193 results about "Glucagon" patented technology

Disclosed herein are methods for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity using a glucagon-like peptide-1 (GLP-1) receptor non-peptide agonist (NPA) compound selected from Compound 1, Compound 1a, Compound 2, Compound 3, pharmaceutically acceptable salts thereof, and hydrates of the compounds and pharmaceutically acceptable salts, by oral administration to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA. Also disclosed herein are uses of a GLP-1 receptor NPA compound for the manufacture of a medicament for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA.

Described herein is a composition comprising at least one of a lotus leaf extract (LLE), a chrysanthemum extract (CME), and a Pu'er tea extract (PTE), the composition having an agonistic effect on the glucagon-like peptide-1 receptor (GLP-1R). In addition, compositions comprising a mixture of LLE, CME, and PTE are described herein. Also described are methods of using the described compositions, e.g., for supporting weight loss efforts in a subject in need thereof.

The present application relates to heterobicyclic compounds having glucagon-like peptide receptor (GLP-1R) agonist activity, processes for their preparation, pharmaceutical compositions comprising them and their use as GLP-1R agonists or for the treatment or prophylaxis of GLP-1R associated diseases or disorders. In particular, the compounds of the present application are useful for body weight management, for lowering blood sugar and / or for the treatment or prevention of diabetes, diabetic complications, obesity, overweight, dyslipidemia, fatty liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH)), metabolic diseases, cardiovascular diseases, nervous system disorders, mental disorders, kidney diseases, etc. , gastrointestinal diseases, autoimmune diseases, inflammatory diseases, lung diseases, hypothalamic-pituitary-gonad axis related diseases or disorders, cancers and the like.

Provided herein are combinations comprising a glucagon-like peptide-1 receptor (GLP-1R) agonist and a thyroid hormone receptor beta (THRβ) agonist and methods comprising administering to a subject in need thereof such combinations.

The invention provides an application of synbiotics in preparation of a composition for improving glucagon-like peptide-1 (GLP-1). The composition comprises litchi polyphenol, probiotics and methionine. The probiotics comprise bifidobacterium animalis BCRC910645, bifidobacterium longum BCRC910812, or a combination of the bifidobacterium animalis BCRC910645 and the bifidobacterium longum BCRC910812, so that the content of the glucagon-like peptide-1 is increased.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention belongs to the technical field of medicines, and particularly provides a novel application of a theaflavin compound in preparation of a product for inhibiting dipeptidyl peptidase-4 (DPP-4), and the theaflavin compound is one or more of theaflavin-3-gallate (TF2A), theaflavin-3 '-digallate (TF3) and theaflavin (TF). The research systematically proves that TF2A, TF3 and TF have new application of inhibiting DPP-4 for the first time: in-vitro enzymology and fluorescence experiments show that theaflavin can inhibit DPP-4 and interact with DPP-4, and molecular docking further shows possible binding configuration and key action sites of theaflavin. In vivo, the activity of DPP-4 in serum and different tissues of high-fat diet mice can be reduced, serum glucagon-like peptide-1 (GLP-1) can be up-regulated, and glycometabolism and inflammatory phenotype can be improved. Therefore, the theaflavin compound disclosed by the invention can be applied to preparation of products for inhibiting DPP-4, and has a good development prospect.

The invention pertains to an inhalable dry powder formulation comprising a therapeutically effective amount of Glucagon-like peptide-1 (GLP-1) receptor agonist. Further, use of the inhalable dry powder formulation treatment of chronic weight management for people who are overweight or obese, with or without a weight-related comorbid condition. Further, a process for forming particles comprising a Glucagon- like peptide-1 (GLP-1) receptor agonist suitable for airborne inhalation.

The present invention relates to formulations of glucagon analogues or pharmaceutically acceptable salts and / or derivatives thereof; and their medical use, e.g. in the treatment of hypoglycemia. In particular, the present invention relates to stable aqueous liquid formulations of glucagon analogues comprising a combination of excipients that make them suitable for long-term storage as liquids and capable of being used in single dose (SD) or multiple dose (MD) formulations.

The present disclosure relates to the discovery of small molecule compounds that act as GLP-1R agonists and / or as positive allosteric modulators (PAMs) of GLP-1R. Such compounds are useful to treat, ameliorate, and / or prevent insulin resistance and / or diabetes in a mammal.

Described herein are compositions including at least one of lotus leaf extract (LLE), Chrysanthemum morifolium extract (CME), and Pu'er tea extract (PTE) having an agonistic effect on glucagon-like peptide-1 receptor (GLP-1R). Also, described herein are compositions including a mixture of LLE, CME and PTE. Methods of using the described compositions, e.g., for supporting weight loss efforts in a subject in need of thereof are also described.

The utility model relates to the technical field of blood glucose regulation equipment, in particular to a pumping device for diabetic patients, which is used for infusion of insulin and glucagon and comprises a shell, a first medicine storage device, a second medicine storage device and a first injection device are arranged in the shell, a second injection device is arranged outside the shell, and the first injection device is connected with the second injection device. Insulin is arranged in the first medicine storage device, glucagon is arranged in the second medicine storage device, the first medicine storage device and the second medicine storage device are respectively provided with an injector, and the injectors are sequentially communicated with the first injection device and the second injection device through infusion tubes. The insulin and glucagon infusion device can be used for infusing insulin and glucagon, is convenient to use, and can help a diabetic to better manage the blood glucose level.

The present invention relates to compositions comprising GLP-2 protein or variants thereof linked to extended recombinant polypeptide (XTEN), isolated nucleic acids encoding the compositions and vectors and host cells containing the same, and methods of making and using such compositions in the treatment of GLP-2-related conditions.

There is provided a pharmaceutical formulation useful for the treatment of a metabolic disorder or condition, the pharmaceutical formulation comprising a plurality of particles suspended in a carrier system, the particles: (a) having an average diameter based on weight, quantity or volume of between about 10 nm and about 700 [mu] m; and (b) comprises a solid core comprising at least one glucagon-like peptide-1 receptor agonist or a pharmaceutically acceptable salt thereof, said solid core being at least partially coated by an inorganic material coating comprising a mixture of (i) zinc oxide; and (ii) one or more other metal oxides and / or metalloid oxides, wherein the atomic ratio ((i): (ii)) is at least about 1: 10 and up to and including about 10: 1. The mixed oxide coated particles are preferably synthesized by vapor phase coating techniques, such as atomic layer deposition. The formulations may provide delayed or sustained release of a glucagon-like peptide-1 receptor agonist to treat metabolic disorders or conditions, such as type 2 diabetes and / or obesity, without burst release effects. The glucagon-like peptide-1 receptor agonist is preferably a liraglutide (liraglutide), and the glucagon-like peptide-1 receptor agonist is preferably a liraglutide (liraglutide).

Exemplary embodiments account for differing needs of a user over the menstrual cycle of the user to better control the blood glucose concentration of the user. The exemplary embodiments may be realized in control systems for medicament delivery devices that deliver medicaments, such as medicaments that regulate blood glucose concentration levels. Examples of such medicaments that regulate blood glucose concentration levels include insulin, glucagon, and glucagon peptide-1 (GLP-1) agonists. The exemplary embodiments are able to better tailor the dosages of the medicament delivered to the user with the medicament delivery device to reduce the risk of hyperglycemia and hypoglycemia and help reduce blood glucose concentration excursions.

The present invention relates to processes for obtaining glucagon-like-peptide-2 (GLP-2) analogues, such as glepaglutide. In particular, the processes described herein use a multi-step purification method of GLP-2 analogues synthesized by solid phase peptide synthesis (SPPS).

The subject matter disclosed herein is generally directed to methods and compositions for preventing, suppressing or treating obesity and / or obesity-induced disorders, specifically, select piperidine urea-derived compounds as a monotherapy or a combination therapy with glucagon-like peptide 1 (GLP-1 – SEQ ID NO: 1) receptor agonist and / or dual GLP-1 (SEQ ID NO: 1) and glucose-dependent insulinotropic polypeptide GIP (SEQ ID NO: 8) receptor agonist for the treatment of obesity.

This invention provides a polypeptide or a pharmaceutically acceptable salt thereof that may be useful in the treatment of type 2 diabetes (T2D), diabetes mellitus with obesity, obesity, and hyperlipidemia. [Solution] Provides a long-acting glucagon-like peptide-1 and a human glucose-dependent insulin secretion-stimulating polypeptide (GIP) biagonal agonist polypeptide.

The present application provides protease resistant glucagon-like peptide 1 (eGLP-1) peptides, as well as protease resistant dual agonist peptides directed against GLP-1R and GIPR, methods of making these peptides, as well as compositions comprising the protease resistant peptides and methods of treatment utilizing these peptides.

The invention relates to a pharmaceutical composition for use as a medicament, in the oral treatment of a disease, in particular a metabolic disease, said pharmaceutical composition comprising a Glucagon-like peptide-1 receptor agonist (GLP-1), and a system that can buffer the pH of the pharmaceutical composition to a value ranging from 4 to 8.

According to the GLP1R targeted radioactive probe, the preparation method and the application, the GLP1R targeted radioactive probe can be specifically combined with GLP1R, has the good in-vivo biological metabolism property, does not cause blood glucose reduction after being injected and is a potential glucagon-like peptide-1 receptor PET imaging probe. The GLP1R targeted radioactive probe is [68Ga] Ga-NOTA-1D32, [68Ga] Ga-NOTA-1D36, or [68Ga] Ga-NOTA-1D39, and the GLP1R targeted radioactive probe is a GLP1R targeted radioactive probe, or a GLP1R targeted radioactive probe, or a GLP1R targeted radioactive probe.

The present invention relates to nucleic acid constructs comprising a first polynucleotide encoding a signal peptide, and a second polynucleotide encoding a glucagon like-1 peptide (GLP- 1) receptor agonist; expression vectors and host cells comprising said nucleic acid constructs; methods for producing a GLP-1 receptor agonist; and fusion proteins comprising the signal peptide and a GLP-1 receptor agonist. The present invention also relates to Bacillus cells with reduced protease activities and to methods of producing recombinant proteins in said Bacillus cells.

Provided herein are compositions, systems, kits, and methods for detecting, in a DNA sample from a subject (e.g., overweight or obese subject), the presence of at least one polymorphism in the Neurobeachin (NBEA) gene. In particular embodiments, once at least one such polymorphism is detected, the subject is treated with, or provided with, a Glucagon-like peptide-1 receptor agonist (GLP-1RA).

The present disclosure relates to a drug combination and a method for the prevention and / or the treatment of a liver disease, the combination comprising lanifibranor or a deuterated form thereof and a GLP-1 / GIP / glucagon triple receptor agonist.

The present invention relates to fusion proteins comprising a GLP-1R (glucagon-like peptide-1 receptor) agonist and an FGF21 (fibroblast growth factor 21) compound, which are useful for the treatment of diabetes, obesity and other disorders of abnormal glycolipid metabolism.

The exemplary embodiments attempt to identify impending hypoglycemia and / or hyperglycemia and take measures to prevent the hypoglycemia or hyperglycemia. Exemplary embodiments may provide a drug delivery system for delivering insulin and glucagon as needed by a user of the drug delivery system. The drug delivery system may deploy a control system that controls the automated delivery of insulin and glucagon to a patient by the drug delivery system. The control system seeks among other goals to avoid the user experiencing hypoglycemia or hyperglycemia. The control system may employ a clinical decision support algorithm as is described below to control delivery of insulin and glucagon to reduce the risk of hypoglycemia or hyperglycemia and to provide alerts to the user when needed. The control system assesses whether the drug delivery system can respond enough to avoid hypoglycemia or hyperglycemia and generates alerts when manual action is needed to avoid hypoglycemia or hyperglycemia.

The present invention provides a method to identify and use compounds for the inhibition of abnormal or dysregulated hepatic glucose production that results in elevated blood glucose levels and associated metabolic disorders. The invention is based on the surprising discovery that the glucagon forms an obligate binding complex with aP2, which is necessary for activation of the glucagon G-coupled protein receptor.

This invention provides compounds suitable for oral administration that exhibit agonist activity at GIP and GLP-1 receptors. [Solution] The present invention provides compounds that are active in both the human glucose-dependent insulin-stimulating polypeptide (GIP) receptor and the glucagon-like peptide-1 (GLP-1) receptor. The present invention also relates to compounds that have a sustained action over a long period of time in each of these receptors. Furthermore, the present invention also relates to compounds that can be administered orally. These compounds may be useful in the treatment of type 2 diabetes mellitus ("T2DM"). These compounds may be useful in the treatment of obesity.

The invention discloses a group of GLP-1R transmembrane domain mimic peptides and application thereof, and belongs to the technical field of polypeptides. The invention aims to solve the technical problem of how to interfere formation of GLP-1R and IR heteropolymers and further realize targeted prevention or / and treatment of metabolic diseases such as type 2 diabetes mellitus, obesity, insulin resistance, fatty liver and the like. In order to solve the technical problem, the invention provides a polypeptide composition or polypeptide for interfering formation of GLP-1R and IR heteropolymers. The invention develops a transmembrane domain heterodimer regulation direction aiming at a brand new action interface of the heterodimer of a glucagon-like peptide-1 receptor (GLP-1R) and an insulin receptor (IR) for the first time. Meanwhile, the polypeptide provided by the invention can also influence the interaction between the GLP-1R and the polymer.

The present invention relates to combinations, pharmaceutical compositions and fusion molecules comprising an FGF21 (fibroblast growth factor 21) compound and a GLP-1R (glucagon-like peptide-1 receptor) agonist, with an optimized GLP-1R agonist / FGF21 compound activity ratio. The present invention also relates to the use of said combinations, pharmaceutical compositions and fusion molecules as medicaments, in particular for the treatment of obesity, overweight, metabolic syndrome, diabetes, diabetic retinopathy, hyperglycemia, dyslipidemia, non-alcoholic steatohepatitis (NASH) and / or atherosclerosis.