1517 results about "Drought resistance" patented technology

The invention relates to the technical field of agricultural micro-ecological application, and discloses a method for improving the growth and drought resistance of oats by using arbuscular mycorrhizal fungi, the arbuscular mycorrhizal fungi having a close symbiotic relationship with the oats are selectively utilized, and the symbiotic relationship between the arbuscular mycorrhizal fungi and the oats is established in a condition control mode. Oat growth is promoted, and drought adaptability is improved. The AM fungi used in the method are selected from rhizosporidium intraradices or glomus mosseae, corn or trifolium repens is taken as a host, the two AM fungi are propagated in a propagation medium respectively, then two arbuscular mycorrhizal fungi inoculants and oat are co-cultured in a symbiotic culture medium respectively, and the two arbuscular mycorrhizal fungi inoculants and oat are co-cultured in a symbiotic culture medium respectively. An effective way for improving beneficial symbiosis of AM fungi and hosts under adverse conditions is provided, the infection symbiosis relation of the AM fungi to host plants is improved manually, and the yield of dry land oats is increased.

The invention discloses an application of a GHERF114 gene in regulating and controlling salt stress tolerance and drought stress tolerance of a plant. The ID (Identity) of the gene is GHA05G2445. According to the invention, an arabidopsis thaliana homozygous line over-expressing the GHERF114 gene is obtained through a transgenic technology; through phenotypic change after salt stress treatment and drought stress treatment, leaf wilting degree, rosette leaf size and form comparison, in-vitro leaf water loss rate, leaf relative water content, chlorophyll content and the like verification, it is indicated that the tolerance of transgenic arabidopsis thaliana to salt stress and drought stress is remarkably reduced, and a TRV: GHERF114 gene silent plant is obtained through a VIGS technology; compared with a control group after salt stress and drought stress treatment, the salt tolerance and the drought resistance of silent plants are remarkably improved. Results show that the GHERF114 plays an important role in plant salt stress and drought stress response processes, has important significance in breeding and research for improving salt tolerance and drought tolerance of cotton, and can be applied to screening of stress-resistant cotton varieties through a gene knockout technology.

A screening method for a drought-resistant germplasm of Ophiopogon japonicus related to the field of Ophiopogon japonicus planting is provided. The method uses Ophiopogon japonicus of the main production areas, which requires a large amount of water and rainfall during the growth period, the drought-resistant germplasm that is suitable for growing well is conducted with drought stress under the drought condition. The growth indicators and the physiological indicators of different Ophiopogon japonicus germplasm under drought stress conditions are comprehensively evaluated and ranked to evaluate the drought-resistant ability of the different germplasm. The screening method is scientific and effective, and can comprehensively evaluate the drought resistance ability of Ophiopogon japonicus under the drought stress conditions, laying a technical foundation for the screening and promotion of in the Ophiopogon japonicus with drought resistance ability.

The invention discloses application of a gene FTO in improvement of forage grass quality, yield and stress resistance. According to the invention, the FTO gene is subjected to codon optimization according to the metatropism of alfalfa and is overexpressed in alfalfa to obtain a transgenic alfalfa plant overexpressed with the FTO gene, and compared with wild alfalfa, the transgenic alfalfa plant overexpressed with the FTO gene has the advantages that the growth performance is enhanced; the crude protein content, the soluble carbohydrate content and the in-vitro dry matter digestibility are obviously higher than those of the wild type; the crude fiber content, the acid detergent fiber content, the neutral detergent fiber content and the lignin content of the transgenic alfalfa plant are obviously lower than those of a wild type; in addition, the drought resistance and salt stress resistance of the transgenic alfalfa plant are also obviously enhanced, which indicates that the FTO gene has the functions of improving forage grass quality, resisting stress or positively regulating plant growth. The method has application prospects in the aspects of improving forage grass quality and stress resistance or promoting plant growth and the like.

The invention relates to a Chinese wildrye rhizosphere growth-promoting bacterium and application of the Chinese wildrye rhizosphere growth-promoting bacterium in growth promotion and drought resistance of Chinese wildrye, and belongs to the technical field of microorganisms, the strain is classified and named as Paraburkholderia graminis, the strain number is B24, and the preservation number is CGMCC No.31907. The strain provided by the invention is derived from the intergrassland soil of leymus chinensis in an excessive grazing grassland, has good growth promoting characteristics of producing IAA, producing ACC deaminase, fixing nitrogen, dissolving phosphorus and the like, and also can obviously enhance the drought resistance of the leymus chinensis. When the strain is inoculated to the rhizosphere of a leymus chinensis seedling, the growth of the leymus chinensis can be obviously promoted, and the overground and underground biomass of the leymus chinensis is increased; the activity of antioxidant enzymes is reduced and the hormone content in leymus chinensis leaves is changed, so that drought stress is relieved, the photosynthesis of leymus chinensis is enhanced, and the drought resistance of leymus chinensis is remarkably improved. Therefore, the Burkholderia parakholderia can be used for development of a microbial fertilizer for grassland plants and applied to a drought stress habitat, so that the drought resistance of the grassland plant leymus chinensis is improved, and grassland management is optimized.

The invention relates to the technical field of molecular marker development and molecular marker assisted breeding, and particularly discloses a KASP molecular marker closely linked with a wheat drought resistance related gene TaRPL36-8, a primer and application, the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.1, and T / C polymorphism exists at the 201bp position of the sequence. By detecting the KASP molecular marker, the drought-resistant variety of wheat is identified, and technical support is provided for wheat breeding.

The invention discloses a comprehensive evaluation method for drought resistance of white birch germplasm resources in the seedling stage, and belongs to the technical field of drought resistance evaluation. Under different gradient drought stress and normal conditions, 14 drought resistance indexes of 90 white birch half-sib families are measured, and the drought resistance is comprehensively evaluated by combining membership function analysis, principal component analysis and clustering analysis. A comprehensive drought resistance evaluation value (D value) is obtained according to a membership function, comprehensive clustering analysis is carried out according to the D value of each family, 90 families are divided into four categories at the Euclidean distance of 1.5, and BWY32 and BWY29 are screened out as drought-resistant families. A stepwise linear regression analysis method is utilized to respectively establish linear regression equations under drought stress 5d and 10d, and four important drought resistance indexes are screened out. Compared with the previous research, the method fully considers the difference of the sensitivity degree of each selected index to drought stress and the contribution rate of each index to drought resistance evaluation, and lays a good foundation for simplification and high efficiency of the drought resistance evaluation of the white birch.

The invention belongs to the technical field of agriculture, and discloses a method for identifying and selecting drought-resistant and salt-tolerant wheat varieties in a growth period, which is used for identifying and selecting the drought-resistant and salt-tolerant wheat varieties in the growth period of different wheat varieties under the stress of salt with soil salt content of 0.3% and 0.6% as a correlation analysis result of membership function values and comprehensive evaluation values of all indexes in the whole growth period of the wheat. The above-ground biomass in the heading stage and the filling stage is preliminarily determined as a key stage for evaluating the drought resistance, and can be used as an identification index for screening salt-tolerant varieties. The salt tolerance comprehensive index established through the indexes can be used for clustering test varieties, a direct and simple basis is provided for variety salt tolerance identification and grading, and the salt tolerance of wheat varieties (lines) can be well evaluated by utilizing a whole-growth-period comprehensive model.

The invention discloses a Leymus chinensis drought resistance character related SNP molecular marker and application, the molecular marker is selected from one of SNP1, SNP2, SNP3 and SNP4, a molecular marker combination is formed by combining four markers of SNP1, SNP2, SNP3 and SNP4, the molecular marker combination is C, GC, T and ATG homozygous genotypes according to the sequence of SNP1-SNP4, that is, when the molecular marker combination is CC-GGCC-TT-AATTGG genotype combination, the corresponding Leymus chinensis has the strongest drought resistance. According to the molecular marker related to the drought-resistant character of the leymus chinensis and the combination of the molecular marker, the drought-resistant character of the leymus chinensis can be accurately evaluated at the molecular level, a drought-resistant seed source is accurately and efficiently screened at the seedling stage of the leymus chinensis, and the breeding period of the leymus chinensis is shortened.

The invention discloses an ecological restoration method for a bare rock side slope in a high and cold arid area, and belongs to the technical field of ecological restoration, the ecological restoration method for the bare rock side slope in the high and cold arid area comprises the following steps: (1) side slope pretreatment: firstly, mechanically chiseling a bare rock slope surface to form micro holes; a rhombic iron gauze is laid and anchored; (2) spray-seeding an anti-freezing and thawing base material to ensure that the base material uniformly covers the slope surface; wherein the freeze-thaw resistant base material comprises the following raw materials: weathered gravels, straw fibers, attapulgite clay, an inorganic compound fertilizer, a slow-release water-retaining agent, a cold-resistant microbial agent and mixed anti-freezing grass seeds; (3) covering the surface of the bare rock slope with an ecological blanket; (4) water management. The structural stability is enhanced through mechanical pretreatment, the anti-freezing and drought-resisting capabilities are improved through the composite anti-freezing and thawing base material, vegetation growth is promoted through cooperation of microorganisms and grass seeds, precise maintenance is achieved through an intelligent system, and a systematic solution for ecological restoration of the bare rock slope in the high and cold arid area is formed. The method has remarkable advantages in the aspects of improving the restoration efficiency, guaranteeing the ecological sustainability and the like.

The invention discloses an SNP molecular marker related to drought resistance of corn and application of the SNP molecular marker, and relates to the field of agricultural molecular biology. The SNP molecular marker comprises at least one of a first SNP molecular marker and a second SNP molecular marker; the first SNP molecular marker is located at a basic group at a 97605381 site of a chromosome 9 of a corn reference genome Zeamas.AGPv4, and the polymorphism of the first SNP molecular marker is C / T; the second SNP molecular marker is located at the basic group of the 97604011 site of the No.9 chromosome of the corn reference genome Zeamas.AGPv4, and the polymorphism is C / T. The SNP molecular marker disclosed by the invention has the characteristics of high specificity, high sensitivity, high resolution and high typing quality; the drought resistance of the corn material can be quickly judged according to the genotype, and the method has wide application universality and can be used for corn breeding.

The invention belongs to the technical field of molecular markers and germplasm resource identification, and particularly relates to an Indel molecular marker for identifying upland cotton drought resistance and application of the Indel molecular marker. The Indel molecular marker is located at the 737th basic group of a nucleotide sequence as shown in SEQ ID NO.1, the genotype of the Indel molecular marker is G in the germplasm of the drought-resistant cotton, and the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA in the germplasm of the sensitive drought cotton. The Indel molecular marker provided by the invention is closely linked with the drought resistance phenotype of upland cotton, can be used for efficiently and accurately identifying or assisting in identifying the drought resistance of to-be-detected cotton and effectively distinguishing drought-resistant and sensitive drought-resistant cotton germplasm, and provides an effective means and way for molecular marker-assisted selection of drought-resistant cotton and cultivation of new cotton germplasm resources.

The invention discloses a gene PtoMYB20 for regulating and controlling salt tolerance and drought resistance of poplars. A nucleotide sequence of the gene comprises a sequence as shown in SEQ ID NO. 1. The gene interference fragment is introduced into a plant to obtain a silent transgenic plant, under the conditions of salt stress, drought stress and salt-drought composite stress, the H2O2 and MDA contents of the silent transgenic plant are lower than those of a wild plant, and the SOD and POD activities of the silent transgenic plant are higher than those of the wild plant, so that the damage degree of the plant is effectively reduced; the method is of great significance in improving salt tolerance and drought resistance of the poplar and relieving damage of adversity stress to forestry yield. The invention also discloses a breeding method of the transgenic poplar with strong salt tolerance and drought resistance, provides a new poplar germplasm which not only improves the stress resistance of the poplar but also does not influence the wood yield, and lays a theoretical and gene resource foundation for the stress-resistant molecular breeding of the poplar.

The invention discloses a winter wheat field soil fertility evaluation data processing method based on comprehensive weight calculation, and relates to the technical field of data processing, and the method comprises the steps: S1, collecting nutrient content and moisture retention data from field soil through a sensor network, performing grouping processing on the acquired nutrient content and moisture retention data by adopting decision node splitting and entropy calculation to obtain a soil fertility layering result; s2, according to a soil fertility layering result, acquiring root depth and leaf moisture content indexes of the winter wheat in different layers of soil from crop monitoring equipment, analyzing association strength of the root depth and leaf moisture content indexes and fertility layering by adopting leaf node classification and feature selection standards, and determining a fertility contribution coefficient; according to the winter wheat field soil fertility evaluation data processing method based on comprehensive weight calculation, efficient resource allocation and stable yield are realized, and the drought resistance and resource utilization efficiency of winter wheat in a drought environment are remarkably improved.

The invention relates to the technical field of mountain afforestation, provides an efficient nursery stock planting method suitable for mountain afforestation, and aims at solving the problems that in existing mountain afforestation, planting is not standard, the survival rate is low, the water and soil conservation capacity is weak, and the labor intensity is high. The forest space layout is optimized, and the water and soil conservation capability is enhanced; the mellow soil and immature soil layered stacking and backfilling technology is adopted, the natural structure of the soil is recovered, and the root zone microenvironment quality is improved; a fertilizer isolation layer is arranged and degradable container seedlings are implanted, so that the risk of root burning is avoided, the integrity of root systems is protected, and the survival rate of the seedlings is remarkably increased; by combining root fixing water slow irrigation, water retention covering and slope water collection and soil conservation structures, natural rainfall is effectively utilized, evaporation and runoff are reduced, and water saving and drought resisting are achieved; the whole process flow is standard, the replicability is high, and the dependence on artificial experience is reduced.

The invention discloses a multi-type drought propagation process analysis method and device, a medium and equipment, and relates to the field of drought propagation data processing, and the method comprises the steps: obtaining meteorological, hydrological, agricultural and underground water drought data of a to-be-detected region under different time scales, obtaining meteorological-hydrological, meteorological-agricultural and meteorological-underground water drought propagation time, and calculating the drought propagation time of the to-be-detected region according to the meteorological-hydrological, meteorological-agricultural and meteorological-underground water drought propagation time; determining a drought propagation path of meteorology-hydrology-agriculture-groundwater drought; the method comprises the following steps: constructing a bivariate joint distribution function to obtain the probability of causing drought risks under different meteorological drought levels, carrying out iteration on a meteorological drought index within a certain range with a fixed sliding step length, determining a drought triggering threshold, and obtaining the drought resistance of a to-be-detected region according to the change of the triggering threshold. According to the method, the drought propagation path is determined, and the drought trigger threshold value is combined, so that the drought resistance of a certain region can be accurately predicted.

The invention belongs to the field of gene engineering, and relates to a kiwi fruit AcERF56 gene and application thereof in drought resistance and growth improvement. The nucleotide sequence of the AcERF56 gene of the kiwi fruit disclosed by the invention is as shown in SEQ ID NO: 1; the amino acid sequence of the protein coded by the AcERF56 gene is as shown in SEQ ID NO: 2. The drought resistance function of the gene is reported in the kiwi fruit for the first time, the photosynthetic performance, overground and underground biomass and active oxygen scavenging capacity of the kiwi fruit under the water stress condition can be remarkably improved by overexpressing the gene, the drought resistance of the kiwi fruit is improved, and a research basis is provided for cultivation of drought-resistant and high-yield plants.

The invention discloses an application of an msa-miR156e gene regulated by NO in regulation of drought resistance of plants, and is characterized in that a mature sequence of the msa-miR156e gene is as shown in SEQ ID No. 1, and a precursor sequence of the msa-miR156e gene is as shown in SEQ ID No. 2. The invention also discloses an application of the msa-miR156e gene in regulation of drought resistance of plants. According to the application, the mechanism of NO for regulating the alfalfa msa-miR156e gene to cope with drought stress is studied, the NO is found to up-regulate the expression of msa-miR156e, enhance the activity of antioxidant enzyme and reduce the accumulation of active oxygen, so that the drought resistance of alfalfa is remarkably improved, SPL family genes are regulated in a targeted manner through msa-miR156e, the physiological adaptability of plants is promoted, and the theoretical basis of plant stress resistance is enriched; the cultivation of a high-quality alfalfa variety adapting to a drought environment is facilitated.

The invention provides bacillus subtilis KC-1 as well as a composition and application thereof, and belongs to the technical field of microorganisms. The preservation number of the bacillus subtilis KC-1 is CGMCC (China General Microbiological Culture Collection Center) No.35237. The bacillus subtilis KC-1 can secrete IAA, has nitrogen fixation capacity and can generate siderophores. The bacillus subtilis KC-1 and whey protein are used as a composition, and the bacillus subtilis KC-1 and the whey protein jointly act to prepare the seed treatment material, so that a synergistic effect can be achieved, and corn seed germination and seedling root development are remarkably promoted. Experiments show that compared with single use of the whey protein and the bacillus subtilis KC-1, the combined use of the whey protein and the bacillus subtilis KC-1 can significantly improve the seed germination rate, the length of buds on the overground part, the length of main roots on the underground part, the total root volume, the total root surface area, the total root length and the seedling auxin concentration, and also can significantly reduce the concentration of abscisic acid in seedlings, so that the survival rate of the seedlings is improved. The germination of seeds and the growth of seedlings under drought conditions are promoted, and the drought resistance of plants is improved.

The invention relates to the technical field of plant genetic engineering, in particular to a gene of leymus secalinus participating in adversity stress and application of the gene. The gene LsHSFA participating in adversity stress in leymus secalinus is found for the first time, the nucleotide sequence of the gene LsHSFA is shown as SEQ ID NO.1, and the amino acid sequence of the coded protein is shown as SEQ ID NO.2. Through cloning and identification of the adversity stress participating gene of the leymus secalinus, expression analysis of the gene, genetic transformation of the gene and other means, the function of the gene is analyzed and verified, and the result shows that the adversity stress participating gene of the leymus secalinus has important influence on promotion of upper development of the leymus secalinus and improvement of heat resistance, salt resistance, drought resistance and other stress resistance; the stress-resistant gene of the leymus secalinus is utilized to positively regulate and control the abiotic stress function, so that the leymus secalinus can cope with various stress adversities better, the leymus secalinus can adapt to more complex and harsh ecological environments, degenerated and desertified grassland is improved, and potential application prospects are provided for improved variety breeding and excellent population construction of the leymus secalinus in the future.

The invention relates to the technical field of plant drought tolerance, in particular to a plant drought tolerance related protein FYVE4 and application of a coding gene thereof. By inhibiting expression or protein activity of the FYVE4 gene in the plant, the survival rate of the plant under drought stress is increased; according to the method, in genetic improvement of arabidopsis thaliana, after genetic transformation is conducted through an agrobacterium-mediated method or a gene gun method, the stomata closing response speed and chlorophyll accumulation amount of crops can be effectively increased, and therefore plants with stable genetic drought resistance characters are established; the technical scheme is particularly suitable for constructing a water-saving agricultural system, has very important significance for improving crops and cultivating drought-resistant crops, and is suitable for popularization and application.

The invention discloses a gene DobHLH14 for regulating and controlling DoSUS2 expression under drought stress to increase the content of dendrobium officinale polysaccharides and application of the gene DobHLH14, and belongs to the technical field of plant genetic engineering breeding, the nucleotide sequence of the gene DobHLH14 is shown as SEQ ID No: 4, and the coded amino acid sequence is shown as SEQ ID No: 5. The DobHLH14 is applied to the improvement of the polysaccharide content of the plant or the breeding of the drought-tolerant transgenic plant. The homologous and heterologous overexpression results of the dendrobium officinale show that the polysaccharide content and drought resistance of the transgenic plant are obviously improved by regulating the expression of the DoSUS2 gene through the DobHLH14 transcription factor of the dendrobium officinale under drought stress, and the method is an excellent method for breeding perennial herbaceous plants with high polysaccharide and drought resistance.

The invention discloses haplotype molecular markers related to wheat drought resistance, primers, a kit and application of the haplotype molecular markers, and aims to solve the technical problem that molecular markers capable of identifying excellent haplotypes of TaXTH-2B gene promoters are lacked at present. It is confirmed that the TaXTH-2B gene promoter has two haplotypes, and the Hap II haplotype is an excellent haplotype endowing wheat with a high drought resistance index and has high promoter activity; meanwhile, the invention develops molecular marker primers for distinguishing the two haplotypes, and the molecular marker primers have wide application prospects in the aspects of identifying and screening bred wheat varieties or breeding intermediate generation materials, assisting in selecting wheat materials with high drought resistance indexes and the like.

The invention discloses application of an OsLOX1 gene in regulation and control of drought resistance and seed vigor of rice, and relates to the technical field of plant genetic engineering. According to the invention, the drought stress tolerance of the mutation line with the OsLOX1 knocked out through CRISPR / Cas9 is lower than that of a wild type line, and along with the increase of the content of hydrogen peroxide (H2O2) and malondialdehyde (MDA) and the reduction of the expression quantity of antioxidant enzyme related genes. In addition, it is found that compared with a wild type, the service life of rice seeds is shortened by knocking out OsLOX1, meanwhile, the content of H2O2 and MDA is increased, and the activity of antioxidant enzyme superoxide dismutase (SOD) and catalase (CAT) is reduced; the method can be used for breeding storage-resistant and drought-resistant rice varieties; important gene resources are provided for cultivating drought-resistant rice varieties and prolonging the service life of seeds.

The invention belongs to the field of plant genetic engineering, and discloses application of a PtNF-YB9 gene of trifoliate orange in drought-resistant genetic improvement of plants. The PtNF-YB9 gene is a transcription factor gene which is separated and cloned from Poncirus trifoliata, and the sequence of the PtNF-YB9 gene is as shown in SEQ ID NO. 1. The gene or the homologous gene thereof is knocked out or inhibited in a plant, the drought resistance of the plant is remarkably reduced, and the drought resistance of the plant is remarkably enhanced by overexpressing the gene or the homologous gene thereof. The development and utilization of the genetic resource are beneficial to reducing the agricultural production cost and realizing the green and environment-friendly agricultural goal.

The invention discloses application of an OsCPN10a gene in regulation and control of vigor, grain shape and drought tolerance of rice seeds, and belongs to the technical field of rice gene engineering. The invention particularly relates to the research of the OsCPN10a gene in the aspects of regulating and controlling the germination rate, the germination potential, the germination index, the grain length, the grain width, the thousand grain weight, the drought tolerance of the rice seeds and the like. Experimental results show that the grain shape of the OsCPN10a knockout mutant seed is obviously lengthened and widened, and the grain shape of the OsCPN10a overexpression seed is opposite; the yield of the Ocpn10a mutant is higher than that of a TNG67 plant; overexpression of the OsCPN10a has the potential of improving the drought resistance of the rice. The invention reveals that OsCPN10a affects genetic mechanisms such as rice seed vigor, grain length, grain width and storability, provides important gene resources and theoretical basis for genetic improvement of rice, and is beneficial to cultivation of a new rice variety with better grain shape and higher yield.

The invention discloses a rice drought resistance phenotype detection and genetic analysis method based on a phenotypic robot, which is characterized in that rice hyperspectral phenotypic character data is acquired based on the phenotypic robot, and the relative water content RWC of rice is predicted. Through high-frequency data acquisition, RWC (t) based on a time sequence is obtained, RWC (t) curve change characteristic indexes are calculated, the dynamic change process of a rice experiment material in the whole drought experiment period is quantified, the drought resistance index DTI of the rice experiment material is obtained, and the drought resistance of the rice variety is comprehensively evaluated. DTI as a user-defined phenotypic character can be used for whole genome association analysis (GWAS), and a key gene for controlling the drought resistance of rice is excavated. According to the invention, the problems of low efficiency and low flux of traditional rice phenotype detection are solved, phenotype-gene mining based on the mobile robot is realized, and a new way is expanded for improvement of rice genetic breeding.

The invention belongs to the technical field of gene engineering, and relates to improvement of drought resistance of cotton, in particular to application and a method of a transcription factor GhTCP67 in improvement of the drought resistance of the cotton. According to the application, the transcription factor GhTCP67 is used as a drought negative regulation gene in cotton, and the plant height can be inhibited by knocking out the gene, but the drought resistance of the cotton can be enhanced. Therefore, the GhTCP67 can be used as a candidate gene for cultivating a cotton drought-resistant variety, and the gene is mutated from a genome level by utilizing a gene editing technology, so that a new cotton genetic germplasm with reduced plant height and enhanced drought resistance is obtained. According to the application, a new research idea is provided for cotton drought resistance research, and meanwhile, a cotton genetic material with enhanced drought resistance is also created. The invention further provides a recombinant plasmid constructed by using the DNA fragment and an obtained gene editing transgenic plant and seed.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying drought tolerance of wheat, haplotypes, primers and application. Belongs to the technical field of biological breeding. Research finds that three SNP loci exist on a wheat ARF20-B gene, a wheat drought-enduring haplotype ARF20-BHapI is developed based on the SNP loci, the first locus is located at the 3616bp position of the ARF20-B gene, and the A / G nucleotide polymorphism is A; the second site is located at the 5623bp position of the ARF20-B gene, and G is in the G / A nucleotide polymorphism; the third site is located at the 9795bp position of the ARF20-B gene, and G is in the G / A nucleotide polymorphism. The wheat carrying the ARF20-BHapI haplotype has the advantage that the drought tolerance of the wheat carrying the ARF20-BHapI haplotype is higher. The invention further provides a KASP primer group for detecting the ARF20-BHapI haplotype, and successful detection of the drought tolerance of the wheat is achieved.

The invention provides a wheat drought-tolerant gene TaTZF1 and application thereof in plant drought tolerance, and belongs to the technical field of gene engineering. The invention provides a wheat drought-enduring gene TaTZF1. The amino acid sequence of a protein encoded by the wheat drought-enduring gene TaTZF1 is as shown in SEQ ID No. 2. The wheat drought-enduring gene TaTZF1 is subjected to induced expression by drought, ABA and salt stress, the wheat drought-enduring gene TaTZF1 is overexpressed and transformed into wheat in an overexpression mode, and it is found that the drought tolerance of a transgenic plant with overexpressed TaTZF1 is remarkably improved compared with that of a wild type plant; after the wheat drought-tolerant gene TaTZF1 in wheat is knocked out, the drought tolerance is obviously reduced. It is proved that the wheat drought-resistant gene TaTZF1 positively regulates the drought resistance of wheat, gene resources are provided for wheat molecular breeding, and the wheat drought-resistant gene TaTZF1 has great significance in improvement of wheat drought-resistant genetic improvement.