104 results about "Leucine" patented technology

The invention provides a sustained-release pellet containing gamma-aminobutyric acid, the sustained-release pellet comprises a pellet core and a coating layer wrapping the pellet core, the pellet core contains a physiologically active substance, and the physiologically active substance is gamma-aminobutyric acid; the pellet core comprises the following components in parts by weight: 15-40 parts of gamma-aminobutyric acid, 30-55 parts of a filling agent, 1-30 parts of a lubricating agent and 0.5-5 parts of an anti-caking agent; the filling agent comprises at least one of microcrystalline cellulose, powdery cellulose, starch and derivatives thereof, hydroxypropyl cellulose, hydroxypropyl methylcellulose, low-substituted hydroxypropyl cellulose, sugar or sugar alcohol and fruit and vegetable powder; the lubricant comprises at least one of talcum powder, magnesium stearate, stearic acid, glycerol and leucine; the anti-caking agent comprises at least one of magnesium carbonate, tricalcium phosphate, calcium hydrophosphate and silicon dioxide.

The application belongs to the technical field of protein extraction, and provides a method for improving water holding property and oil holding property of peony seed protein, the core of the method is that before the extraction of the peony seed protein, the peony seed is pretreated by the following method: the peony seed meal is subjected to steam explosion treatment under the condition of 0.4-1.2 Mpa and 60-150 s, preferably 0.8 Mpa and 100 s, to obtain the steam exploded peony seed, and the sample after the steam explosion is subjected to drying treatment; preferably heat pump drying. The peony seed protein prepared by the method has obviously improved water holding property, oil holding property, foaming property, foam stability, emulsifying property and emulsion stability; the valine is increased by 8.58%, the leucine is increased by 6.63%, and the tyrosine is increased by 10.65%; the extraction rate of the seed protein is 76.82%, and the extraction effect is excellent.

The invention relates to the field of functional additives for daily chemicals, and particularly discloses hydrolyzed procyanidine freeze-dried powder and a preparation method thereof. The hydrolyzed procyanidine freeze-dried powder is prepared by freeze-drying and comprises the following raw materials in parts by weight: 0.1-0.2 part of hydrolyzed procyanidine, 25-35 parts of carnosine, 10-20 parts of a stabilizer, 0.1-0.3 part of acetyl hexapeptide-8 and 45-55 parts of water. The stabilizer is selected from at least one of mannan, trehalose, mannitol, cane sugar, betaine, whey protein, PVP (Polyvinyl Pyrrolidone), PEG (Polyethylene Glycol), glycine, histidine, leucine, sodium alginate, beta-cyclodextrin, maltodextrin and chitosan. The hydrolyzed procyanidine freeze-dried powder has good storage stability, can keep activity for a long time, is still stable after being dissolved in water for a long time, and has less activity loss.

The invention discloses a zinc oxide decrement substitution composite additive for improving intestinal health of piglets and application of the zinc oxide decrement substitution composite additive, and belongs to the technical field of animal feed. The zinc oxide decrement substitution composite additive is composed of curcumin, eutectic essential oil, leucine, a microbial agent and an enzyme preparation. The invention provides a zinc oxide decrement substitution composite additive which has the effects of improving intestinal health of piglets and reducing diarrhea rate of the piglets. The compound additive is composed of plant extracts, amino acid, a microbial agent, an enzyme preparation and the like, and all the components are combined for use, so that the weight of piglets can be remarkably increased, the feed utilization rate is increased, and the diarrhea rate of the piglets is reduced. The composite additive disclosed by the invention can realize zinc oxide reduction and replacement, reduces metal discharge at a breeding end, and accords with an environmental protection policy; based on natural components, no residual risk exists, food safety is guaranteed, and sustainable development of the breeding industry is assisted.

The invention discloses an application of CsTON2 protein and a coding gene thereof in regulating and controlling the length of cucumber fruits, and belongs to the technical field of biology. The CsTON2 protein is derived from cucumbers, the amino acid sequence of the CsTON2 protein is as shown in SEQ ID NO.2, and the nucleotide sequence of a gene for coding the protein is as shown in SEQ ID NO.1. The South China type short fruit mutant sf5 is obtained through EMS mutagenesis, a candidate gene is determined to be CsTON2 through map-based cloning, amino acid is changed into leucine from proline due to mutation (C is changed into T) of the gene, and the fruit length is remarkably shortened; and after the overexpression vector is constructed and the mutant is transformed, the CsTON2 expression quantity of the overexpression strain is obviously increased, and the fruit length is obviously increased. The positive regulation effect of the CsTON2 gene on the cucumber fruit length is defined, a key target gene and a molecular marker are provided for molecular breeding of the cucumber fruit length, and the CsTON2 gene has important theoretical significance and application value.

The invention relates to the technical field of fermentation engineering and wine brewing, and discloses a low-alcohol fruit wine brewing process based on compound microorganism synergistic fermentation, which comprises the following steps: inoculating Meijie yeast into clarified fruit juice, adding L-leucine, culturing under controlled temperature, and removing free iron ions by biological chelation until the liquid level becomes red; then inoculating saccharomyces cerevisiae, starting a trace oxygen introduction and ORP (oxidation-reduction potential) system after main fermentation is started, and controlling potential to carry out metabolism redirected fermentation in a micro-aerobic interval until residual sugar reaches the standard; after the fermentation is finished, adding an alkaline regulator to increase the pH value, inducing the haematochrome-iron compound to flocculate and settle, separating to remove the precipitate, and adding an acidic regulator to adjust the pH value to obtain the low-alcohol fruit wine. According to the method disclosed by the invention, a brewer's yeast respiratory chain is blocked and oxidative stress is applied by utilizing a metabolic redirection strategy under precursor-induced biological iron removal and micro-aerobic environment, so that a carbon flux is promoted to flow to a glycerol synthesis path, the ethanol yield is reduced, and the glycerol content is greatly increased.

The invention discloses an L-leucine-removed effervescent tablet and a preparation method thereof, and belongs to the technical field of functional foods and medicines. The effervescent tablet is prepared from the following raw materials in parts by weight: 10.47 parts of vitamin B1, 20.390 parts of vitamin B2, 45.425 parts of vitamin C, 15.500 parts of zinc citrate, 81.360 parts of taurine, 70.436 parts of maltodextrin, 500.000 parts of isomaltitol, 0.380 parts of allura red, 0.060 parts of sunset yellow, 22.000 parts of sucralose, 130 parts of food essence, 800.000 parts of sodium bicarbonate, 240.000 to 250.000 parts of DL-malic acid, 733.979 to 764.779 parts of sorbitol and 1329.200 to 1350.000 parts of anhydrous citric acid. The preparation method specifically comprises the following steps: (1) weighing the prepared materials; (2) granulating; (3) mixing; (4) tabletting; and (5) packaging. The functional effervescent tablet product which is rapid in disintegration, clear in solution and better in stability is produced, the problem of peculiar smell caused by L-leucine in the prior art is solved, the production cost is reduced, and the functional effervescent tablet has urgent market requirements and important technical value.

The application discloses application of Fagopyrum cymosum root powder in preparation of products for improving egg quality or intestinal health of laying ducks, and belongs to the technical field of feed additives. The application provides application of Fagopyrum cymosum root powder in preparation of products for improving egg quality or intestinal health of laying ducks, and the Fagopyrum cymosum root powder can improve eggshell strength, yolk color and eggshell proportion, improve the content of aspartic acid, threonine, glutamic acid, glycine, cystine and leucine in yolk, improve the content of arachidonic acid and arachidonic acid in yolk, and reduce the content of saturated fatty acid in yolk; the Fagopyrum cymosum root powder can improve the activity of maltase in the mucous membrane of the jejunum of laying ducks, and can improve the diversity and abundance of intestinal flora of laying ducks. The application provides a new strategy for improving egg quality or intestinal health of laying ducks.

This invention provides a novel raw material that, for cats, which exhibit unique characteristics in their kidneys compared to other mammals, can inhibit the decline in feline kidney function and improve coat condition while maintaining the form of cat food or other feeds. When using a poorly soluble soybean protein raw material with a characteristic amino acid composition of less than a glutamic acid (Glu) to leucine (Leu) mass ratio of 2, and an NSI of 10%–60%, the decline in feline kidney function can be inhibited and coat condition improved through small-scale intake. This raw material can also be obtained as undigested residue from the soybean peptide manufacturing process.

This invention discloses a *Lactococcus faecium* strain, YS-IM01. This strain can efficiently hydrolyze sheep colostrum proteins and specifically release a large amount of leucine. This invention also provides a polypeptide composition comprising multiple active peptides with potential for muscle synthesis, immunomodulation, and antioxidant activity. This invention further provides a fermented sheep colostrum product obtained by fermenting sheep colostrum with the aforementioned *Lactococcus faecium*. This invention also provides a method for preparing the fermented sheep colostrum product, comprising steps including fermentation, low-temperature vacuum concentration, and vacuum freeze-drying. Simultaneously, this invention also provides a method for preparing a drug using *Lactococcus faecium* and the polypeptide composition to prevent and / or improve age-related muscle loss.

The application provides a breeding method of daphnia magna, which comprises the following steps: S1, putting collected daphnia magna into an expansion culture pool, and the initial density of the daphnia magna is 30-40 ind. / L; S2, adding lake water or tap water into the expansion culture pool, and then putting farmyard manure, leucine and fermentation products fermented by bean dregs and wheat bran into the expansion culture pool, and expanding the daphnia magna under the condition that the water temperature is 15-25 DEG C, the pH value is 7-8 and the dissolved oxygen is greater than 2 mg / L. The leucine in the fermentation products of the bean dregs and the wheat bran cooperatively accelerates the growth speed of the daphnia magna, improves the reproduction rate of the daphnia magna, and ensures that the size and the quantity of the daphnia magna are rapidly increased in a short time.

The invention relates to a method for improving the prokaryotic expression quantity of CRISPR-dCas9 (clustered regularly interspaced short palindromic repeats) protein. Specifically, the invention relates to a method for improving the expression level of dCas9 protein in a prokaryotic cell, and a leucine zipper gene sequence and a dCas9 gene sequence are connected and introduced into the prokaryotic cell. According to the method, the high-purity and high-concentration dCas9 protein can be obtained, the expression quantity of the dCas9 protein is remarkably higher than that of a common method using maltose binding protein (MBP) as a fusion molecular chaperone, the obtained dCas9-lzip fusion protein still has the capability of being normally combined with DNA in a targeted manner under the guidance of sgRNA, and the function of dCas9 is not influenced by connection of a lzip sequence.

The invention relates to the technical field of amino measurement, in particular to a method for measuring the content of reactive primary amino in sulfydryl-containing protein and application of the method. The determination method comprises the following steps: S1, weighing a proper amount of L-leucine solid, dissolving the L-leucine solid in ultrapure water, preparing the L-leucine solid into different concentrations by adopting a NaHCO3 solution, then determining the content of the reactive primary amino group by adopting a TNBS method, and establishing a standard curve according to the relationship between an OD value at the maximum absorption wavelength and the concentration of the reactive primary amino group; s2, carrying out sealing treatment on the to-be-detected protein containing the sulfydryl by adopting N-ethyl maleimide; and S3, determining the content of the primary amino group of the protein by adopting a TNBS method, and substituting the OD value at the maximum absorption wavelength into the standard curve to obtain the concentration of the reactive primary amino group. According to the method, reactive sulfydryl in the protein is blocked in advance through N-ethylmaleimide to eliminate interference of sulfydryl, and the content of reactive primary amino groups in the protein can be measured more accurately.

The invention relates to the technical field of biology, and particularly discloses a rice ALS mutant protein ALS-ANTSL and application of the rice ALS mutant protein ALS-ANTSL. Compared with a wild type rice ALS protein, the rice ALS mutant protein disclosed by the invention contains mutation that valine at the 170th position is mutated into alanine, proline at the 171st position is mutated into asparagine, arginine at the 172nd position is mutated into threonine, arginine at the 173rd position is mutated into serine, and methionine at the 174th position is mutated into leucine. According to the rice ALS mutant protein disclosed by the invention, various plants can have relatively high resistance to various ALS inhibitor herbicides, and the rice ALS mutant protein can be used for cultivating herbicide-resistant plant varieties and has relatively high application value.

The invention discloses a Lactobacillus paracasei 1029 and application thereof, the preservation number of the Lactobacillus paracasei 1029 is CCTCC (China Center for Type Culture Collection) NO: M20251441, and the Lactobacillus paracasei 1029 is preserved in the China Center for Type Culture Collection on June 23, 2025. The fermentation product contains a plurality of active metabolites, such as pyruvic acid, pantothenic acid, proline and leucine, and the components synergistically enhance the effects of oxidation resistance, bacteriostasis and cell melanin inhibition. Compared with the prior art, the fermented product disclosed by the invention realizes integration of multiple effects, is high in safety (free of cytotoxicity) and simple in preparation process (standing for 6 days at 30 DEG C, filtering, centrifuging, freezing and drying), has wide application prospects including food additives, health-care products, cosmetics and pharmaceutical preparations, and can remarkably improve the bioavailability and market competitiveness of products.

This invention provides the application of a cyclic dipeptide in inhibiting the TRPV1 protein, wherein the cyclic dipeptide is a cyclic (D-leucine-L-proline) dipeptide. This invention also relates to the application of the cyclic dipeptide in the preparation of topical skin agents or pharmaceuticals with TRPV1 protein inhibitory activity, wherein the topical skin agent is selected from: creams, lotions, gels, toners, serums, masks, eye creams, aerosol cleansing foams, sprays, shower gels, or facial cleansers.

The invention belongs to the technical field of fertilizers, and particularly relates to a fulvic acid fertilizer for improving passion fruit quality and amino acid composition and application of the fulvic acid fertilizer. A preparation method of the fulvic acid fertilizer for improving the passion fruit quality and the amino acid composition comprises the following steps: S1, preparing a basic solution: mixing a potassium fulvate mother solution with deionized water to form the basic solution; s2, constructing an electro-Fenton system; s3, electro-Fenton activation reaction: applying constant current to an electro-Fenton reaction system, quenching after reaction, and adjusting the pH value; s4, carrying out chelation reaction; and S5, fixing the volume. The fulvic acid fertilizer disclosed by the invention can regulate and control secondary metabolism of crops, can remarkably improve the soluble solid content of fruits, reduces total acid, optimizes the sugar-acid ratio, and enables the flavor of the fruits to be better; meanwhile, the amino acid composition of fruits can be systematically improved, and the total amount of amino acids, especially the content of arginine, leucine and other key amino acids, can be remarkably increased.

The invention provides an application of amino acid as a chlorine removal agent. The amino acid is D-tryptophan, L-tryptophan, D-histidine, D-glutamine, L-histidine, L-leucine, L-phenylalanine, L-methionine or L-tyrosine. The amino acid, especially D-tryptophan, can react with available chlorine in water to reduce the concentration of available chlorine in water, and the amino acid can be used as a dechlorinating agent for treating chlorine-containing industrial wastewater, biological treatment wastewater and domestic wastewater or reducing the content of available chlorine in daily domestic water or drinking water. The invention also provides a method for reducing the available chlorine concentration in the chlorine-containing water sample by using the amino acid. The invention provides a novel dechlorinating agent which is high in efficiency and low in cost and has a wide application prospect.

The present disclosure provides an antimicrobial peptide (AMP) for controlling Pseudomonas syringae pv. actinidiae (PSA) and a preparation method and use thereof, belonging to the technical field of biological control. In the present disclosure, the AMP has an amino acid sequence of Trp-Trp-Lys-Leu-Leu-Arg-Lys-Leu-NH2, and has a typical amphiphilic structure. The AMP can target a cell membrane of the PSA, increasing permeabilization and dissipating a membrane potential, which leads to calcium ion leakage. The AMP also acts on intracellular targets, affects DNA functions, reduces an activity of esterases, and induces the generation of reactive oxygen species (ROS). The AMP has a minimal inhibitory concentration (MIC) of 3.13 μg / mL and a half maximal effective concentration (EC50) of 1.67 μg / mL for the PSA, showing an activity significantly higher than that of agricultural streptomycin.

The invention relates to a mutant cell strain of ZNF717 L39V, which is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is GGTGTCCTTGAGGAGGTAGCTGCACCTCGGGAGGAGTGGCAGGATGATGCTCAG. The mutant cell strain of ZNF717 L39V is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is shown in the specification. According to the gRNA sequence of the ZNF717 L39V and the ssDNA donor sequence of the ZNF717 L39V, which are designed by the invention, a mutation sequence can be obtained, the mutation efficiency is high, and a mutation site and a base sequence after mutation can be accurately controlled.

Delayed-release micropellet particles containing γ-aminobutyric acid, characterized in that it comprises a pellet core and a coating layer surrounding the pellet core, wherein the pellet core contains a physiologically active substance, the physiologically active substance being gamma-aminobutyric acid; the pellet core comprises, calculated in parts by weight, the following components: 15 to 40 parts of gamma-aminobutyric acid, 30 to 55 parts of a filler, 1 to 30 parts of a lubricant, 0.5 to 5 parts of an anti-caking agent; wherein the filler comprises at least one of microcrystalline cellulose, powdered cellulose, starch and its derivatives, hydroxypropyl cellulose, hydroxypropyl methylcellulose, low-substituted hydroxypropyl cellulose, sugar or sugar alcohols and solid fruit and vegetable drinks; wherein the lubricant comprises at least one of talc, magnesium stearate, stearic acid, glycerol and leucine; wherein the anti-caking agent comprises at least one of magnesium carbonate, tricalcium phosphate, dicalcium phosphate and silicon dioxide.

The application discloses a novel insect short neuropeptide sNPF analogue and application thereof in pests, and relates to the technical field of agriculture; the application provides a structural general formula of the novel insect short neuropeptide sNPF analogue, and the novel insect short neuropeptide sNPF analogue is applied to the prevention and treatment of aphids, thrips, Plutella xylostella and Spodoptera frugiperda. The terminal tyrosine Y, arginine R or leucine L residue is substituted and modified by using hydrophilic, hydrophobic, steric hindrance natural amino acids or unnatural amino acids and other groups on a lead compound, and the obtained novel insect short neuropeptide sNPF analogue can be used in the prevention and treatment of various pests.

The invention discloses application of a soybean GmCDF3 gene in regulating and controlling the content of seed protein, amino acid and raffinose, and relates to application of soybean GmCDF3. According to the application of the soybean GmCDF3 gene in regulating and controlling the contents of seed protein, amino acid and raffinose, the application method is to culture plant seeds by using the soybean GmCDF3 gene, and further improve the plant quality. According to the invention, a GmCDF3 overexpression vector is constructed by utilizing a molecular means, and the soybean GmCDF3 gene is overexpressed in soybean through an agrobacterium-mediated genetic transformation technology, so that the content of 12 amino acids such as cysteine, leucine, lysine, phenylalanine and threonine in soybean seeds can be remarkably increased, and the yield of soybean seeds is increased. The protein content of the seeds is obviously improved, the oil content and the grain weight are not influenced, and the raffinose content is obviously reduced. Meanwhile, the soybean GmCDF3 gene is over-expressed in arabidopsis thaliana, and the protein content of arabidopsis thaliana seeds is also remarkably increased.

The invention belongs to the technical field of preparation of aquatic product active peptides with biological activity. A method for improving DPP-IV inhibitory peptide activity based on a proteinoid reaction is characterized by comprising the following steps: step 1, according to the ratio of fish meat to ultrapure water being 1 g: (1-6) g, adding fish meat into ultrapure water to prepare a homogenous solution, carrying out enzymolysis on protein with trypsin to prepare an enzymatic hydrolysate, carrying out ultrafiltration purification treatment on the enzymatic hydrolysate, and freeze-drying to obtain fish meat crude peptide, wherein the addition amount of the trypsin is 3000-5000 U / g; step 2, adding leucine to carry out proteoid modification on the crude peptide; and step 3, identifying the sequence by mass spectrometry to obtain a peptide fragment with an amino acid sequence of LNWDAAPGPVR, so as to obtain the protein-like modified fish DPP-IV inhibitory peptide. The method can improve the activity of the peptide.

The present application relates to a kind of compositions for regulating autophagy of eukaryotic cell, improving mitochondrial dysfunction and its preparation method and application.It includes the following weight parts of raw materials: 10-30 parts of broccoli powder, 10-30 parts of wheat germ microcapsule powder, 20-40 parts of raspberry extract, 20-40 parts of banana powder, 2-6 parts of leucine, 0.1-1 parts of pyrroloquinoline quinone disodium salt.The present application also provides the preparation method of broccoli powder, wheat germ microcapsule powder, raspberry extract and banana powder, and the use of the composition.The composition combines the efficacy of the above 6 ingredients, reasonable compatibility, safe and effective, various components activate mitochondria through regulating protein, PINK1 / Parkin-dependent pathway and PINK1 / Parkin-independent pathway;At the same time, by activating PGC-1 alpha signal pathway, promote mitochondrial DNA replication and new mitochondria generation;Stabilize mitochondrial membrane potential, improve ATP synthesis efficiency;Synergistically activate mitochondrial autophagy, improve mitochondrial dysfunction and then relieve aging.

The invention provides bacillus brevis HDCC00067, the preservation number of the bacillus brevis HDCC00067 is CGMCC (China General Microbiological Culture Collection Center) No.35553, and the capability of producing brevibacterium peptide A is obviously higher than that of the prior art. The applicant also finds that the yield of the brevibacitracin A can be obviously improved when amino acid precursor substances are added into the fermentation culture medium, especially when the concentrations of L-tryptophan, D-leucine and D-valine are controlled to be within a certain range. By controlling pH and dissolved oxygen in a tank fermentation culture medium and optimizing a feeding control strategy of a mixed solution of a carbon source and a nitrogen source, the content of the brevibacitracin A in fermentation liquor is further greatly increased and reaches 7.5 g / L or above, and the brevibacitracin A can be used for large-scale industrial production.

The application discloses a production method of honeysuckle tablet candy. The honeysuckle, chrysanthemum, momordica grosvenori, menthol, sorbitol, lactose and leucine of a formula are subjected to ultrasonic extraction to obtain filtrate, and then concentrated, dried, mixed and tabletted, so that the obtained tablet candy contains a large amount of chlorogenic acid, and the tablet has the advantage of stronger flower fragrance. A production device of honeysuckle tablet candy comprises a bearing plate, and two symmetrically-distributed arm rods are horizontally swing-connected to the top of the bearing plate. In the application, the setting of the extrusion groove, the material pipe, the pressure disc, the swing arm and the transmission mechanism can prevent the powder loss of the mixed raw materials of the honeysuckle tablet candy during feeding and tabletting, avoid the mixing of the discharged tablet and the lost powder, thus easily causing the waste of the mixed raw materials, and has the advantages of improving the hardness of the tablet and ensuring the weight of the tablet.

The invention discloses a method for improving the stable activity and antioxidant activity of chicken peptide ADH, and a polypeptide and application thereof. The ADH stable activity and the antioxidant activity of the chicken peptide can be improved by performing the plastein reaction on the chicken peptide, and it is proved for the first time that the ADH stable activity and the antioxidant activity of the chicken peptide can be further remarkably improved by adding exogenous amino acid in the plastein reaction; compared with the unreacted chicken peptide and the chicken peptide subjected to plastein reaction, the ADH stable activity and the oxidation resistance of the prepared product are remarkably improved by at least 105%; wherein under the plastein reaction action of alkaline protease, cysteine, leucine, tryptophan and lysine, the ADH stable activity and antioxidant activity of the chicken peptide are remarkably improved. The method provided by the invention is simple, convenient and rapid, the prepared polypeptide product has a remarkable effect, and more product raw material sources with better effects are provided.

We provide foods or pet food ingredients, foods, pet food, and supplements that have anti-glycation effects. [Solution] The present invention provides an anti-glycation agent comprising a dipeptide or salt thereof made of Lys-Leu as an active ingredient, a food or pet food material containing the same, a food, a pet food, and a supplement.