290 results about "Glucagon" patented technology

Disclosed herein are methods for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity using a glucagon-like peptide-1 (GLP-1) receptor non-peptide agonist (NPA) compound selected from Compound 1, Compound 1a, Compound 2, Compound 3, pharmaceutically acceptable salts thereof, and hydrates of the compounds and pharmaceutically acceptable salts, by oral administration to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA. Also disclosed herein are uses of a GLP-1 receptor NPA compound for the manufacture of a medicament for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

Methods for enhancing weight loss, or preventing or treating obesity or other conditions related thereto, such as diabetes, involve administering a GLP-1 agonist together with, or prior to, administering a mitochondrial uncoupler. Use of the uncoupler increases weight loss and enhances treatment of obesity and obesity-related medical conditions, such as by preventing weight regain after cessation of administration of the GLP-1 agonist.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

The invention relates to a lactobacillus rhamnosus YYSJ019 strain for relieving obesity and application of the lactobacillus rhamnosus YYSJ019 strain. The lactobacillus rhamnosus YYSJ019 strain is classified and named as lactobacillus rhamnosus, and the preservation number of the lactobacillus rhamnosus YYSJ019 strain is CGMCC (China General Microbiological Culture Collection Center) No.33472. The strain has good tolerance and high surface hydrophobicity in gastric juice, and has the potential of smoothly entering the gastrointestinal tract of a human body; the bacterial strain has excellent intestinal adhesion capability, and provides a basis for continuously playing a probiotic effect; the strain can slow down weight gain of obese mice and improve fat accumulation, liver injury and inflammation in bodies of the obese mice; the blood sugar metabolism capability and the blood fat metabolism capability can also be improved, and the potential of preventing and treating hyperglycemia or hyperlipidemia is achieved; in addition, a mouse small intestine endocrine cell line (STC-1 cell line) can be stimulated to generate the glucagon-like peptide-1, and the glucagon-like peptide-1 has the potential of improving diseases caused by insufficient secretion of the glucagon-like peptide-1; the effects of reducing uric acid in vitro and reducing uric acid in vivo are achieved, and the potential of preventing and treating hyperuricemia is achieved.

Described herein is a composition comprising at least one of a lotus leaf extract (LLE), a chrysanthemum extract (CME), and a Pu'er tea extract (PTE), the composition having an agonistic effect on the glucagon-like peptide-1 receptor (GLP-1R). In addition, compositions comprising a mixture of LLE, CME, and PTE are described herein. Also described are methods of using the described compositions, e.g., for supporting weight loss efforts in a subject in need thereof.

The present application relates to heterobicyclic compounds having glucagon-like peptide receptor (GLP-1R) agonist activity, processes for their preparation, pharmaceutical compositions comprising them and their use as GLP-1R agonists or for the treatment or prophylaxis of GLP-1R associated diseases or disorders. In particular, the compounds of the present application are useful for body weight management, for lowering blood sugar and / or for the treatment or prevention of diabetes, diabetic complications, obesity, overweight, dyslipidemia, fatty liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH)), metabolic diseases, cardiovascular diseases, nervous system disorders, mental disorders, kidney diseases, etc. , gastrointestinal diseases, autoimmune diseases, inflammatory diseases, lung diseases, hypothalamic-pituitary-gonad axis related diseases or disorders, cancers and the like.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The invention relates to the technical field of polypeptide drugs for metabolic diseases, in particular to a glucagon-like peptide (GLP-1), a glucose-dependent insulinotropic polypeptide (GIP) and a glucagon (GCG) triple receptor agonist (protein). According to the triple receptor agonist protein provided by the technical scheme, weight reduction is achieved, meanwhile, lower side effects are shown, and drug compliance is enhanced. The triple receptor stimulant researched and developed by the technical scheme can be applied to preparation of medicines with the effects of losing weight, reducing lipid or reducing blood sugar, solves the technical problem that the existing GLP-1, GIP and GCG triple receptor stimulants are difficult to reduce side effects while reducing body weight, and breaks through the weight loss mode that the traditional medicines depend on appetite suppression; due to the unique action mechanism and good safety, a safer and more effective treatment scheme is provided for patients, and the medicine has wide market prospects and social benefits.

The invention pertains to pharmaceutical compositions containing a GIP (glucose-dependent insulino-tropic polypeptide) and GLP-1 (Glucagon-like peptide-1) receptor agonist. In particular, the invention provides pharmaceutical compositions containing tirzepatide. The pharmaceutical compositions according to the invention are physically and chemically stable, are easy to manufacture and suitable for parenteral administration. The invention further provides methods for making the same as specified in the claims.

Provided herein are combinations comprising a glucagon-like peptide-1 receptor (GLP-1R) agonist and a thyroid hormone receptor beta (THRβ) agonist and methods comprising administering to a subject in need thereof such combinations.

The invention provides an application of synbiotics in preparation of a composition for improving glucagon-like peptide-1 (GLP-1). The composition comprises litchi polyphenol, probiotics and methionine. The probiotics comprise bifidobacterium animalis BCRC910645, bifidobacterium longum BCRC910812, or a combination of the bifidobacterium animalis BCRC910645 and the bifidobacterium longum BCRC910812, so that the content of the glucagon-like peptide-1 is increased.

A composition comprising a glucagon-like peptide 1 (GLP-1) agonist for sublingual or buccal administration, wherein the composition comprises one or more agents selected from the group consisting of; sodium glycodeoxycholate; sodium deoxycholate; carboxymethyl cellulose; sodium alginate; SNAC (salcaprozate sodium); a non-ionic ester alkoxylate (or alkanoic acid ester alkoxylate); and soy lecithin.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention belongs to the technical field of medicines, and particularly provides a novel application of a theaflavin compound in preparation of a product for inhibiting dipeptidyl peptidase-4 (DPP-4), and the theaflavin compound is one or more of theaflavin-3-gallate (TF2A), theaflavin-3 '-digallate (TF3) and theaflavin (TF). The research systematically proves that TF2A, TF3 and TF have new application of inhibiting DPP-4 for the first time: in-vitro enzymology and fluorescence experiments show that theaflavin can inhibit DPP-4 and interact with DPP-4, and molecular docking further shows possible binding configuration and key action sites of theaflavin. In vivo, the activity of DPP-4 in serum and different tissues of high-fat diet mice can be reduced, serum glucagon-like peptide-1 (GLP-1) can be up-regulated, and glycometabolism and inflammatory phenotype can be improved. Therefore, the theaflavin compound disclosed by the invention can be applied to preparation of products for inhibiting DPP-4, and has a good development prospect.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present disclosure relates to dosage regimens for glucagon-like-peptide-2 (GLP-2) analogs, e.g., apraglutide, in a subject in need thereof, e.g., a subject with short bowel syndrome (SBS).

The invention pertains to an inhalable dry powder formulation comprising a therapeutically effective amount of Glucagon-like peptide-1 (GLP-1) receptor agonist. Further, use of the inhalable dry powder formulation treatment of chronic weight management for people who are overweight or obese, with or without a weight-related comorbid condition. Further, a process for forming particles comprising a Glucagon- like peptide-1 (GLP-1) receptor agonist suitable for airborne inhalation.

The present invention relates to formulations of glucagon analogues or pharmaceutically acceptable salts and / or derivatives thereof; and their medical use, e.g. in the treatment of hypoglycemia. In particular, the present invention relates to stable aqueous liquid formulations of glucagon analogues comprising a combination of excipients that make them suitable for long-term storage as liquids and capable of being used in single dose (SD) or multiple dose (MD) formulations.

The present disclosure relates to the discovery of small molecule compounds that act as GLP-1R agonists and / or as positive allosteric modulators (PAMs) of GLP-1R. Such compounds are useful to treat, ameliorate, and / or prevent insulin resistance and / or diabetes in a mammal.

The invention relates to a biological preparation prepared from astragalus polysaccharide and application of the biological preparation. The biological preparation comprises the following components: traditional Chinese medicine components: 15-20g of an astragalus-codonopsis pilosula-lucid ganoderma co-extract, 10-15g of an astragalus-atractylodes macrocephala-Chinese yam co-extract, 8-12g of an astragalus-medlar-dendrobe co-extract, 6-10g of an astragalus-ginseng-polygala tenuifolia co-extract and 5-8g of an astragalus-coptis-kudzu vine root co-extract; the biological preparation comprises the following components: recombinant human interferon alpha-2b150-200IU, 0.03-0.05 mg of an anti-PD-1 antibody fragment, 0.08-0.1 [mu] g of a brain-derived neurotrophic factor (BDNF) and 0.05-0.1 mg of a glucagon-like peptide-1 (GLP-1) analogue, and by means of multi-target linkage, traditional Chinese medicine polysaccharide synergistic protection of the biological preparation, dynamic dosage regulation and the like, the treatment effect on complex diseases is improved, and the dosage and side effects of the biological preparation are reduced.

Described herein are compositions including at least one of lotus leaf extract (LLE), Chrysanthemum morifolium extract (CME), and Pu'er tea extract (PTE) having an agonistic effect on glucagon-like peptide-1 receptor (GLP-1R). Also, described herein are compositions including a mixture of LLE, CME and PTE. Methods of using the described compositions, e.g., for supporting weight loss efforts in a subject in need of thereof are also described.

The utility model relates to the technical field of blood glucose regulation equipment, in particular to a pumping device for diabetic patients, which is used for infusion of insulin and glucagon and comprises a shell, a first medicine storage device, a second medicine storage device and a first injection device are arranged in the shell, a second injection device is arranged outside the shell, and the first injection device is connected with the second injection device. Insulin is arranged in the first medicine storage device, glucagon is arranged in the second medicine storage device, the first medicine storage device and the second medicine storage device are respectively provided with an injector, and the injectors are sequentially communicated with the first injection device and the second injection device through infusion tubes. The insulin and glucagon infusion device can be used for infusing insulin and glucagon, is convenient to use, and can help a diabetic to better manage the blood glucose level.

Provided herein are compounds comprising an ionic form of a GLP-1 receptor agonist, such as semaglutide, and a counterion thereof, additional esters and prodrug derivatives of semaglutide, and methods of use thereof.

In one embodiment, the present invention provides a compound of the formula: # imgabs0 # or a pharmaceutically acceptable salt thereof, as well as methods of using such compounds in the treatment of type 2 diabetes mellitus.

The present invention relates to a Korean microbiome-derived Clostridium butyricum strain having anti-obesity efficacy and a use thereof. The strain has an excellent effect of reducing the body weight and adipose tissue weight of experimental animals compared to a control group (strain-untreated) under high-fat diet conditions, has an excellent effect of reducing the content of total cholesterol, triglycerides, low-density lipoprotein (LDL), leptin, alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in serum, and has an excellent effect of reducing blood glucose and increasing the content of glucagon-like peptide-1 (GLP-1) in an oral glucose load test, and is thus expected to be effectively used as an ingredient in a composition for preventing, alleviating, or treating obesity and metabolic diseases caused by obesity.