398 results about "Catalase" patented technology

The invention relates to the technical field of biocatalysts, in particular to a FeCo-NC bimetallic monatomic nano-enzyme as well as a preparation method and application thereof. The preparation method of the nano enzyme comprises the following steps: preparing Co-ZIF-8 from zinc nitrate, cobalt nitrate and 2-methylimidazole; the Co-ZIF-8 and ferric chloride are used for preparing the FeCo-NC bimetallic monatomic nano-enzyme, the molar ratio of the zinc nitrate to the cobalt nitrate is (20-30): 1, and the molar ratio of the cobalt nitrate to the ferric chloride is (2-6): 1. The nano-enzyme prepared by the embodiment of the invention is of a monatomic structure, has double-enzyme activity, can simultaneously simulate catalase and NADH oxidase, and has the capability of removing active oxygen.

The invention discloses a glucose response type insulin delivery system as well as a preparation method and application thereof, and belongs to the technical field of biological materials. The glucose response type insulin delivery system provided by the invention comprises a delivery carrier and a bioactive component encapsulated in the carrier, the delivery carrier is a metal polyphenol network formed by carrying out coordination reaction on epigallocatechin gallate and metal ions; the bioactive components comprise glucose oxidase, catalase and insulin. The glucose response type insulin delivery system provided by the invention can adjust the release of insulin according to the concentration of glucose in the surrounding environment, so that the blood glucose is maintained at a normal level.

The invention discloses a metal-doped carbon quantum dot as well as preparation and application of the metal-doped carbon quantum dot in a nano antibacterial agent, citric acid, urea and tea polyphenol are taken as precursors, metal salt is added, carbon dot synthesis and metal ion doping are synchronously completed in one step through a hydrothermal method, and the metal-doped carbon quantum dot is prepared; the surfaces of the metal-doped carbon quantum dots are negatively charged, and the metal-doped carbon quantum dots have peroxidase-like activity and catalase-like activity at the same time; the metal ions adopt any one of Fe < 3 + >, Cu < 2 + > and Ce < 3 + >; the metal-doped carbon quantum dots are in a sphere-like shape. The metal-doped carbon quantum dots prepared by the preparation method disclosed by the invention have peroxidase-like activity and catalase-like activity at the same time through precise doping of metal ions, and the two activities have a synergistic effect in an oral periodontitis microenvironment, so that a good antibacterial effect is achieved.

The invention discloses a drug-loaded liposome nano-particle, a preparation method thereof and application of the drug-loaded liposome nano-particle in treatment of brain glioma, and belongs to the technical field of biological nano-medicines. The invention provides a novel copper phthalocyanine derivative and catalase co-loaded lipidosome nanoparticle and application of the novel copper phthalocyanine derivative and catalase co-loaded lipidosome nanoparticle to treatment of brain glioma on the cellular level. The nano-particles are obtained by wrapping copper phthalocyanine derivatives and catalase with lipidosome prepared by a microfluidic method. The co-drug-loaded liposome can catalyze excessive H2O2 in brain glioma to generate oxygen, and O2 is continuously supplied to photodynamic therapy (PDT) to generate active oxygen; meanwhile, Cu < 2 + > can deplete glutathione and improve the oxidative stress level in the glioma, the reduction product Cu < + > can convert H2O2 into hydroxyl radicals with higher toxicity through a Fenton-like reaction, oxidative stress injury is doubly amplified, cascade cooperation of PDT and chemical dynamic therapy (CDT) is achieved, and the treatment effect on the glioma is remarkably enhanced.

The invention discloses a comprehensive prevention and control method for tobacco root knot nematode disease containing a biological agent. The method comprises the steps of crop rotation of tobacco and buckwheat / quinoa, host resistance induction of the microbial agent in the seedling raising period, tobacco planting soil quality improvement in the transplanting period and the like. The agronomic characters of tobacco seedlings are effectively improved, and the physical characters of soil are improved; the chemical properties of soil pH, alkali-hydrolyzable nitrogen, available phosphorus, quick-acting potassium, exchangeable calcium, exchangeable magnesium and the like are improved; the activity of soil urease, sucrase, acid phosphatase, catalase and peroxidase is improved; the content of water-soluble phenols, compound phenols and total phenols in soil is reduced; the disease index of the tobacco root knot nematode disease can be remarkably reduced, the survival rate of tobacco is increased, the application amount of chemical agents is reduced, and the healthy and sustainable development of the tobacco industry is promoted.

The invention relates to the technical field of saline-alkali soil improvement and microorganisms, in particular to bacillus pumilus S3-9 and application thereof. The bacillus pumilus S3-9 is preserved in the China General Microbiological Culture Collection Center on December 19, 2024, and the preservation number of the bacillus pumilus S3-9 is CGMCC (China General Microbiological Culture Collection Center) No. 33120. The bacillus pumilus S3-9 provided by the invention has the effects of reducing salinity in saline-alkali soil, increasing nutrients of the saline-alkali soil and improving the diversity and stability of rhizosphere microbial communities of the saline-alkali soil, and can be applied to improving soil fertility, promoting nutrient circulation, improving soil quality, relieving soil salinization and the like. The strain can also be used for increasing the yield of sweet sorghum in saline-alkali land, has a remarkable growth promoting effect on plant height, overground part fresh weight and underground part fresh weight, can effectively improve the K < + > / Na < + > ratio, chlorophyll content, superoxide dismutase activity and catalase activity, and is beneficial to enhancing the adaptive capacity of plants to salt stress.

The invention discloses a serum-free culture medium for in-vitro proliferation of poultry muscle stem cells and application of the serum-free culture medium, and belongs to the technical field of cell engineering, a basic serum-free culture medium is DMEM-F12, a complete serum culture medium is a mixture of DMEM-F12 added with 10% of fetal calf serum and 1% of mycillin, and the volume ratio of a culture medium supplement to the basic culture medium is 1: 1000; the serum-free culture medium contains a supplement; the supplement comprises the following compositions: insulin, transferrin, fibroblast growth factor 2, epidermal growth factor, catalase, ethanolamine, vitamin B12, linoleic acid, linolenic acid, retinol acetate, tocopherol, L-alanine, L-proline, sodium selenite, sodium pyruvate, reduced glutathione, berberine hydrochloride and analogues thereof.

The invention discloses a continuous cropping Chinese cabbage planting method based on a microbial agent and application, and belongs to the technical field of crop cultivation. According to the planting method, Chinese cabbage and garlic are intercropped according to the ratio of 1: 1, and a trichoderma harzianum agent is applied. Results show that the planting method can significantly increase the growth indexes such as the plant height, the root length, the leaf chlorophyll content and the soluble sugar content of the Chinese cabbage; the soluble protein content, the peroxidase activity, the superoxide dismutase activity and the malondialdehyde content of the Chinese cabbage leaves are obviously reduced. Meanwhile, the content of rapidly available phosphorus, rapidly available potassium, effective calcium and other substances in the soil can be increased; the activities of urease, catalase and alkaline phosphatase in the soil are also obviously improved. In addition, the number of fungi, bacteria and actinomycetes in the soil is also remarkably increased. Therefore, according to the planting method, the quality of continuous cropping soil can be improved, Chinese cabbage growth is promoted, and theoretical support is provided for healthy and sustainable development of the Chinese cabbage industry.

The invention provides a plasmid, an alpha-ketoglutaric acid engineering strain and a construction method and application of the alpha-ketoglutaric acid engineering strain, the strain is obtained by adopting a directional transformation method, transcriptional levels of katE, katG, sodB and grxA genes are up-regulated, a catR gene and a katA gene are heterologously expressed, a high-copy plasmid pETKG is carried, and the plasmid simultaneously expresses L-glutamate oxidase LGOX genes from Streptomyces sp and Chain A; the strain self-synthesized catalase eliminates H2O2 generated in the process of producing alpha-ketoglutaric acid through enzyme catalysis, engineering bacteria of L-glutamate oxidase LGOX expressed by pETKG plasmids are used for performing whole-cell catalysis on L-sodium glutamate to synthesize alpha-ketoglutaric acid, and the engineering strain is a high-level engineering strain capable of industrially and stably producing alpha-ketoglutaric acid.

The invention belongs to the field of nano-medicine and traditional Chinese medicine, and particularly discloses an antioxidant nano-material based on self-assembly of traditional Chinese medicine and copper ions and a preparation method thereof.The nano-material is prepared from BPCu nano-particles formed by self-assembly of berberine and procyanidine B2 under induction of the copper ions, the BPCu nano-particles are further subjected to surface modification through polyvinylpyrrolidone, and the antioxidant nano-material is prepared. And the stably dispersed PVP-coated BPCu nano structure is obtained. The material is small in particle size, uniform in distribution, good in water solubility and storage stability, excellent in free radical scavenging capacity and catalase-like activity and suitable for adjuvant therapy of oxidative stress related diseases, and the preparation method is easy and convenient to operate, does not need an organic solvent and has good industrialization and disease treatment potential.

The invention discloses bacillus orientalis, a microbial agent and application of the bacillus orientalis and the microbial agent, the bacillus orientalis is named as bacillus orientalis Jiang8 and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO. 33084, and the preservation time is December 16, 2024. The bacillus orientalis screened and identified by the invention has good saline-alkaline tolerance and strong stress resistance; besides, the strain disclosed by the invention not only can secrete extracellular polymeric substances and catalase in a saline-alkali environment, but also can fix nitrogen and dissolve phosphorus (converting insoluble phosphorus into water-soluble phosphorus), provides nutrition for crops, further promotes growth and development of the crops, and provides a new thought for ecological management of saline-alkali soil.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention discloses an AuAgPt ternary alloy nano-framework, a preparation method thereof and application of the AuAgPt ternary alloy nano-framework in anti-tumor preparations, and belongs to the field of biomedical nano-materials. The AuAgPt ternary alloy nano frame is a hollow octahedral nano frame formed by 12 AuAgPt ternary alloy edges, and the nano frame has plasmon photothermal conversion performance, catalase activity and peroxidase-like activity, and can be used for preparing the nano frame. The aptamer has the characteristics that the aptamer can form a covalent bond with glutathione (GSH), the aptamer with the framework surface capable of being modified and specifically bound with tumor cells is used for tumor targeted delivery and the like, the aptamer can be bound in a targeted manner and internalized into the tumor cells, and after near-infrared laser irradiation, the cell temperature can be increased to 42 DEG C, reactive oxygen species (ROS) can be generated, GSH can be consumed, and the tumor targeting effect is achieved. In addition, the content change of small molecule metabolites in cells can be driven through a low-temperature photothermal effect, the metabolic state is disturbed, the redox balance in the cells is destroyed, the tumor cells are induced to generate ferroptosis and apoptosis, and the low-temperature photothermal treatment of tumors is realized.

The invention belongs to the field of plant genetic engineering, and discloses a key gene OsHPCA1 for positively regulating salt stress and oxidative stress tolerance of rice. The gene (with the login number of Os05g40770) encodes a receptor protein capable of specifically sensing hydrogen peroxide, and belongs to a leucine repeat receptor-like protein kinase (LRR-RLKs) family, wherein the family is the largest subfamily in the receptor-like protein kinase (RLKs). The OsHPCA1 responds to salt and oxidative stress signals, and the salt tolerance and oxidative stress resistance of the rice are positively regulated and responded. The OsHPCA1 overexpression rice strain shows very strong salt tolerance; and the OsHPCA1 knockout strain oshpca1 is more sensitive to salt stress. The OsHPCA1 protein encoded by the OsHPCA1 gene and rich in leucine repeat receptor-like protein kinase can positively regulate and control the activity of catalase C (CatC) in rice and enhance the removal efficiency of H2O2 under salt stress, so that the salt tolerance of rice is improved. When the OsHPCA1 is overexpressed, the activity of CatC in the overexpressed strain OsHPCA1 is obviously increased, the H2O2 removal capability is enhanced, and the salt tolerance and oxidative stress tolerance of the rice are improved.

The invention relates to a preparation method of a high-solid low-viscosity peach gum solution for gouache. The preparation method is characterized by comprising the following steps: (1) soaking solid peach gum in water; (2) adding a hydrogen peroxide solution until the pH value is 6-7, heating, and stirring until the solid peach gum is completely dissolved to obtain a first treatment solution; (3) adding a sodium hydroxide solution into the first treatment solution to obtain a second treatment solution; (4) adding a hydrogen peroxide solution into the second treatment solution, stirring and bleaching, and then removing impurities through precipitation to obtain a third treatment solution; (5) cooling the third treatment liquid to 30-60 DEG C, then adding catalase into the third treatment liquid, uniformly stirring, and removing redundant hydrogen peroxide; and (6) settling, and taking an upper-layer solution, thereby obtaining the high-solid low-viscosity peach gum solution for gouache. When the peach gum solution with high concentration and moderate viscosity is applied to gouache, the hand feeling of drawing is good.

The invention relates to a pH-responsive copper hydrogen phosphate-loaded hydrogel with multiple enzyme-like activities and a preparation method and application thereof. The material mainly shows catalase-like activity in a neutral microenvironment, and can remove H2O2 and relieve oxidative stress; in a weakly acidic microenvironment, the compound mainly shows peroxidase-like activity and catalyzes H2O2 to generate. OH bacteria with higher toxicity; meanwhile, the inherent osteogenesis promoting performance of copper synergistically enhances bone regeneration, the biocompatibility, the oxidation resistance, the osteogenesis promoting capacity under the oxidative stress condition and the antibacterial efficiency under the weak acid condition of the SA / CuHP hydrogel are evaluated through in-vitro experiments, and a type II diabetes rat periodontitis model is established; the in-vivo antibacterial and osteogenesis promoting effects and the biological safety performance of the compound are verified, and a new strategy is provided for treatment of periodontitis with diabetes mellitus.

The invention provides an application of catalase nanoparticles in preparation of a medicine for preventing or treating thrombus. A method for preparing the catalase nanoparticles comprises the following steps: 1) reacting dopamine with melanin to generate melanin modified by the dopamine; 2) preparing catalase with carboxyl activated by EDC; and 3) in the presence of NHS, mixing the melanin modified by dopamine with the catalase with carboxyl activated by EDC, stirring overnight, then adding amino methoxy polyethylene glycol (mPEG-NH2), and continuing to react for 3 hours to obtain a product, namely the melanin-dopamine-catalase nanoparticles. The catalase nanoparticles provided by the invention can maintain the biological activity of melanin and catalase for a long time, and can avoid the risk of bleeding when preventing or treating thrombus.

The invention provides a V2O5-NC nano-enzyme as well as preparation and application thereof. The V2O5-NC nano-enzyme is dark green powder and has a stacked layered structure, the specific surface area is 16-18m < 2 > / g, mesoporous distribution is realized, the average particle size is 20-25nm, and the V2O5-NC nano-enzyme has catalase-like activity. The wide-interlayer-spacing V2O5-NC nano-enzyme based on C-O bond bridging prepared by the invention has relatively good stability, can be prepared on a large scale, is convenient to store, has good affinity to catalytic chromogenic substrates, has high stability, and has universality for the chromogenic reaction of the catalytic chromogenic substrates (TMB, ABTS, DAB and OPD). The V2O5-NC nano-enzyme disclosed by the invention is used for analyzing five organophosphorus pesticides (parathion-methyl, glyphosate, phoxim, methamidophos and chlorpyrifos), has good pesticide recognition capability and interference resistance, and also has the advantages of wide linear range, low detection limit, simplicity and convenience in operation, low detection cost and the like.

The invention discloses candida tropicalis engineering bacteria for high yield of (-)-alpha-bisabolol and a construction method of the candida tropicalis engineering bacteria, and belongs to the technical field of microorganisms. According to the invention, chassis cell candida tropicalis DC04-WG04-2 is constructed, a gene Cat2 of catalase derived from saccharomyces cerevisiae and a gene ERG10 of 3-hydroxy-3-methylglutaryl coenzyme A reductase are expressed on the basis of the chassis cell candida tropicalis DC04-WG04-2, and a PEX15 motif is anchored on the surface of peroxisome for co-expression; the genes ADH1, GPD1 and GPD2 are further knocked out, so that the accumulation of ethanol is reduced, and the generation of glycerol is reduced. According to the method disclosed by the invention, the yield of the (-)-alpha-bisabolol of the recombinant candida tropicalis reaches 461.7 mg / L by optimizing fermentation conditions. The preparation method has the characteristics of low cost, high efficiency, simplicity in operation, wide prospect and the like.

The invention discloses hydrogel based on a self-adaptive biological catalysis system, a preparation method and application of the hydrogel as a diabetes wound dressing, and the preparation method of the hydrogel comprises the following steps: weighing oxidized sodium alginate, adding the oxidized sodium alginate into ultrapure water for dissolving, adding gelatin, glucose oxidase and catalase, uniformly stirring to obtain a gel solution, and carrying out freeze drying on the gel solution to obtain the hydrogel. And heating, preserving heat and standing until the gel is formed. Oxidized sodium alginate (OSA) and gelatin (GEL) are coupled to generate pH-sensitive Schiff base bond crosslinking, glucose oxidase (GOx) and catalase (CAT) are loaded in the pH-sensitive Schiff base bond crosslinking, and dynamic gel capable of interacting with the environment is prepared; the hydrogel can interact with the micro-environment (pH, glucose and the like) of the chronic wound surface of the diabetes mellitus, and can be used as a micro-environment adaptive and adjustable dressing for treating the wound surface of the diabetes mellitus.

The invention relates to a chemiluminescence kit for detecting pepsinogen II. The kit comprises an enzyme marker, a luminescent substrate solution and an anti-interference buffer system, the anti-interference buffer system comprises a nonionic surfactant, animal-derived IgG (immunoglobulin G), an antioxidant and catalase; the chemiluminescence kit also comprises a PG II calibration product and a PG II quality control product. The core active component of the enzyme marker is beta-galactosidase. The enzyme marker further comprises an anti-PG II monoclonal antibody marked by beta-galactosidase, bovine serum albumin, trehalose, cane sugar, MgCl2. 6H2O, sodium chloride, Proclin300 and a phosphate buffer solution. According to the kit, a brand-new anti-interference buffer system is introduced on the basis of a spatial proximity chemiluminescence analysis method, so that the resistance to clinically common interferents (such as hemolysis, lipemia, jaundice and heterotropism antibodies) is remarkably improved, and the detection result is more accurate and reliable.

According to the method for prolonging the fresh-keeping period of the fruits by using the controlled atmosphere fresh-keeping box, the controlled atmosphere fresh-keeping box is prepared by improving the sealing performance of a common fresh-keeping box and covering a certain area of the common fresh-keeping box with a film, and the fruits are put into the box to be stored. When the area of the covering film is 20%, the lotus seeds are stored in a box, and 1-methylcyclopropene can be added; when the area of the covering film is 34.8%, the longan is placed in a box to be stored. Compared with the control, the modified atmosphere preservation box treatment can reduce the weight loss rate and browning degree of the lotus seeds and maintain the contents of Vc, amylose, total phenols and soluble solids; compared with a control group, the modified atmosphere preservation box treatment can inhibit browning of longan peel, delay reduction of soluble solids, acidity and vitamin C, inhibit increase of malondialdehyde content, reduce peroxidase activity and improve catalase activity and glutathione content. According to the technology, the shelf life of the fruits can be effectively prolonged, and the problems that an existing fresh-keeping method is tedious and short in fresh-keeping period are solved.

The invention discloses a hydrogen peroxide sensing electrode, a preparation method thereof, a hydrogen peroxide electrochemical sensor and a monitoring method. The hydrogen peroxide sensing electrode comprises a tube body, the tube body is provided with a first end and a second end, the first end is provided with a first opening, the second end is a tip, the tip is provided with a second opening, the first opening is communicated with the second opening, and the caliber of the second opening is smaller than that of the first opening; the tip is filled with solid hydrogel embedded with catalase, and the aperture of the solid hydrogel is 20-50 nm; the tube body is filled with an electrolyte, and the electrolyte is a solution with ionic conductivity; the electrolyte is in contact with the solid hydrogel. According to the invention, nano confinement hydrogel and electrophoresis-like technologies are combined, oxygen nano bubbles are used as a signal transduction mechanism, ultrasensitive detection of intracellular H2O2 is realized through ionization sensing, and dynamic change of intracellular hydrogen peroxide can be monitored in situ in real time.

The invention belongs to the field of biomedical materials, and discloses a preparation method and application of a mesoporous polydopamine nano preparation loaded with ultra-small nano enzyme. The nano preparation takes mesoporous polydopamine nanoparticles as a carrier skeleton and is combined with ultra-small nano enzyme through an in-situ reaction: the mesoporous polydopamine nanoparticles can efficiently carry drugs and accurately deliver the drugs to inflammatory tissues such as psoriasis, gout, colitis and the like by virtue of a modified targeting ligand by virtue of high specific surface area, biocompatibility and modifiability; the ultra-small nano enzyme has catalytic activity of catalase and the like, and can remove active oxygen and relieve oxidative stress. The two components are combined to achieve a synergistic effect, so that the catalytic efficiency of the enzyme is improved by virtue of the characteristics of the carrier, the high activity of the enzyme under different conditions is maintained by virtue of the stability of the carrier, and the platform can synchronously realize targeted delivery, enzymatic treatment and drug controlled release, and has a wide application prospect in the fields of inflammatory disease intervention and wound repair. And an efficient, accurate and low-toxicity universal treatment strategy is provided for chronic inflammatory diseases.

The invention relates to the technical field of plasmalogen, and discloses a preparation method and application of an amide plasmalogen compound, and the preparation method comprises the following steps: (1) reacting a compound 1 and a compound 2 in an HEPES buffer solution to obtain a compound 3; (2) reacting the compound 3 in an ethyl acetate phase and a water phase by using phospholipase D under the assistance of Ca < 2 + > ions to obtain a compound 4; (3) expression and purification of CarF protein from myxobacteria; and (4) reacting the compound 4 and CarF protein in a Tris-HCl buffer solution under the assistance of NADH (Nicotinamide Adenine Dinucleotide) and catalase to obtain a compound 5. According to the invention, the purified recombinant myxobacteria CarF protein and the chemically synthesized CarF protein reaction substrate are adopted to finally synthesize the amide plasmalogen, and the amide plasmalogen can show the effect similar to that of natural plasmalogen.

The invention relates to a hydrogel light-operated multi-mode synergistic treatment platform based on a CuxS-MoS2 heterojunction for promoting wound healing of diabetes mellitus. And an interface induced electric field strategy is provided through density functional theory (DFT) calculation to optimize the charge migration behavior of the phototherapy agent. The multifunctional phototherapy system is constructed by taking CuxS-MoS2 with a built-in electric field as a core and PVA-CS hydrogel loaded with glucose oxidase (GOx) as a bracket. In a weakly acidic wound microenvironment, glucose at the wound is catalyzed by GOx to be converted into H2O2 and gluconic acid; meanwhile, the CuxS-MoS2 remarkably enhances the generation of reactive oxygen species (ROS) under illumination through peroxidase-like (POD) activity, photothermal effect (PTT) and heterojunction efficient carrier separation. After entering a proliferation period, the stent exerts catalase-like (CAT) activity to remove excessive ROS and release oxygen, and oxygen deficit and oxidative stress are relieved. In addition, the controllably released copper ions regulate and control the behavior of fibroblasts, promote healing and inhibit fibrosis. Experiments prove that the stent has excellent biocompatibility, effective antibacterial property and remarkable healing promoting effect in chronic wound repair of diabetes mellitus.

The invention provides a near-infrared light mediated hybrid hydrogel multi-bioactivity synergistic tissue repair promoting material as well as a preparation method and application thereof, and relates to the technical field of biological materials. The method comprises the following steps: 1) dispersing calcium peroxide in a solvent, and adding a 3-hydroxytyramine hydrochloride solution for reaction to obtain CaO2 (at) PDA nanoparticles; enabling the CaO2 (at) PDA nano-particles to react with a catalase solution, so as to obtain ORN oxygen release particles; (2) mixing the ORN oxygen release particles with the surfaces rich in sulfydryl with Se-NPs with the surfaces rich in selenol after reduction treatment under the protection of inert atmosphere to obtain ORN-coated Se composite particles; the preparation method comprises the following steps: dissolving hyaluronic acid methacrylate in deionized water, adding the ORN-coated Se composite particles, uniformly mixing, adding a photoinitiator, and carrying out ultraviolet curing to obtain the ORN-coated Se-HAMA hydrogel which can realize local response oxygen supply on an anoxic wound surface and has antibacterial and antioxidant characteristics.

The invention discloses a compound probiotic fermented fish sauce and a preparation method thereof. The method comprises the following steps: cleaning fish and leftovers, adding distilled water, pulping to obtain fish cream, adding beta-D-glucose, glucose oxidase and catalase into the fish cream, and carrying out primary enzymolysis under stirring; adjusting the pH value of the primary enzymatic hydrolysate to be neutral, adding a compound enzyme to carry out secondary enzymatic hydrolysis, and carrying out enzyme deactivation to obtain a secondary enzymatic hydrolysate; adding table salt to obtain enzymatic hydrolysate; soybean meal, green beans, bran and water are mixed to obtain a koji material, the koji material is cooled to the room temperature after high-pressure sterilization, compound probiotics are inoculated for koji making, mold koji is added into the enzymatic hydrolysate for fermentation, electrodialysis desalination is conducted on fermentation liquor, then high-pressure sterilization is conducted, and the fish sauce is obtained. The fishy smell in the leftovers is removed by adding beta-D-glucose, glucose oxidase and catalase, and then the fishy smell is further degraded through fermentation; the green beans are added into the koji to prepare the koji, so that the fish sauce obtained by fermentation can keep specific fragrance, and the fish sauce product with good flavor and low fishy smell is obtained.

The invention discloses a nano-material-based nitrogen-phosphorus-potassium compound fertilizer as well as a preparation method and application thereof, and belongs to the field of plant nutrition and soil science research. According to the invention, the nano biochar prepared through nano grinding after pyrolysis of the rice straw is directly mixed with three chemical components, namely the urea, the ammonium dihydrogen phosphate and the potassium chloride, and the sodium bentonite, and the key points of the effects are triple effects of promoting early growth and rapid ripening, enhancing tillering and advancing heading. After the nano biochar is matched with balanced NPK nutrition (such as NPK-II), the activity level of soil key enzymes, including catalase (CAT), alkaline phosphatase (AKP), urease (UE), sucrase (SC) and the like, is remarkably improved. Besides, the composite particles are constructed through the cooperation of the nano-charcoal and the bentonite, and a low-temperature drying process is adopted, so that moisture absorption and caking can be inhibited, and the storage stability and field application performance of the fertilizer are remarkably improved.

The invention relates to a nitrogen / sulfur co-doped chiral iron monatomic carbon dot and a preparation method and application thereof.The preparation method of the nitrogen / sulfur co-doped chiral iron monatomic carbon dot comprises the steps that dimethyl formamide, iron phthalocyanine and cysteine serve as raw materials, and a nitrogen / sulfur co-doped chiral iron monatomic carbon dot solution is synthesized in one step through a hydrothermal synthesis method; the preparation method comprises the following steps: firstly preparing an iron monatomic carbon dot, then carrying out chiral amino acid modification on the surface of the iron monatomic carbon dot through an amido bond to enhance the chiral structure characteristic, and finally obtaining nitrogen / sulfur co-doped chiral iron monatomic carbon dot powder through centrifugation, dialysis and freeze drying. The nitrogen / sulfur co-doped chiral iron monatomic carbon dot has high chiral dependence catalytic activity, shows catalase-like activity, photodynamic activity and photo-thermal activity at the same time, and can promote accumulation of free iron in bacterial cells and finally induce ferroptosis of bacteria through chiral regulation and control of activity of Fur, FtnA and other bacterial metal transporters.