316 results about "Catalase" patented technology

The invention discloses a metal-doped carbon quantum dot as well as preparation and application of the metal-doped carbon quantum dot in a nano antibacterial agent, citric acid, urea and tea polyphenol are taken as precursors, metal salt is added, carbon dot synthesis and metal ion doping are synchronously completed in one step through a hydrothermal method, and the metal-doped carbon quantum dot is prepared; the surfaces of the metal-doped carbon quantum dots are negatively charged, and the metal-doped carbon quantum dots have peroxidase-like activity and catalase-like activity at the same time; the metal ions adopt any one of Fe < 3 + >, Cu < 2 + > and Ce < 3 + >; the metal-doped carbon quantum dots are in a sphere-like shape. The metal-doped carbon quantum dots prepared by the preparation method disclosed by the invention have peroxidase-like activity and catalase-like activity at the same time through precise doping of metal ions, and the two activities have a synergistic effect in an oral periodontitis microenvironment, so that a good antibacterial effect is achieved.

The invention discloses a drug-loaded liposome nano-particle, a preparation method thereof and application of the drug-loaded liposome nano-particle in treatment of brain glioma, and belongs to the technical field of biological nano-medicines. The invention provides a novel copper phthalocyanine derivative and catalase co-loaded lipidosome nanoparticle and application of the novel copper phthalocyanine derivative and catalase co-loaded lipidosome nanoparticle to treatment of brain glioma on the cellular level. The nano-particles are obtained by wrapping copper phthalocyanine derivatives and catalase with lipidosome prepared by a microfluidic method. The co-drug-loaded liposome can catalyze excessive H2O2 in brain glioma to generate oxygen, and O2 is continuously supplied to photodynamic therapy (PDT) to generate active oxygen; meanwhile, Cu < 2 + > can deplete glutathione and improve the oxidative stress level in the glioma, the reduction product Cu < + > can convert H2O2 into hydroxyl radicals with higher toxicity through a Fenton-like reaction, oxidative stress injury is doubly amplified, cascade cooperation of PDT and chemical dynamic therapy (CDT) is achieved, and the treatment effect on the glioma is remarkably enhanced.

The invention discloses a comprehensive prevention and control method for tobacco root knot nematode disease containing a biological agent. The method comprises the steps of crop rotation of tobacco and buckwheat / quinoa, host resistance induction of the microbial agent in the seedling raising period, tobacco planting soil quality improvement in the transplanting period and the like. The agronomic characters of tobacco seedlings are effectively improved, and the physical characters of soil are improved; the chemical properties of soil pH, alkali-hydrolyzable nitrogen, available phosphorus, quick-acting potassium, exchangeable calcium, exchangeable magnesium and the like are improved; the activity of soil urease, sucrase, acid phosphatase, catalase and peroxidase is improved; the content of water-soluble phenols, compound phenols and total phenols in soil is reduced; the disease index of the tobacco root knot nematode disease can be remarkably reduced, the survival rate of tobacco is increased, the application amount of chemical agents is reduced, and the healthy and sustainable development of the tobacco industry is promoted.

The invention provides a plasmid, an alpha-ketoglutaric acid engineering strain and a construction method and application of the alpha-ketoglutaric acid engineering strain, the strain is obtained by adopting a directional transformation method, transcriptional levels of katE, katG, sodB and grxA genes are up-regulated, a catR gene and a katA gene are heterologously expressed, a high-copy plasmid pETKG is carried, and the plasmid simultaneously expresses L-glutamate oxidase LGOX genes from Streptomyces sp and Chain A; the strain self-synthesized catalase eliminates H2O2 generated in the process of producing alpha-ketoglutaric acid through enzyme catalysis, engineering bacteria of L-glutamate oxidase LGOX expressed by pETKG plasmids are used for performing whole-cell catalysis on L-sodium glutamate to synthesize alpha-ketoglutaric acid, and the engineering strain is a high-level engineering strain capable of industrially and stably producing alpha-ketoglutaric acid.

The invention belongs to the field of nano-medicine and traditional Chinese medicine, and particularly discloses an antioxidant nano-material based on self-assembly of traditional Chinese medicine and copper ions and a preparation method thereof.The nano-material is prepared from BPCu nano-particles formed by self-assembly of berberine and procyanidine B2 under induction of the copper ions, the BPCu nano-particles are further subjected to surface modification through polyvinylpyrrolidone, and the antioxidant nano-material is prepared. And the stably dispersed PVP-coated BPCu nano structure is obtained. The material is small in particle size, uniform in distribution, good in water solubility and storage stability, excellent in free radical scavenging capacity and catalase-like activity and suitable for adjuvant therapy of oxidative stress related diseases, and the preparation method is easy and convenient to operate, does not need an organic solvent and has good industrialization and disease treatment potential.

The invention discloses bacillus orientalis, a microbial agent and application of the bacillus orientalis and the microbial agent, the bacillus orientalis is named as bacillus orientalis Jiang8 and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO. 33084, and the preservation time is December 16, 2024. The bacillus orientalis screened and identified by the invention has good saline-alkaline tolerance and strong stress resistance; besides, the strain disclosed by the invention not only can secrete extracellular polymeric substances and catalase in a saline-alkali environment, but also can fix nitrogen and dissolve phosphorus (converting insoluble phosphorus into water-soluble phosphorus), provides nutrition for crops, further promotes growth and development of the crops, and provides a new thought for ecological management of saline-alkali soil.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention discloses an AuAgPt ternary alloy nano-framework, a preparation method thereof and application of the AuAgPt ternary alloy nano-framework in anti-tumor preparations, and belongs to the field of biomedical nano-materials. The AuAgPt ternary alloy nano frame is a hollow octahedral nano frame formed by 12 AuAgPt ternary alloy edges, and the nano frame has plasmon photothermal conversion performance, catalase activity and peroxidase-like activity, and can be used for preparing the nano frame. The aptamer has the characteristics that the aptamer can form a covalent bond with glutathione (GSH), the aptamer with the framework surface capable of being modified and specifically bound with tumor cells is used for tumor targeted delivery and the like, the aptamer can be bound in a targeted manner and internalized into the tumor cells, and after near-infrared laser irradiation, the cell temperature can be increased to 42 DEG C, reactive oxygen species (ROS) can be generated, GSH can be consumed, and the tumor targeting effect is achieved. In addition, the content change of small molecule metabolites in cells can be driven through a low-temperature photothermal effect, the metabolic state is disturbed, the redox balance in the cells is destroyed, the tumor cells are induced to generate ferroptosis and apoptosis, and the low-temperature photothermal treatment of tumors is realized.

The invention belongs to the field of plant genetic engineering, and discloses a key gene OsHPCA1 for positively regulating salt stress and oxidative stress tolerance of rice. The gene (with the login number of Os05g40770) encodes a receptor protein capable of specifically sensing hydrogen peroxide, and belongs to a leucine repeat receptor-like protein kinase (LRR-RLKs) family, wherein the family is the largest subfamily in the receptor-like protein kinase (RLKs). The OsHPCA1 responds to salt and oxidative stress signals, and the salt tolerance and oxidative stress resistance of the rice are positively regulated and responded. The OsHPCA1 overexpression rice strain shows very strong salt tolerance; and the OsHPCA1 knockout strain oshpca1 is more sensitive to salt stress. The OsHPCA1 protein encoded by the OsHPCA1 gene and rich in leucine repeat receptor-like protein kinase can positively regulate and control the activity of catalase C (CatC) in rice and enhance the removal efficiency of H2O2 under salt stress, so that the salt tolerance of rice is improved. When the OsHPCA1 is overexpressed, the activity of CatC in the overexpressed strain OsHPCA1 is obviously increased, the H2O2 removal capability is enhanced, and the salt tolerance and oxidative stress tolerance of the rice are improved.

The invention provides an application of catalase nanoparticles in preparation of a medicine for preventing or treating thrombus. A method for preparing the catalase nanoparticles comprises the following steps: 1) reacting dopamine with melanin to generate melanin modified by the dopamine; 2) preparing catalase with carboxyl activated by EDC; and 3) in the presence of NHS, mixing the melanin modified by dopamine with the catalase with carboxyl activated by EDC, stirring overnight, then adding amino methoxy polyethylene glycol (mPEG-NH2), and continuing to react for 3 hours to obtain a product, namely the melanin-dopamine-catalase nanoparticles. The catalase nanoparticles provided by the invention can maintain the biological activity of melanin and catalase for a long time, and can avoid the risk of bleeding when preventing or treating thrombus.

The invention provides a V2O5-NC nano-enzyme as well as preparation and application thereof. The V2O5-NC nano-enzyme is dark green powder and has a stacked layered structure, the specific surface area is 16-18m < 2 > / g, mesoporous distribution is realized, the average particle size is 20-25nm, and the V2O5-NC nano-enzyme has catalase-like activity. The wide-interlayer-spacing V2O5-NC nano-enzyme based on C-O bond bridging prepared by the invention has relatively good stability, can be prepared on a large scale, is convenient to store, has good affinity to catalytic chromogenic substrates, has high stability, and has universality for the chromogenic reaction of the catalytic chromogenic substrates (TMB, ABTS, DAB and OPD). The V2O5-NC nano-enzyme disclosed by the invention is used for analyzing five organophosphorus pesticides (parathion-methyl, glyphosate, phoxim, methamidophos and chlorpyrifos), has good pesticide recognition capability and interference resistance, and also has the advantages of wide linear range, low detection limit, simplicity and convenience in operation, low detection cost and the like.

The invention relates to a chemiluminescence kit for detecting pepsinogen II. The kit comprises an enzyme marker, a luminescent substrate solution and an anti-interference buffer system, the anti-interference buffer system comprises a nonionic surfactant, animal-derived IgG (immunoglobulin G), an antioxidant and catalase; the chemiluminescence kit also comprises a PG II calibration product and a PG II quality control product. The core active component of the enzyme marker is beta-galactosidase. The enzyme marker further comprises an anti-PG II monoclonal antibody marked by beta-galactosidase, bovine serum albumin, trehalose, cane sugar, MgCl2. 6H2O, sodium chloride, Proclin300 and a phosphate buffer solution. According to the kit, a brand-new anti-interference buffer system is introduced on the basis of a spatial proximity chemiluminescence analysis method, so that the resistance to clinically common interferents (such as hemolysis, lipemia, jaundice and heterotropism antibodies) is remarkably improved, and the detection result is more accurate and reliable.

The invention discloses a hydrogen peroxide sensing electrode, a preparation method thereof, a hydrogen peroxide electrochemical sensor and a monitoring method. The hydrogen peroxide sensing electrode comprises a tube body, the tube body is provided with a first end and a second end, the first end is provided with a first opening, the second end is a tip, the tip is provided with a second opening, the first opening is communicated with the second opening, and the caliber of the second opening is smaller than that of the first opening; the tip is filled with solid hydrogel embedded with catalase, and the aperture of the solid hydrogel is 20-50 nm; the tube body is filled with an electrolyte, and the electrolyte is a solution with ionic conductivity; the electrolyte is in contact with the solid hydrogel. According to the invention, nano confinement hydrogel and electrophoresis-like technologies are combined, oxygen nano bubbles are used as a signal transduction mechanism, ultrasensitive detection of intracellular H2O2 is realized through ionization sensing, and dynamic change of intracellular hydrogen peroxide can be monitored in situ in real time.

The invention belongs to the field of biomedical materials, and discloses a preparation method and application of a mesoporous polydopamine nano preparation loaded with ultra-small nano enzyme. The nano preparation takes mesoporous polydopamine nanoparticles as a carrier skeleton and is combined with ultra-small nano enzyme through an in-situ reaction: the mesoporous polydopamine nanoparticles can efficiently carry drugs and accurately deliver the drugs to inflammatory tissues such as psoriasis, gout, colitis and the like by virtue of a modified targeting ligand by virtue of high specific surface area, biocompatibility and modifiability; the ultra-small nano enzyme has catalytic activity of catalase and the like, and can remove active oxygen and relieve oxidative stress. The two components are combined to achieve a synergistic effect, so that the catalytic efficiency of the enzyme is improved by virtue of the characteristics of the carrier, the high activity of the enzyme under different conditions is maintained by virtue of the stability of the carrier, and the platform can synchronously realize targeted delivery, enzymatic treatment and drug controlled release, and has a wide application prospect in the fields of inflammatory disease intervention and wound repair. And an efficient, accurate and low-toxicity universal treatment strategy is provided for chronic inflammatory diseases.

The invention relates to a hydrogel light-operated multi-mode synergistic treatment platform based on a CuxS-MoS2 heterojunction for promoting wound healing of diabetes mellitus. And an interface induced electric field strategy is provided through density functional theory (DFT) calculation to optimize the charge migration behavior of the phototherapy agent. The multifunctional phototherapy system is constructed by taking CuxS-MoS2 with a built-in electric field as a core and PVA-CS hydrogel loaded with glucose oxidase (GOx) as a bracket. In a weakly acidic wound microenvironment, glucose at the wound is catalyzed by GOx to be converted into H2O2 and gluconic acid; meanwhile, the CuxS-MoS2 remarkably enhances the generation of reactive oxygen species (ROS) under illumination through peroxidase-like (POD) activity, photothermal effect (PTT) and heterojunction efficient carrier separation. After entering a proliferation period, the stent exerts catalase-like (CAT) activity to remove excessive ROS and release oxygen, and oxygen deficit and oxidative stress are relieved. In addition, the controllably released copper ions regulate and control the behavior of fibroblasts, promote healing and inhibit fibrosis. Experiments prove that the stent has excellent biocompatibility, effective antibacterial property and remarkable healing promoting effect in chronic wound repair of diabetes mellitus.

The invention provides a near-infrared light mediated hybrid hydrogel multi-bioactivity synergistic tissue repair promoting material as well as a preparation method and application thereof, and relates to the technical field of biological materials. The method comprises the following steps: 1) dispersing calcium peroxide in a solvent, and adding a 3-hydroxytyramine hydrochloride solution for reaction to obtain CaO2 (at) PDA nanoparticles; enabling the CaO2 (at) PDA nano-particles to react with a catalase solution, so as to obtain ORN oxygen release particles; (2) mixing the ORN oxygen release particles with the surfaces rich in sulfydryl with Se-NPs with the surfaces rich in selenol after reduction treatment under the protection of inert atmosphere to obtain ORN-coated Se composite particles; the preparation method comprises the following steps: dissolving hyaluronic acid methacrylate in deionized water, adding the ORN-coated Se composite particles, uniformly mixing, adding a photoinitiator, and carrying out ultraviolet curing to obtain the ORN-coated Se-HAMA hydrogel which can realize local response oxygen supply on an anoxic wound surface and has antibacterial and antioxidant characteristics.

The invention discloses a compound probiotic fermented fish sauce and a preparation method thereof. The method comprises the following steps: cleaning fish and leftovers, adding distilled water, pulping to obtain fish cream, adding beta-D-glucose, glucose oxidase and catalase into the fish cream, and carrying out primary enzymolysis under stirring; adjusting the pH value of the primary enzymatic hydrolysate to be neutral, adding a compound enzyme to carry out secondary enzymatic hydrolysis, and carrying out enzyme deactivation to obtain a secondary enzymatic hydrolysate; adding table salt to obtain enzymatic hydrolysate; soybean meal, green beans, bran and water are mixed to obtain a koji material, the koji material is cooled to the room temperature after high-pressure sterilization, compound probiotics are inoculated for koji making, mold koji is added into the enzymatic hydrolysate for fermentation, electrodialysis desalination is conducted on fermentation liquor, then high-pressure sterilization is conducted, and the fish sauce is obtained. The fishy smell in the leftovers is removed by adding beta-D-glucose, glucose oxidase and catalase, and then the fishy smell is further degraded through fermentation; the green beans are added into the koji to prepare the koji, so that the fish sauce obtained by fermentation can keep specific fragrance, and the fish sauce product with good flavor and low fishy smell is obtained.

The invention discloses a nano-material-based nitrogen-phosphorus-potassium compound fertilizer as well as a preparation method and application thereof, and belongs to the field of plant nutrition and soil science research. According to the invention, the nano biochar prepared through nano grinding after pyrolysis of the rice straw is directly mixed with three chemical components, namely the urea, the ammonium dihydrogen phosphate and the potassium chloride, and the sodium bentonite, and the key points of the effects are triple effects of promoting early growth and rapid ripening, enhancing tillering and advancing heading. After the nano biochar is matched with balanced NPK nutrition (such as NPK-II), the activity level of soil key enzymes, including catalase (CAT), alkaline phosphatase (AKP), urease (UE), sucrase (SC) and the like, is remarkably improved. Besides, the composite particles are constructed through the cooperation of the nano-charcoal and the bentonite, and a low-temperature drying process is adopted, so that moisture absorption and caking can be inhibited, and the storage stability and field application performance of the fertilizer are remarkably improved.

The invention relates to a nitrogen / sulfur co-doped chiral iron monatomic carbon dot and a preparation method and application thereof.The preparation method of the nitrogen / sulfur co-doped chiral iron monatomic carbon dot comprises the steps that dimethyl formamide, iron phthalocyanine and cysteine serve as raw materials, and a nitrogen / sulfur co-doped chiral iron monatomic carbon dot solution is synthesized in one step through a hydrothermal synthesis method; the preparation method comprises the following steps: firstly preparing an iron monatomic carbon dot, then carrying out chiral amino acid modification on the surface of the iron monatomic carbon dot through an amido bond to enhance the chiral structure characteristic, and finally obtaining nitrogen / sulfur co-doped chiral iron monatomic carbon dot powder through centrifugation, dialysis and freeze drying. The nitrogen / sulfur co-doped chiral iron monatomic carbon dot has high chiral dependence catalytic activity, shows catalase-like activity, photodynamic activity and photo-thermal activity at the same time, and can promote accumulation of free iron in bacterial cells and finally induce ferroptosis of bacteria through chiral regulation and control of activity of Fur, FtnA and other bacterial metal transporters.

The invention relates to a method for relieving continuous cropping obstacles of ginseng and application of the method, and belongs to the technical field of agricultural planting. The method comprises the following specific steps: planting wrinkled gianthyssop herb on a field after ginseng planting, crushing the wrinkled gianthyssop herb, returning the crushed wrinkled gianthyssop herb to the field, and improving soil for subsequent ginseng planting. The method can effectively relieve continuous cropping obstacles of ginseng, increase the content of soil organic matter, nitrogen, phosphorus and potassium, adjust the pH of soil, improve the activity of soil catalase, reduce the activity of sucrase and urease, optimize the microbial community structure of soil, reduce the abundance of pathogenic bacteria and reduce the incidence rate of root rot and rust rot of ginseng; the yield and quality of ginseng are remarkably improved, the ginsenoside content is increased, meanwhile, use of chemical fertilizers and pesticides is reduced, a green and safe planting mode is achieved, and remarkable economic benefits and ecological benefits are achieved.

The invention belongs to the field of rape breeding, and particularly discloses a sclerotinia rot resistance related gene BnaCLE20 of rape and application of the sclerotinia rot resistance related gene BnaCLE20 in rape breeding. The sequence of the BnaCLE20 gene is as shown in SEQ ID NO. 1, and the coded protein is as shown in SEQ ID NO. 2; the BnaCLE20 gene of the brassica napus is identified to be capable of regulating the sclerotinia rot resistance of the brassica napus for the first time, a molecular network for regulating the sclerotinia rot resistance of plants is enriched, and the BnaCLE20 gene plays an important role in researching a molecular mechanism formed by the disease resistance of the plants. The overexpression of the BnaCLE20 gene disclosed by the invention can reduce the content of active oxygen, malondialdehyde and oxalic acid in rape leaves infected by sclerotinia sclerotiorum; meanwhile, the activity of catalase in the rape leaves infected by sclerotinia sclerotiorum is enhanced; the sclerotiniose resistance of the oilseed rape is remarkably improved, and the method has important significance in guaranteeing the high and stable yield of the oilseed rape by improving the sclerotiniose resistance of the oilseed rape.

This invention provides a simple synthesis method for Fe-Ag / CMP nanopolymers with catalase-like activity and their application in hydrogen peroxide detection, belonging to the field of bioanalytical technology. The method of this invention includes the following steps: (1) preparing a 4-hydroxyethylpiperazine thiosulfonic acid (HEPES) standard buffer solution; (2) adding cytidine monophosphate (CMP) to the solution obtained in step (1) and stirring until the CMP is fully dissolved. Then, under vigorous stirring, ferric nitrate aqueous solution and silver nitrate aqueous solution are added sequentially, at which point the colorless solution turns pale yellow; (3) transferring the mixed solution obtained in step (2) to a centrifuge tube, centrifuging at 12000 rpm for 8 min to collect the precipitate, washing it three times with distilled water, and finally adding 4 mL of distilled water to obtain a 1 mg / mL Fe-Ag / CMP suspension. This invention utilizes CMP as a biological ligand and Ag... + Fe 3+ Simultaneous coordination, and the reducing amino groups on CMP can directly transfer Ag... + In situ reduction to silver nanoparticles (AgNPs) led to the one-step synthesis of a bimetallic Fe-Ag / CMP nanopolymer with hydrogen peroxide-like nanozyme activity, enabling the detection of hydrogen peroxide.

The application discloses a kind of cultivation methods of konjak, belong to konjak planting technical field, the present application is to the pretreatment konjak seed potato of sterilization in nitrogen and ozone mixed atmosphere steam treatment, not only strengthen the growth potential of konjak seed potato, and fully activated the catalase in seed potato, create excellent intracellular environment for promoting subsequent seed potato germination, heat shock seed potato is soaked in activation liquid and activated, brassinolide, calcium sulfate, ethiofencarb and sodium complex nitrophenol in activation liquid activate the cytokinin oxidase in cell, and then regulate seed potato germination speed and germination quality, effectively solve the problem of low seedling rate of offspring konjak and yield decline.The activation seed potato is sowed in nutrient soil, effectively improves the content of nutrient substance in harvested konjak.

This invention belongs to the fields of biotechnology and genetic engineering, and relates to a dual-enzyme fusion protein resistant to hydrogen peroxide inhibition, a polynucleotide, an expression vector, and its applications. The dual-enzyme fusion protein is composed of a glutamate oxidase mutant, a catalase mutant, and a linker peptide; the amino acid sequences of the glutamate oxidase mutant and the catalase mutant are shown in SEQ ID NO. 2 and 4, respectively, in the sequence listing. This invention improves the performance of single enzymes through enzyme molecule modification, achieves spatial synergy through fusion protein design, and enables industrial application through a continuous reaction process; it fundamentally solves the problem of hydrogen peroxide's inhibition of glutamate oxidase products; and the fusion expression simultaneously improves the stability and reusability of the dual enzymes.

The invention discloses a double-drug-loading cationic mixed micelle as well as a preparation method and application thereof, and belongs to the field of pharmaceutics. The micelle is composed of a cationic polymer PEI-stearamide (PSA), an amphiphilic polymer DSPE-PEG2000, a hydrophobic drug resveratrol (RES) and a hydrophilic drug catalase (CAT). The preparation method comprises the following steps: 1) synthesizing PSA; the preparation method comprises 1, dissolving RES, PSA and DSPE-PEG2000 in an organic phase, injecting the obtained solution into a water phase, and carrying out rotary evaporation to obtain RES-loaded micelle (RES / PSA-PEG), and 3, adding a CAT solution to the micelle solution in a dropwise manner to obtain co-loaded micelle (RES / PSA-PEG / CAT). The micelle can effectively penetrate a corneal barrier and target a retinal pigment epithelial layer and a choroidal membrane.Through eye drop administration, RES anti-oxidation and anti-inflammatory effects and CAT hydrogen peroxide removal effects can be synergistically exerted, and an AMD curative effect can be substantially enhanced.

The invention provides dewaxing, repairing and blocking integrated liquid and application thereof in a pathological specimen immunohistochemical operation method. The dewaxing, repairing and blocking integrated liquid is prepared from the following components in percentage by mass: 1.0 to 5.0 percent of Triton-100, 1.0 to 5.0 percent of Tween 20, 0.1 to 3.0 percent of fatty acid methyl ester ethoxylate, 0.1 to 1.0 percent of tetrahydrofurfuryl alcohol, 0.001 to 0.01 percent of 2-methyl-3-isothiazolinone, 0.01 to 4.0 percent of buffer solution and the balance of water. In the process of applying the dewaxing, repairing and blocking integrated body fluid to the pathological specimen immunohistochemical operation method, compared with an existing laboratory method, the dewaxing, repairing and blocking integrated body fluid is used at the temperature of 65-75 DEG C, the steps of xylene dewaxing and gradient alcohol hydration after dewaxing in an existing laboratory can be replaced, the temperature continues to rise to 95-99 DEG C, and when antigen repairing is conducted on a sample, the temperature of the sample is lowered to 95-99 DEG C; according to the method, the step of blocking 0.3-3% of hydrogen peroxide in an existing laboratory is replaced by the enzyme activity of high temperature on endogenous catalase, and the same effects of dewaxing, repairing and blocking in the existing laboratory are achieved on the basis of reducing the experimental steps and the experimental time.

This invention relates to the field of oral care products technology, specifically to an artificial enzyme with antibacterial properties, its preparation method, and its application. This technical solution employs a chemical reduction method, where a palladium source reacts in an environment containing surfactants and reducing agents to obtain palladium nanozymes. The obtained palladium nanozymes exhibit uniform morphology, controllable particle size, good dispersibility in water, and good biocompatibility; they have no significant toxic side effects on human gingival fibroblasts, possess highly efficient catalase activity, and demonstrate strong antibacterial and bactericidal effects against oral pathogens, significantly reducing bacterial drug resistance; they can inhibit acid production by oral bacteria, preventing tooth decay; and they retain their original catalytic activity even after multiple cycles of use. Applying the palladium nanozymes of this solution to the manufacture of oral care products can solve the technical problems of unsatisfactory safety and easy development of drug resistance in existing oral care products using antibacterial and anti-caries methods, showing promising application prospects.

The present invention belongs to the technical field of material preparation and application, and discloses a nano-spherical porous copper porphyrin, a preparation method thereof and uses thereof. The present invention uses gallium black phosphorus as a template to drive the coordination of 5,10,15,20-tetrakis(4-aminophenyl)porphyrin and terephthaloyl chloride to induce the directional formation of nano-porous copper porphyrin with gallium black phosphorus as the core; the nano-porous copper porphyrin material prepared by the present invention is a porous sphere, and has excellent photodynamic, chemical kinetic and photothermal properties. Under dark conditions, it has the characteristics of catalase and catalyzes the production of hydroxyl radicals from hydrogen peroxide; under red light irradiation, it can continuously generate singlet oxygen; under near-infrared light irradiation, it has good photothermal properties, and this material is expected to be applied to the treatment of drug-resistant bacterial infections.

The present disclosure provides an application of a composite nanozyme material in a tumor dual-targeted drug delivery system. The composite nanozyme material is used in the preparation of an anti-tumor injection or an implantable medicament. The composite nanozyme material has peroxidase-like activity, catalase-like activity, and glutathione oxidase-like activity. The application method includes: using the composite nanozyme material as a contrast agent to determine the location of the tumor by magnetic resonance; setting a magnetic field at the location of the tumor and injecting an injection or a medicament containing the composite nanozyme material. The present invention first uses a magnetic composite nanozyme material as a MIR contrast agent to determine the location of the tumor by magnetic resonance technology, and further utilizes the biological activity targeting of the composite nanozyme and the physical magnetic targeting of the external magnetic field of the tumor tissue to achieve the specific release of the chemotherapy drug functional molecule at the target site.

The application discloses a method for promoting growth of cymbidium on a steel slag flat bed based on microbial organic matrix, and belongs to the technical field of steel slag resource utilization. The application inoculates eight kinds of bacillus agents with different concentrations on the bacterial residue to prepare the organic matrix, and then covers the matrix on the converter slag to promote the growth of cymbidium on the converter slag, and selects the bacillus strain with the best growth promotion effect and the most suitable inoculation concentration. The results show that after being inoculated with bacillus megaterium, bacillus polymyxa and bacillus mucilaginosus, the sucrose activity of the soil is enhanced; the hydrogen peroxide activity of the soil in the four groups of treatments inoculated with the bacillus agent is stronger than that in the control group; the application of the bacillus megaterium, bacillus polymyxa and bacillus mucilaginosus enhances the urease activity in the soil; the inoculation of the bacillus megaterium promotes the release of Ca and P elements in the soil and the absorption of Ca, P, Mg, Mn and Si elements by the plant.