205 results about "Catalase" patented technology

The invention discloses a metal-doped carbon quantum dot as well as preparation and application of the metal-doped carbon quantum dot in a nano antibacterial agent, citric acid, urea and tea polyphenol are taken as precursors, metal salt is added, carbon dot synthesis and metal ion doping are synchronously completed in one step through a hydrothermal method, and the metal-doped carbon quantum dot is prepared; the surfaces of the metal-doped carbon quantum dots are negatively charged, and the metal-doped carbon quantum dots have peroxidase-like activity and catalase-like activity at the same time; the metal ions adopt any one of Fe < 3 + >, Cu < 2 + > and Ce < 3 + >; the metal-doped carbon quantum dots are in a sphere-like shape. The metal-doped carbon quantum dots prepared by the preparation method disclosed by the invention have peroxidase-like activity and catalase-like activity at the same time through precise doping of metal ions, and the two activities have a synergistic effect in an oral periodontitis microenvironment, so that a good antibacterial effect is achieved.

The invention belongs to the field of nano-medicine and traditional Chinese medicine, and particularly discloses an antioxidant nano-material based on self-assembly of traditional Chinese medicine and copper ions and a preparation method thereof.The nano-material is prepared from BPCu nano-particles formed by self-assembly of berberine and procyanidine B2 under induction of the copper ions, the BPCu nano-particles are further subjected to surface modification through polyvinylpyrrolidone, and the antioxidant nano-material is prepared. And the stably dispersed PVP-coated BPCu nano structure is obtained. The material is small in particle size, uniform in distribution, good in water solubility and storage stability, excellent in free radical scavenging capacity and catalase-like activity and suitable for adjuvant therapy of oxidative stress related diseases, and the preparation method is easy and convenient to operate, does not need an organic solvent and has good industrialization and disease treatment potential.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the field of plant genetic engineering, and discloses a key gene OsHPCA1 for positively regulating salt stress and oxidative stress tolerance of rice. The gene (with the login number of Os05g40770) encodes a receptor protein capable of specifically sensing hydrogen peroxide, and belongs to a leucine repeat receptor-like protein kinase (LRR-RLKs) family, wherein the family is the largest subfamily in the receptor-like protein kinase (RLKs). The OsHPCA1 responds to salt and oxidative stress signals, and the salt tolerance and oxidative stress resistance of the rice are positively regulated and responded. The OsHPCA1 overexpression rice strain shows very strong salt tolerance; and the OsHPCA1 knockout strain oshpca1 is more sensitive to salt stress. The OsHPCA1 protein encoded by the OsHPCA1 gene and rich in leucine repeat receptor-like protein kinase can positively regulate and control the activity of catalase C (CatC) in rice and enhance the removal efficiency of H2O2 under salt stress, so that the salt tolerance of rice is improved. When the OsHPCA1 is overexpressed, the activity of CatC in the overexpressed strain OsHPCA1 is obviously increased, the H2O2 removal capability is enhanced, and the salt tolerance and oxidative stress tolerance of the rice are improved.

The invention provides an application of catalase nanoparticles in preparation of a medicine for preventing or treating thrombus. A method for preparing the catalase nanoparticles comprises the following steps: 1) reacting dopamine with melanin to generate melanin modified by the dopamine; 2) preparing catalase with carboxyl activated by EDC; and 3) in the presence of NHS, mixing the melanin modified by dopamine with the catalase with carboxyl activated by EDC, stirring overnight, then adding amino methoxy polyethylene glycol (mPEG-NH2), and continuing to react for 3 hours to obtain a product, namely the melanin-dopamine-catalase nanoparticles. The catalase nanoparticles provided by the invention can maintain the biological activity of melanin and catalase for a long time, and can avoid the risk of bleeding when preventing or treating thrombus.

The invention relates to a chemiluminescence kit for detecting pepsinogen II. The kit comprises an enzyme marker, a luminescent substrate solution and an anti-interference buffer system, the anti-interference buffer system comprises a nonionic surfactant, animal-derived IgG (immunoglobulin G), an antioxidant and catalase; the chemiluminescence kit also comprises a PG II calibration product and a PG II quality control product. The core active component of the enzyme marker is beta-galactosidase. The enzyme marker further comprises an anti-PG II monoclonal antibody marked by beta-galactosidase, bovine serum albumin, trehalose, cane sugar, MgCl2. 6H2O, sodium chloride, Proclin300 and a phosphate buffer solution. According to the kit, a brand-new anti-interference buffer system is introduced on the basis of a spatial proximity chemiluminescence analysis method, so that the resistance to clinically common interferents (such as hemolysis, lipemia, jaundice and heterotropism antibodies) is remarkably improved, and the detection result is more accurate and reliable.

The invention belongs to the field of biomedical materials, and discloses a preparation method and application of a mesoporous polydopamine nano preparation loaded with ultra-small nano enzyme. The nano preparation takes mesoporous polydopamine nanoparticles as a carrier skeleton and is combined with ultra-small nano enzyme through an in-situ reaction: the mesoporous polydopamine nanoparticles can efficiently carry drugs and accurately deliver the drugs to inflammatory tissues such as psoriasis, gout, colitis and the like by virtue of a modified targeting ligand by virtue of high specific surface area, biocompatibility and modifiability; the ultra-small nano enzyme has catalytic activity of catalase and the like, and can remove active oxygen and relieve oxidative stress. The two components are combined to achieve a synergistic effect, so that the catalytic efficiency of the enzyme is improved by virtue of the characteristics of the carrier, the high activity of the enzyme under different conditions is maintained by virtue of the stability of the carrier, and the platform can synchronously realize targeted delivery, enzymatic treatment and drug controlled release, and has a wide application prospect in the fields of inflammatory disease intervention and wound repair. And an efficient, accurate and low-toxicity universal treatment strategy is provided for chronic inflammatory diseases.

The invention relates to a hydrogel light-operated multi-mode synergistic treatment platform based on a CuxS-MoS2 heterojunction for promoting wound healing of diabetes mellitus. And an interface induced electric field strategy is provided through density functional theory (DFT) calculation to optimize the charge migration behavior of the phototherapy agent. The multifunctional phototherapy system is constructed by taking CuxS-MoS2 with a built-in electric field as a core and PVA-CS hydrogel loaded with glucose oxidase (GOx) as a bracket. In a weakly acidic wound microenvironment, glucose at the wound is catalyzed by GOx to be converted into H2O2 and gluconic acid; meanwhile, the CuxS-MoS2 remarkably enhances the generation of reactive oxygen species (ROS) under illumination through peroxidase-like (POD) activity, photothermal effect (PTT) and heterojunction efficient carrier separation. After entering a proliferation period, the stent exerts catalase-like (CAT) activity to remove excessive ROS and release oxygen, and oxygen deficit and oxidative stress are relieved. In addition, the controllably released copper ions regulate and control the behavior of fibroblasts, promote healing and inhibit fibrosis. Experiments prove that the stent has excellent biocompatibility, effective antibacterial property and remarkable healing promoting effect in chronic wound repair of diabetes mellitus.

The invention provides a near-infrared light mediated hybrid hydrogel multi-bioactivity synergistic tissue repair promoting material as well as a preparation method and application thereof, and relates to the technical field of biological materials. The method comprises the following steps: 1) dispersing calcium peroxide in a solvent, and adding a 3-hydroxytyramine hydrochloride solution for reaction to obtain CaO2 (at) PDA nanoparticles; enabling the CaO2 (at) PDA nano-particles to react with a catalase solution, so as to obtain ORN oxygen release particles; (2) mixing the ORN oxygen release particles with the surfaces rich in sulfydryl with Se-NPs with the surfaces rich in selenol after reduction treatment under the protection of inert atmosphere to obtain ORN-coated Se composite particles; the preparation method comprises the following steps: dissolving hyaluronic acid methacrylate in deionized water, adding the ORN-coated Se composite particles, uniformly mixing, adding a photoinitiator, and carrying out ultraviolet curing to obtain the ORN-coated Se-HAMA hydrogel which can realize local response oxygen supply on an anoxic wound surface and has antibacterial and antioxidant characteristics.

This invention provides a simple synthesis method for Fe-Ag / CMP nanopolymers with catalase-like activity and their application in hydrogen peroxide detection, belonging to the field of bioanalytical technology. The method of this invention includes the following steps: (1) preparing a 4-hydroxyethylpiperazine thiosulfonic acid (HEPES) standard buffer solution; (2) adding cytidine monophosphate (CMP) to the solution obtained in step (1) and stirring until the CMP is fully dissolved. Then, under vigorous stirring, ferric nitrate aqueous solution and silver nitrate aqueous solution are added sequentially, at which point the colorless solution turns pale yellow; (3) transferring the mixed solution obtained in step (2) to a centrifuge tube, centrifuging at 12000 rpm for 8 min to collect the precipitate, washing it three times with distilled water, and finally adding 4 mL of distilled water to obtain a 1 mg / mL Fe-Ag / CMP suspension. This invention utilizes CMP as a biological ligand and Ag... + Fe 3+ Simultaneous coordination, and the reducing amino groups on CMP can directly transfer Ag... + In situ reduction to silver nanoparticles (AgNPs) led to the one-step synthesis of a bimetallic Fe-Ag / CMP nanopolymer with hydrogen peroxide-like nanozyme activity, enabling the detection of hydrogen peroxide.

The application discloses a kind of cultivation methods of konjak, belong to konjak planting technical field, the present application is to the pretreatment konjak seed potato of sterilization in nitrogen and ozone mixed atmosphere steam treatment, not only strengthen the growth potential of konjak seed potato, and fully activated the catalase in seed potato, create excellent intracellular environment for promoting subsequent seed potato germination, heat shock seed potato is soaked in activation liquid and activated, brassinolide, calcium sulfate, ethiofencarb and sodium complex nitrophenol in activation liquid activate the cytokinin oxidase in cell, and then regulate seed potato germination speed and germination quality, effectively solve the problem of low seedling rate of offspring konjak and yield decline.The activation seed potato is sowed in nutrient soil, effectively improves the content of nutrient substance in harvested konjak.

This invention belongs to the fields of biotechnology and genetic engineering, and relates to a dual-enzyme fusion protein resistant to hydrogen peroxide inhibition, a polynucleotide, an expression vector, and its applications. The dual-enzyme fusion protein is composed of a glutamate oxidase mutant, a catalase mutant, and a linker peptide; the amino acid sequences of the glutamate oxidase mutant and the catalase mutant are shown in SEQ ID NO. 2 and 4, respectively, in the sequence listing. This invention improves the performance of single enzymes through enzyme molecule modification, achieves spatial synergy through fusion protein design, and enables industrial application through a continuous reaction process; it fundamentally solves the problem of hydrogen peroxide's inhibition of glutamate oxidase products; and the fusion expression simultaneously improves the stability and reusability of the dual enzymes.

This invention relates to the field of oral care products technology, specifically to an artificial enzyme with antibacterial properties, its preparation method, and its application. This technical solution employs a chemical reduction method, where a palladium source reacts in an environment containing surfactants and reducing agents to obtain palladium nanozymes. The obtained palladium nanozymes exhibit uniform morphology, controllable particle size, good dispersibility in water, and good biocompatibility; they have no significant toxic side effects on human gingival fibroblasts, possess highly efficient catalase activity, and demonstrate strong antibacterial and bactericidal effects against oral pathogens, significantly reducing bacterial drug resistance; they can inhibit acid production by oral bacteria, preventing tooth decay; and they retain their original catalytic activity even after multiple cycles of use. Applying the palladium nanozymes of this solution to the manufacture of oral care products can solve the technical problems of unsatisfactory safety and easy development of drug resistance in existing oral care products using antibacterial and anti-caries methods, showing promising application prospects.

The application discloses a method for promoting growth of cymbidium on a steel slag flat bed based on microbial organic matrix, and belongs to the technical field of steel slag resource utilization. The application inoculates eight kinds of bacillus agents with different concentrations on the bacterial residue to prepare the organic matrix, and then covers the matrix on the converter slag to promote the growth of cymbidium on the converter slag, and selects the bacillus strain with the best growth promotion effect and the most suitable inoculation concentration. The results show that after being inoculated with bacillus megaterium, bacillus polymyxa and bacillus mucilaginosus, the sucrose activity of the soil is enhanced; the hydrogen peroxide activity of the soil in the four groups of treatments inoculated with the bacillus agent is stronger than that in the control group; the application of the bacillus megaterium, bacillus polymyxa and bacillus mucilaginosus enhances the urease activity in the soil; the inoculation of the bacillus megaterium promotes the release of Ca and P elements in the soil and the absorption of Ca, P, Mg, Mn and Si elements by the plant.

The utility model discloses an indoor residue discharging device which comprises an air inlet, a driver, a ventilation pipeline, a processing bin and an air outlet. The driver drives indoor air to enter the ventilation pipeline through the air inlet, the ventilation pipeline conveys the air to the treatment bin, a solution mixed with catalase is arranged in the treatment bin, the ventilation pipeline extends into the treatment bin and is inserted into the solution, the catalase can reduce the content of a strong oxidant in the air, and the content of the strong oxidant in the air can be reduced. The treated air returns indoors through the air outlet to form a closed-loop air purification loop; and a pipeline leading to the outside is not needed, the installation complexity is reduced, cyclic utilization of indoor air is achieved, and the environmental hardware requirement is reduced.

The application belongs to the field of plant genetic engineering, and discloses a key gene for positively regulating salt stress and oxidation stress tolerance of rice OsHPCA1 . The gene (accession number: Os05g40770) encodes a receptor protein specifically sensing hydrogen peroxide, which is classified into the leucine repeat receptor-like kinase (LRR-RLKs) family, which is the largest subfamily in the receptor-like kinase (RLKs) family. OsHPCA1 In response to salt and oxidation stress signals, the rice salt and oxidation stress tolerance is positively regulated. OsHPCA1 The overexpression rice strain shows strong salt tolerance; and OsHPCA1 the knockout strain oshpca1 is more sensitive to salt stress. OsHPCA1 The leucine repeat receptor protein kinase OsHPCA1 encoded by the gene can positively regulate the activity of catalase C (CatC) in the rice body, enhance the H2O2 clearance efficiency under salt stress, and thus improve the salt tolerance of the rice. When OsHPCA1 overexpressed, the activity of CatC in the overexpression strain OsHPCA1 is significantly increased, the H2O2 clearance capacity is enhanced, and the salt tolerance and oxidation stress tolerance of the rice are improved.

The invention discloses sodium alginate hydrogel of a chimeric antigen receptor NK cell for expressing catalase and application of the sodium alginate hydrogel. The hydrogel is formed by mixing endogenous calcium ion reactive hydrogel composed of HER1-CAR-CAT-NK and sodium alginate. After the hydrogel disclosed by the invention is injected into an operation excision part, HER1-CAR-CAT-NK cells are decomposed into oxygen by catalyzing main active oxygen (hydrogen peroxide) in a tumor, so that the tolerance of the cells to high-level oxidative stress and hypoxia in the tumor is improved, and the hydrogel shows obviously enhanced durability and effect functions in triple negative breast cancer, and therefore, the hydrogel can be used for preparing a medicine for treating the triple negative breast cancer. The local cell therapy not only can inhibit the growth of local primary residual tumors, but also can stimulate the whole-body anti-tumor activity and inhibit the growth of distant tumors. According to the present invention, the tumor oxidative stress and the anoxic microenvironment are remodeled through the ALG of HER1-CAR-CAT-NK so as to inhibit the postoperative recurrence of TNBC;

The invention belongs to the field of contact lens care, and particularly relates to a sandwich effervescent tablet for cleaning contact lenses and a preparation method of the sandwich effervescent tablet. The outer layer is prepared from the following raw materials: citric acid, sodium bicarbonate, disodium ethylene diamine tetraacetate, a surfactant, polyvinylpyrrolidone, microcrystalline cellulose and colloidal silicon dioxide; the middle layer is prepared from the following raw materials in parts by weight: sodium percarbonate, tetraacetylethylenediamine, phosphate buffer salt, a surfactant, anhydrous sodium carbonate, microcrystalline cellulose and colloidal silicon dioxide; the inner core is prepared from the following raw materials in parts by weight: catalase, a stabilizer, hydroxy propyl cellulose K4M, ethyl cellulose, microcrystalline cellulose and sodium bicarbonate. According to the invention, citric acid / bicarbonate is matched with an active agent to weaken a biological membrane in the outer layer, and a permeation channel is opened preferentially; the H2O2 platform is formed by matching middle-layer sodium percarbonate; and the inner core adopts HPMC / EC controlled-release catalase to realize hysteresis-burst release neutralization.

This invention provides a cell microenvironment stabilizer that captures hydrogen ions, its preparation method, and its application, belonging to the field of biomedical technology. The preparation method of this cell microenvironment stabilizer includes the following steps: (1) mineralizing CaCl2 with TGF-β1, catalase, and polyethylene glycol-polyglutamic acid block copolymer to obtain mineralized nanoparticles; (2) preparing hydrogel microspheres under freezing conditions using a microfluidic device, and then photocrosslinking the frozen hydrogel microspheres; (3) mixing the hydrogel microspheres with the mineralized nanoparticles to prepare the cell microenvironment stabilizer. This invention prepares a mineralized hydrogel microsphere, which, as a cell microenvironment stabilizer, can be used to block the NLRP3 cascade in chronic inflammation, capturing excess hydrogen ions through the mineralization layer to neutralize the acidic microenvironment. This micro / nano bioreactor based on hydrogel microspheres can effectively interfere with NLRP3 in the microenvironment of degenerated tissues from inside and outside the cells, inhibiting chronic inflammation.

This invention relates to the field of catalytic degradation technology for organic pollutants, and particularly to an iron-modified biochar immobilized catalase, its preparation method, and its application. The preparation method of the iron-modified biochar immobilized catalase includes the following steps: mixing iron-modified biochar, catalase solution, and an extracellular polymeric substance; performing an immobilization and cross-linking reaction; and separating the solid and liquid phases to obtain the iron-modified biochar immobilized catalase; the extracellular polymeric substance is secreted by *Goldenella*. This invention uses an extracellular polymeric substance instead of traditional glutaraldehyde as a cross-linking agent, avoiding the hazards associated with glutaraldehyde. Simultaneously, the prepared iron-modified biochar immobilized catalase exhibits higher enzyme activity and superior pollutant degradation performance.

The invention relates to a method for constructing an aptamer sensor for detecting GP73 based on a Zn-TCPP (Fe) nano material, which is characterized in that the Zn-TCPP (Fe) nano material with unique morphology and good catalase-like activity is connected to GP73Apt to generate the Zn-TCPP (Fe)-GP73Apt aptamer sensor, and the Zn-TCPP (Fe)-GP73Apt aptamer sensor can be used as a recognition probe and a catalyst at the same time. NGQDs are used as a fluorescence donor, DAP is used as a fluorescence receptor, the fluorescence intensity (F562) of the DAP is enhanced and the fluorescence intensity (F445) of the NGQDs is reduced due to the FRET phenomenon between the NGQDs and the DAP, and the quantitative detection of the GP73 is realized through the linear relationship between the ratio F562 / F445 of the NGQDs and the concentration of the GP73.

The application discloses a method for synthesizing catalase nanocapsules based on gas-liquid two-phase flow microfluidic technology and application. Nitrogen is used as a gas phase, and a liquid phase containing acrylated catalase, a monomer mixture and a crosslinking agent is used to form Taylor flow in a microfluidic chip. The internal vortex of the gas-liquid interface is used to enhance the mixing efficiency, and in-situ radical polymerization on the surface of the enzyme is realized. By screening six microfluidic chips with different structures, the geometric parameters of the chip and the hydrodynamic conditions are optimized, and the particle size uniformity and enzyme activity retention rate of the nanocapsules are significantly improved. The application also discloses a continuous flow reactor system for loading the obtained nanocapsules on macroporous resin microspheres to construct a continuous flow reactor system, and the system is used for efficient degradation of hydrogen peroxide in semiconductor wastewater. The method has the advantages of high mixing efficiency, mild reaction conditions, continuous production and the like, the obtained nanocapsules have the advantages of narrow particle size distribution, high enzyme activity and good stability, and are suitable for the field of industrial wastewater treatment.

The application discloses an antibacterial hollow mesoporous silica ball injectable hydrogel dressing and a preparation method thereof, and belongs to the technical field of hydrogel dressing preparation. The antibacterial hollow mesoporous silica ball injectable hydrogel dressing provided by the application is obtained by self-crosslinking of a four-arm polyethylene glycol modified by o-phthaldehyde as a crosslinking agent and a hollow mesoporous silica ball loaded with tannic acid in a solvent. Compared with the prior art, the antibacterial hollow mesoporous silica ball injectable hydrogel dressing provided by the application can be gelled without the participation of catalase, has a better gelation time, and can be injected and in-situ formed, so that deep wounds can be treated (the existing hydrogel is too fast or too slow in gelation, and can only be directly made into a gel for use in shallow wounds); moreover, the mechanical strength of the gel can be improved; and the hydrogel dressing has good biocompatibility, degradability, antibacterial property and good repair promoting capacity.

The invention belongs to the technical field of plant disease control, and particularly relates to application of N-hydroxypiperidine acid to improvement of postharvest disease resistance of tomato fruits. The technical problem to be solved by the invention is to provide a new choice for improving the disease resistance of the picked tomato fruits in the storage stage. The technical scheme of the invention is to provide application of N-hydroxypiperidine acid in improvement of postharvest disease resistance of tomato fruits. According to the technical scheme, the N-hydroxypiperidine acid is used, so that the resistance of the picked tomato fruits to botrytis cinerea can be effectively improved, the MDA content in the storage period of the picked fruits is reduced, the peroxidase activity and catalase activity of the fruits are improved, and the disease resistance of the picked tomato fruits is integrally and effectively improved. The method is simple and convenient to operate, low in cost, obvious in effect and good in application value.

The invention provides photo-thermal response enhanced hydrogel loaded with black rice extract as well as a preparation method and application of the photo-thermal response enhanced hydrogel loaded with the black rice extract, and the photo-thermal response enhanced hydrogel is formed by taking a mixture of hyaluronic acid / tyrosine conjugate and the black rice extract as a base material under the cross-linking action of horse radish peroxidase / catalase, horseradish peroxidase acts on the black rice extract while serving as a cross-linking agent, the near-infrared photo-thermal responsiveness of the black rice extract after reaction of the horseradish peroxidase is greatly enhanced, and good oxidation resistance, inflammation resistance and photo-thermal responsiveness can be achieved only through a small amount of black rice extract in a hydrogel system.

The invention discloses a strain of spirillum harteri FtiPS-6 and an application of the strain of spirillum harteri FtiPS-6. The bacterial strain is classified and named as Herbaspiridium huttiense FtiPs-6, and the preservation number of the bacterial strain is CGMCC (China General Microbiological Culture Collection Center) No.37084. The invention further discloses a preparation method of the bacterial strain. The spirillum harteri FtiPS-6 disclosed by the invention can effectively promote the growth of buckwheat and improve the production capacity, so that the plant height, the fresh weight and the yield of a single plant are remarkably increased. The strain can also improve the tolerance of buckwheat to drought stress, so that the survival rate, the relative water content and the proline content of buckwheat are remarkably increased, the catalase activity level is improved, and the malondialdehyde content is reduced. In an in-vitro simulated drought culture environment, the proline production capability of the strain is induced to be improved. And the method has a relatively high application value.

The application discloses a naphthalene phthalocyanine copper liposome and a construction method and application thereof, and belongs to the technical field of liposome preparations. The naphthalene phthalocyanine copper liposome can improve the problems of poor water solubility and insufficient stability of existing sonosensitizers by wrapping naphthalene phthalocyanine copper and catalase in the liposome. Meanwhile, the naphthalene phthalocyanine copper liposome has the function of catalyzing the production of O2 by excessive H2O2 in the microenvironment of brain glioma to supply the continuous production of ROS in the sonodynamic therapy (SDT), enhances the sonodynamic performance, improves the treatment effect of brain glioma, has the advantages of good biological safety, low immunogenicity and long circulation in the body, can effectively penetrate the blood-brain barrier and be delivered to the tumor site, solves the problems that drugs are difficult to penetrate the blood-brain barrier and cannot reach an effective concentration in the traditional treatment method of brain glioma, and provides a new strategy for the treatment of brain glioma.

The application discloses C4 corn ZmClpP6 protein and application of related biological materials thereof in regulation of high light response capability of plants. ZmClpP6 It is found that: ZmClpP6 The knockout can reduce chlorophyll content, total carotenoid content, catalase activity and copper-zinc SOD enzyme activity of corn under high light conditions, and makes corn leaves appear yellowing phenotype. It is indicated that ZmClpP6 can regulate high light response capability of plants. The application clones ZmClpP6 the gene in corn for the first time and analyzes the biological function thereof, and has important significance for cultivation of high light efficiency plants.

The invention relates to the field of plant biotechnology and molecular biology, in particular to application of a VvECT10 gene in regulation and control of drought resistance of grapes. A strain with overexpressed VvECT10 gene is slow in leaf water loss and light in withering degree under a drought condition, the content of malondialdehyde (MDA) and hydrogen peroxide (H2O2) is remarkably reduced, and the activity of peroxidase (POD) and catalase (CAT) is remarkably improved, which indicates that the overexpression of the VvECT10 gene can enhance the drought resistance of the grape plant and relieve oxidative damage.

The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a heat-resistant and alkali-resistant recombinant catalase mutant, a genetically engineered bacterium and application thereof, wherein the mutant is obtained by single-point or multi-point combined mutation of the 439th, 455th, 594th or 681st amino acid in the amino acid sequence shown in SEQ ID NO. 1. The engineered Aspergillus niger bacterium constructed in the present application can efficiently ferment to produce the catalase mutant, and the enzyme activity of the catalase mutant is nearly 5 times higher than that of wild-type catalase (18952.16 U / mL), reaching 110081.68 U / mL. Compared with wild-type catalase, the heat resistance and alkali resistance of the catalase mutant are significantly improved, the application range is wider, and the catalase mutant has excellent industrial application potential.