electrochemical biosensor
The invention discloses an electrochemical biosensor of a light-driven nanopore channel and application of the electrochemical biosensor. According to the sensor, a photoresponse nanopore membrane is constructed, an outer surface aptamer probe is combined, asymmetric photothermal gradient driven ion transmission induced by near-infrared light is utilized, and ultra-sensitive detection on a target object is realized by regulating and controlling the charge density of the outer surface. According to the electrochemical biosensor provided by the invention, traditional voltage driving is replaced by asymmetric near-infrared light driving, so that the electrochemical biosensor has a relatively wide detection range and an extremely low detection limit, and high-sensitivity and specific detection on a target object can be realized. The electrochemical biosensor can be used for detecting microcystin-LR (MC-LR), the detection limit reaches 1 * 10 <-7 > mu g / L, the sensitivity is improved by 5 orders of magnitude compared with that of a traditional voltage-driven sensor, and the electrochemical biosensor can be applied to trace pollutant detection in the fields of environmental monitoring, food safety and the like.
Owner:CHINA UNIV OF GEOSCIENCES (WUHAN)
Nucleic acid aptamer specifically combined with MMLV as well as preparation method and application of nucleic acid aptamer
The invention belongs to the technical field of bioengineering, and particularly relates to a nucleic acid aptamer specifically bound with MMLV, and the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1 or SEQ ID NO.2; the nucleic acid aptamer capable of being specifically bound with MMLV is obtained through screening on the basis of the SELEX technology, has high affinity for MMLV protein, can be applied to MMLV protein enrichment reagents, MMLV protein separation reagents, MMLV protein detection reagents, test paper and biosensors, and facilitates identification and activity research of the MMLV protein.
Owner:THE UNIVERSITY-TOWN HOSPITAL AFFILIATED TO CHONGQING MEDICAL UNIVERSITY
Sensor integrating sweat induction and multi-parameter detection as well as preparation method and application of sensor
The invention discloses a sweat induction and multi-parameter detection integrated sensor and a preparation method and application thereof, and belongs to the technical field of flexible biosensing, a PDMS flexible substrate is adopted to construct a multi-layer integrated structure, the sweat induction and multi-parameter detection integrated sensor comprises a sweat guide layer, a sweat collection layer, a detection electrode layer and a micro-fluidic chip layer, sweat secretion is promoted by accurately controlling the temperature to be less than or equal to 40 DEG C; the detection electrode layer adopts a silk-screen printing process to prepare a three-electrode system, comprises a specifically modified glucose working electrode and a beta-hydroxybutyric acid working electrode and can synchronously detect the concentration of glucose and beta-hydroxybutyric acid in sweat, and the micro-fluidic chip layer is integrated with a Bluetooth transmission module to realize real-time wireless transmission of detection data to a mobile terminal; the biosensor has the advantages of being good in biocompatibility, high in detection sensitivity and comfortable to wear and can tolerate bending with the curvature radius larger than 5 mm, and a non-invasive and continuous metabolism monitoring solution is provided for diabetes management.
Owner:SUZHOU UNIV OF SCI & TECH
Terahertz biosensor based on asymmetric hollow cylinder metasurface and method thereof
The invention discloses a terahertz biosensor based on an asymmetric hollow cylinder metasurface and a method thereof. The sensor is obtained by periodically arranging metasurface units; each metasurface unit is composed of a dielectric substrate and a hollow cylinder array unit. According to the invention, asymmetric disturbance is introduced to asymmetric arrangement of four hollow cylinders of the hollow cylinder array unit, terahertz waves are induced to form a quasi-continuum bound state (Q-BIC) harmonic peak with an ultrahigh Q value on the hollow cylinder array unit, and the Q value up to 20000 or above is realized by using a quasi-continuum bound state induction mechanism. An obvious response signal can be generated in a terahertz wave spectrum, so that ultra-sensitive detection on trace and even trace biological substances can be realized, and the detection efficiency and accuracy are greatly improved.
Owner:CHINA JILIANG UNIV
Nanoparticle modified quantum dot MOF (Metal Organic Framework) material as well as preparation method and application thereof
PendingCN121574725ATransportation and packagingChemiluminescene/bioluminescenceMetal-organic frameworkMalathion
The invention relates to the technical field of organic detection, in particular to a nanoparticle modified quantum dot MOF material and a preparation method and application thereof. A zirconium-based double-ligand metal organic framework material is used as a carrier, a co-reaction accelerant Ti3C2 quantum dot is modified to enhance the electrochemical luminescence reaction efficiency, and copper-gold nanoparticles are loaded to amplify signals. The nanoparticle modified quantum dot MOF material provided by the invention can be prepared into an aptamer biosensor for accurately identifying malathion, and has high sensitivity and high selectivity. According to the invention, a nanoparticle modified quantum dot MOF material is coupled and combined with an aptamer, and an aptamer probe with high electrochemical luminescence activity and specific sensitivity to malathion is constructed. When the malathion acts on the aptamer probe, the malathion is combined with the aptamer in a high affinity manner, the aptamer probe is separated from the surface of the electrode, and meanwhile, an electrochemical luminescence signal is changed, so that the malathion residue in the agricultural product is rapidly detected.
Owner:GUANGDONG PHARMA UNIV
Photosensitive composition used for producing light detection device, transfer film, laminate and method for producing the same, and light detection device
To provide a biosensor and a light detection device allowing a film having excellent light-shielding properties to be patterned with high resolution and high aspect ratio and exhibiting high-resolution.SOLUTION: There are provided a photosensitive composition used for a light detection device, the composition containing a colorant precursor exhibiting light absorptivity upon stimulation, and a transfer film, a laminate, a method for producing the laminate, and a light detection device, each obtained using the photosensitive composition.SELECTED DRAWING: None
Owner:FUJIFILM CORP
Electrochemical hydrogel microneedle array biosensors
PCT designated stageWO2025231565A1Microbiological testing/measurementCatheterElectrochemical biosensorAnalyte
This disclosure provides a wearable electrochemical biosensor for detecting at least one target analyte in interstitial fluid of a subject, comprising, a microneedle array comprising a highly- crosslinked hydrogel polymer; at least one electrochemical chip comprising at least one transducer surface configured for generating a signal in the presence of the at least one target analyte; and a low crosslinked hydrogel polymer, wherein the low crosslinked hydrogel polymer is configured to couple the microneedle array with the at least one transducer surface of the electrochemical chip. Methods of making and use thereof are also disclosed.
Owner:MCMASTER UNIV +3
Pseudomonas aeruginosa InA protein and application thereof
The invention discloses a pseudomonas aeruginosa InA protein and application thereof, and relates to the technical field of biological detection, the InA protein is InAS2, InAAP41 or InAS8, the amino acid sequences of the InA protein are respectively shown as SEQ ID NO.1-3, and the nucleotide sequences for coding the InAS2, the InAAP41 and the InAS8 are shown as SEQ ID NO.4-6. Compared with the prior art, the InA protein can improve the solubility of target protein, in addition, the InA protein and pseudomonas aeruginosa immune protein also have ultrahigh affinity, a biosensing chip with regeneration reversibility is developed based on the InA protein, the chip can capture fusion protein with the InA protein, and the biosensing chip has the advantages that the biosensing chip can be used as a biosensing chip with regeneration reversibility, so that the biosensing chip can be applied to biosensing of pseudomonas aeruginosa. The chip can be used for detecting the affinity between the fusion protein with the InA tag and a candidate drug, drug screening is realized, and meanwhile, the protein-drug affinity kinetics detected by the chip can also be used for pharmacological research of drugs.
Owner:BIORTUS BIOSCI +1
Gene expression cassette and application thereof
The invention relates to a gene expression cassette and application thereof. The gene expression cassette comprises a tyrosinase gene, a transcriptional repressor protein gene, a melanin response promoter and a reporter gene, and the reporter gene is located at the downstream of the melanin response promoter and is regulated by the promoter. The gene expression cassette with a specific structure is designed, melanin in cells can be responded, a melanin biosensor can be further constructed by utilizing the gene expression cassette, the gene expression cassette has good specificity, and high-throughput screening of strains can be realized. Furthermore, ALE evolution is carried out on the strain for producing melanin, high-throughput screening is carried out based on a designed sensor, the strain for producing melanin with high yield is obtained, through shake-flask culture and 5L fermentation tank culture, the yield of melanin reaches up to 10.84 g / L and 29.04 g / L respectively, and an efficient and feasible solution is provided for large-scale production of melanin.
Owner:VERTEXYN (NANJING) BIOWORKS CO LTD
Aptamer biosensors for detecting aspergillus niger
PCT designated stageWO2026008866A3Microbiological testing/measurementBiological material analysisAptamerMicrobiology
Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.
Owner:VIENNA UNIVERSITY OF TECHNOLOGY
Wafer soaking and developing device for manufacturing biosensor chip
The utility model discloses a wafer soaking and developing device for manufacturing a biosensor chip, which comprises a developing device main body, a control table is fixedly arranged on the front surface of the developing device main body, a wafer soaking structure is fixedly connected to the bottom end of a partition plate, and a wafer fixing structure is arranged in the wafer soaking structure. The top end of the wafer fixing structure is provided with a control structure, the bottom end of the wafer soaking structure is fixedly connected with a solution circulating structure, the wafer soaking and developing device for manufacturing the biosensor chip is relatively simple in structure while the wafer developing quality and uniformity are ensured, the maintenance cost and difficulty are reduced, and the production efficiency is improved. Operators only need to set relevant parameters on the console, the operation is relatively easy, the wafer is developed in the closed soaking tank, the stability of the developing effect is greatly ensured, the adaptability of the device to wafers of different sizes is improved, the application range is expanded, the practicability and cost performance of the device are improved, and the device is more competitive in the market.
Owner:ANHUI SCI & TECH UNIV +1
Isobutyraldehyde biosensor and use thereof
The application relates to establishment and application of an isobutyraldehyde biosensor and belongs to the technical field of bioengineering. yqhD The RFP report system responding to isobutyraldehyde is established, the yqhC gene is rationally designed, a mutant library is constructed through random mutation by using error-prone PCR, isobutyraldehyde is used as a substrate, and through screening of response concentrations and response thresholds, a YqhC mutant without background fluorescence response, with a wider substrate detection range (0-5 g / L) and higher response intensity (24 times) is obtained, and the YqhC mutant is named YqhCm9. The isobutyraldehyde response element (YqhCm9) and the fluorescent protein report element (RFP) are used to construct a high-efficiency and specific isobutyraldehyde biosensor, real-time monitoring of an isobutyraldehyde production process and screening of an isobutyraldehyde production strain can be carried out.
Owner:BEIJING INST OF TECH +1
Intelligent evaluation system for endometrial receptivity based on biosensor data processing
This invention relates to the field of intelligent information processing technology and discloses an intelligent assessment system for endometrial receptivity based on biosensor data processing. The system acquires signals of multiple types of biomarkers in bodily fluid samples through multi-channel biosensor detection and performs structured preprocessing and quantitative transformation. Based on this, it establishes object-level associations between biosensor data and multi-source information to construct a unified feature data system. Furthermore, it constructs a weighted heterogeneous assessment graph and introduces a manifold stochastic feature modeling mechanism to generate manifold feature data. The manifold features and original features are jointly input into a shared-parameter cyclic Transformer model. Through cyclic inference and consistency constraints, multi-round feature fusion is achieved, outputting the endometrial receptivity assessment result. This invention improves the multi-source data modeling capability and the stability and consistency of the assessment process.
Owner:THE FIRST HOSPITAL OF LANZHOU UNIV +1
Interlayer surface plasma resonance biosensor as well as preparation method and application thereof
The invention provides an interlayer surface plasmon resonance biosensor which comprises a patterned substrate, and detection areas which are arranged in an array and are formed by metal layers are formed on the surface of the patterned substrate; the spacing layer is formed in the detection area and comprises capture molecules; the nanometer adhesive tape is compounded on the surface of the patterned substrate, and a metal nanoparticle layer is arranged on one surface, facing the patterned substrate, of the nanometer adhesive tape. The invention further provides a preparation method and application of the interlayer surface plasma resonance biosensor. The nano double-sided adhesive tape is used as a transfer medium, and stable transfer of the metal nanoparticles from the substrate to the adhesive tape can be realized through two-step operation of'attaching-stripping ', so that the transfer difficulty of the metal nanoparticle layer is remarkably reduced, the operation is simplified, and the transfer efficiency is improved. And parameters such as the size, the morphology and the density of the nanoparticles in the sandwich structure can be accurately controlled, and the obtained metal nanoparticle layer is good in stability and can be stored for a long time.
Owner:JILIN UNIVERSITY
Ecl biosensor for detecting microcystin mc-lr
ActiveCN119534585BMicrobiological testing/measurementChemiluminescene/bioluminescencePotassium persulfatePhotomultiplier
The application discloses an ECL biosensor for detecting microcystin. Under the excitation of a photomultiplier tube, AuNC and a co-reactant, potassium persulfate (K2S2O8), directly react to generate AuNC •+ and SO4 •‑ , SO4 •‑ is reduced to SO4 •+ by AuNC 2‑ , and AuNC * is generated simultaneously, wherein AuNC * is an excited state of AuNC, and the excited state is transitioned to a ground state to release light intensity, which is captured by an ECL instrument to generate an ECL signal. With the increase of the content of MC-LR, the ECL signal is stronger, so that quantitative detection of the content of MC-LR is realized. The biosensor platform has a wide detection range from 0.1 pM to 1 nM, and the detection limit is as low as 62.3 fM. The application can realize rapid detection of low-concentration target microcystin MC-LR, and can be applied to detection in various samples, such as food, medicine, milk, beverage, water and the like.
Owner:ANHUI UNIVERSITY OF TECHNOLOGY
Single-tube multiple gene detection method based on CRISPR-Cas12a / Cas14a combined light control technology
PendingCN121227857AMicrobiological testing/measurementMicroorganism based processesMultiplexFluorescence
The invention discloses a single-tube multi-gene detection method based on CRISPR-Cas12a / Cas14a combined with a light control technology. The single-tube multi-gene detection method comprises the following steps: firstly, detecting a single-tube gene; comprising the following steps: acquiring a detection target nucleic acid amplification product; the preparation method comprises the following steps: preparing a PC (at) CRISPR-Cas12a system and a T7-CRISPR-Cas14a system; an amplification product is mixed with a PC (at) CRISPR-Cas12a (Clustered Regularly Interspaced Short Palindromic Repeats / Cas14a) system and a T7-CRISPR-Cas14a system The method comprises the following steps: activating a T7-CRISPR-Cas14a system, and reading a fluorescence signal; the method comprises the following steps: irradiating and activating a PC (at) CRISPR-Cas12a system by using a UV light source, and reading a fluorescence signal; and determining the detection result based on the fluorescence signal. According to the invention, CRISPR-Cas12a and CRISPR-14a systems are combined for use, and a light control technology is combined, so that an accurate and efficient single-tube detection biosensor is developed, and a new tool is provided for the fields of clinical diagnosis, food safety, environment monitoring and the like.
Owner:JINAN UNIVERSITY
Graphene transistor sensor, preparation method and application thereof, and sensor for non-invasive detection of depression
The invention provides a graphene transistor sensor and a preparation method and application thereof, and belongs to the technical field of biosensors. The graphene transistor sensor is used for noninvasive detection of depression and can detect depression-related markers in body fluids such as sweat, urine and saliva through noninvasive collection. According to the invention, a biosensing chip is constructed by using a graphene transistor array modified by gold nanoparticles, and simultaneous monitoring of multiple biomarkers can be realized by fixing different aptamers; the response speed and the sensitivity of the sensor are improved by utilizing the ultrahigh carrier mobility of the single-layer graphene with the quasi-single-crystal structure, and high-precision accurate detection is realized when the concentration of a biomarker is relatively low; the gold nanoparticle layer is used for fixing the aptamer of the target biomolecule, the coverage rate of the gold nanoparticles can be regulated and controlled by limiting the thickness of the gold film, more active sites are provided, the detection range can be expanded, and the detection requirement for continuously and dynamically monitoring the concentration change of the biomarker is met.
Owner:HARBIN INST OF TECH
Method and system for detecting alpha-asarone extracting solution based on biosensor
PendingCN121186149AComponent separationMaterial electrochemical variablesElectrochemical responseMedicinal herbs
The invention relates to the technical field of traditional Chinese medicinal material detection, and particularly discloses an alpha-asarone extracting solution detection method and system based on a biosensor, and the method sequentially comprises the following steps: mixing medicinal material powder to be detected with an extraction solvent according to a certain solid-to-liquid ratio, and extracting volatile oil by adopting an ultrasonic or reflux method to obtain a crude extracting solution; volatile oil concentrated mother liquor is obtained; obtaining a standard solution; a combined-state electrode is obtained; obtaining electrochemical response data; and converting the electrochemical response data into the content of alpha-asarone in the sample according to the standard curve, and evaluating the precision, the recovery rate and the regeneration performance to obtain a final detection result. Recognition sites prepared by adopting the molecularly imprinted polymer are complementarily paired with template molecules in steric configuration, steric hindrance and key functional groups to realize specific recognition of alpha-asarone, so that false signals caused by matrix interference and non-specific adsorption are remarkably reduced; the electrochemical measurement method is extremely sensitive to electron transfer generated by surface bonding.
Owner:HEILONGJIANG UNIV OF CHINESE MEDICINE
Paper-based semi-solid phase fret biosensor based on graphene oxide and dna fluorescent probe and preparation method thereof
Owner:ZHUHAI INST OF ADVANCED TECH CO LTD
Ssdna aptamers for malaria detection and their use in diagnostic compositions
The present invention relates to ssDNA aptamers speciically binding to Plasmodium lactate dehydrogenase (LDH). The invention provides ssDNA aptamers having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which are capable of binding LDH from at least Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. The aptamers enable in vitro detection of malaria independently of the infecting Plasmodium species and may be used in diagnostic compositions, kits, and biosensor-based detection systems.
Owner:LATVIJAS UNIVE
An embedded whole-cell biosensor, its preparation method and application in machine learning assisted mercury ion detection
PendingCN122282714ALong-term fluorescence stabilityImprove mechanical propertiesSensor materialsBiocompatibility
This application discloses an embedded whole-cell biosensor, its fabrication method, and its application in machine learning-assisted mercury ion detection, belonging to the field of sensor materials and detection technology. This sensor encapsulates *E. coli* expressing green fluorescent protein (GFP) in a polyacrylamide / hyaluronic acid (PAAM / HA) hydrogel matrix, enabling highly selective and sensitive detection of mercury ions. It effectively eliminates interference from competing metal ions and can be completely regenerated through EDTA-2Na treatment, allowing for repeated use without performance loss. It maintains a stable fluorescence response for up to three weeks, possesses excellent biocompatibility and biodegradability, minimizing the risk of secondary contamination, and facilitates rapid on-site analysis.
Owner:OCEAN UNIV OF CHINA SHENZHEN RES INST +1
A method for monitoring the curative effect of Chinese and Mongolian and western medicines in real time based on biosensing technology
This invention relates to the field of medical data and discloses a method for real-time monitoring of the efficacy of traditional Chinese medicine, Mongolian medicine, and Western medicine based on biosensor technology. This method enables real-time monitoring of drug efficacy and personalized medication guidance. The process includes collecting real-time multimodal biosignals from the user's body surface or minimally invasive body fluid samples to obtain raw sensor signals and acquire sensor array output; extracting real-time pharmacokinetic characteristic signals based on a preset pharmacokinetic model and mapping them to efficacy assessment parameters according to drug type; comparing the efficacy assessment parameters with a preset safe and effective concentration range to generate real-time medication status indicators and dosage adjustment prompts. This invention designs quantitative assessment methods for different types of drugs, enabling real-time comparison to generate efficacy status codes and dosage adjustment suggestions. It comprehensively generates a medication guidance report and transmits it in real-time to the user or clinical monitoring end, allowing for immediate adjustment of the medication regimen and ensuring safe and effective medication.
Owner:AFFILIATED HOSPITAL OF INNER MONGOLIA MEDICAL UNIV (INNER MONGOLIA AUTONOMOUS REGION CARDIOVASCULAR INST)
His-tagged diversity nucleic acid aptamer and use thereof
The application discloses a histidine tag diversity nucleic acid aptamer and application thereof, and belongs to the technical field of biological processing. The nucleotide sequence of the histidine tag diversity nucleic acid aptamer is shown in SEQ ID NO. 3, or SEQ ID NO. 4, or SEQ ID NO. 5, or SEQ ID NO. 6. The application also discloses an application of the histidine tag diversity nucleic acid aptamer in preparation of a biosensor element for targeted recognition of a histidine tag-containing protein or polypeptide. The application also discloses an application of the histidine tag diversity nucleic acid aptamer in qualitative analysis, quantitative detection and separation and purification of the histidine tag-containing protein or polypeptide. The histidine tag diversity nucleic acid aptamer is obtained by taking HisA1-T63 aptamer as an initial chain, preliminarily improving the aptamer through sequence truncation, and repositioning a functional module to a loop region for diversity modification, thereby expanding the structural diversity of the histidine tag nucleic acid aptamer.
Owner:OCEAN UNIV OF CHINA
Photonic biosensors for multiplexed diagnostics and a method of use
ActiveUS12625137B2Material analysis by optical meansLaboratory glasswaresPhotonic sensorLight signal
An apparatus for photonic biosensors for multiplexed diagnostics and a method of use are disclosed. The apparatus includes a portable device configured for point-of-care diagnostics. The portable device includes a photonic sensor chip that includes one or more resonators that is substantially in contact with at least a fluid that includes one or more analytes and the reader device communicatively connected to the photonic sensor chip that includes at least a light source and the reader device is configured to provide an input optical signal using the at least a light source, receive the one or more sensor signals from the photonic sensor chip and determine one or more characteristics of the one or more analytes as a function of the one or more sensor signals and a connecting system, wherein the connecting system is configured to connect the photonic sensor chip and the reader device.
Owner:SIPHOX INC