377 results about "Glucagon" patented technology

The invention relates to a bifidobacterium animalis subsp. Lactis YYSJ001 with a blood sugar reducing effect and application of the bifidobacterium animalis subsp. Lactis YYSJ001. The classification name of the strain is bifidobacterium animalis subsp. Lactis, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.33471. The invention further relates to a preparation method of the bifidobacterium animalis subsp. Lactis YYSJ001. The bacterial strain has good artificial gastric juice resistance, artificial intestinal juice resistance and intestinal tract adhesion ability, has an inhibition effect on numerous pathogenic bacteria such as escherichia coli, staphylococcus aureus, salmonella, klebsiella pneumoniae and quail chicken enterococcus, and can stimulate intestinal cells to generate glucagon-like peptide-1, so that the bacterial strain can be applied to preparation of various pathogenic bacteria. Diseases of diabetic mice can be effectively improved, and the compound can be used for preparing products for preventing and treating diabetes or assisting in reducing blood sugar.

Disclosed herein are methods for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity using a glucagon-like peptide-1 (GLP-1) receptor non-peptide agonist (NPA) compound selected from Compound 1, Compound 1a, Compound 2, Compound 3, pharmaceutically acceptable salts thereof, and hydrates of the compounds and pharmaceutically acceptable salts, by oral administration to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA. Also disclosed herein are uses of a GLP-1 receptor NPA compound for the manufacture of a medicament for treating a subject with T2DM, obesity, or overweight with at least one weight related comorbidity to maintain body weight loss or reduced HbA1c levels resulting from a prior treatment with a GLP-1 RA.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

Methods for enhancing weight loss, or preventing or treating obesity or other conditions related thereto, such as diabetes, involve administering a GLP-1 agonist together with, or prior to, administering a mitochondrial uncoupler. Use of the uncoupler increases weight loss and enhances treatment of obesity and obesity-related medical conditions, such as by preventing weight regain after cessation of administration of the GLP-1 agonist.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The present disclosure provides a pharmaceutical composition for the prevention or treatment of neurodegenerative disorders comprising a phosphodiesterase 5 inhibitor and a glucagon-like peptide 1 (GLP-1) receptor agonist or a dipeptidyl peptidase IV (DPP-4) inhibitor as active ingredients. The phosphodiesterase 5 inhibitor is selected from mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and pharmaceutically acceptable salts, solvates and hydrates thereof. The GLP-1 receptor agonist is selected from semaglutide, exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, tirzepatide, cotadutide, and taspoglutide. The DPP-4 inhibitor is selected from sitagliptin, vildagliptin, saxagliptin, linagliptin, gemigliptin, teneligliptin, alogliptin, evogliptin, and anagliptin. The combination exhibits synergistic effects in reducing intracellular Aβ42, IL1β, and TNFα levels compared to the individual compounds alone.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

Described herein is a method of treating a disease or condition, for example, obesity, weight gain, or diabetes, comprising administering to a subject in need thereof a glucose-dependent insulinotropic polypeptide receptor (GIPR) antagonist and a glucagon-like peptide 1 receptor (GLP-1R) agonist. Further described herein are pharmaceutical compositions comprising a GIPR antagonist and a GLP-1R agonist, which may be useful in the treatment of a disease or condition, for example, obesity, weight gain, or diabetes.

The invention relates to a lactobacillus rhamnosus YYSJ019 strain for relieving obesity and application of the lactobacillus rhamnosus YYSJ019 strain. The lactobacillus rhamnosus YYSJ019 strain is classified and named as lactobacillus rhamnosus, and the preservation number of the lactobacillus rhamnosus YYSJ019 strain is CGMCC (China General Microbiological Culture Collection Center) No.33472. The strain has good tolerance and high surface hydrophobicity in gastric juice, and has the potential of smoothly entering the gastrointestinal tract of a human body; the bacterial strain has excellent intestinal adhesion capability, and provides a basis for continuously playing a probiotic effect; the strain can slow down weight gain of obese mice and improve fat accumulation, liver injury and inflammation in bodies of the obese mice; the blood sugar metabolism capability and the blood fat metabolism capability can also be improved, and the potential of preventing and treating hyperglycemia or hyperlipidemia is achieved; in addition, a mouse small intestine endocrine cell line (STC-1 cell line) can be stimulated to generate the glucagon-like peptide-1, and the glucagon-like peptide-1 has the potential of improving diseases caused by insufficient secretion of the glucagon-like peptide-1; the effects of reducing uric acid in vitro and reducing uric acid in vivo are achieved, and the potential of preventing and treating hyperuricemia is achieved.

Described herein is a composition comprising at least one of a lotus leaf extract (LLE), a chrysanthemum extract (CME), and a Pu'er tea extract (PTE), the composition having an agonistic effect on the glucagon-like peptide-1 receptor (GLP-1R). In addition, compositions comprising a mixture of LLE, CME, and PTE are described herein. Also described are methods of using the described compositions, e.g., for supporting weight loss efforts in a subject in need thereof.

The present application relates to heterobicyclic compounds having glucagon-like peptide receptor (GLP-1R) agonist activity, processes for their preparation, pharmaceutical compositions comprising them and their use as GLP-1R agonists or for the treatment or prophylaxis of GLP-1R associated diseases or disorders. In particular, the compounds of the present application are useful for body weight management, for lowering blood sugar and / or for the treatment or prevention of diabetes, diabetic complications, obesity, overweight, dyslipidemia, fatty liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH)), metabolic diseases, cardiovascular diseases, nervous system disorders, mental disorders, kidney diseases, etc. , gastrointestinal diseases, autoimmune diseases, inflammatory diseases, lung diseases, hypothalamic-pituitary-gonad axis related diseases or disorders, cancers and the like.

The present application provides compounds that may be used as a glucagon-like peptide-1 receptors (GLP-1R) agonist, or pharmaceutically acceptable salts thereof. Also provided are pharmaceutical compositions containing such compounds, or pharmaceutically acceptable salts thereof. Methods of preparing these compounds and compositions, and methods of using these compounds and compositions to treat or prevent a disease or a condition mediated by GLP-1R, are also provided.

The invention relates to the technical field of polypeptide drugs for metabolic diseases, in particular to a glucagon-like peptide (GLP-1), a glucose-dependent insulinotropic polypeptide (GIP) and a glucagon (GCG) triple receptor agonist (protein). According to the triple receptor agonist protein provided by the technical scheme, weight reduction is achieved, meanwhile, lower side effects are shown, and drug compliance is enhanced. The triple receptor stimulant researched and developed by the technical scheme can be applied to preparation of medicines with the effects of losing weight, reducing lipid or reducing blood sugar, solves the technical problem that the existing GLP-1, GIP and GCG triple receptor stimulants are difficult to reduce side effects while reducing body weight, and breaks through the weight loss mode that the traditional medicines depend on appetite suppression; due to the unique action mechanism and good safety, a safer and more effective treatment scheme is provided for patients, and the medicine has wide market prospects and social benefits.

The invention pertains to pharmaceutical compositions containing a GIP (glucose-dependent insulino-tropic polypeptide) and GLP-1 (Glucagon-like peptide-1) receptor agonist. In particular, the invention provides pharmaceutical compositions containing tirzepatide. The pharmaceutical compositions according to the invention are physically and chemically stable, are easy to manufacture and suitable for parenteral administration. The invention further provides methods for making the same as specified in the claims.

Provided herein are combinations comprising a glucagon-like peptide-1 receptor (GLP-1R) agonist and a thyroid hormone receptor beta (THRβ) agonist and methods comprising administering to a subject in need thereof such combinations.

Described herein are protein-drug conjugates and compositions thereof that are useful, for example, for targeting glucagon-like peptide 1 receptor (GLP1R). In certain embodiments, provided are peptidomimetic payloads and linker-payloads and methods of making same. More specifically, GLP1 peptidomimetics, antibody-drug conjugates, and compositions which comprise anti-GLP1R antibodies and GLP1 peptidomimetic payloads and methods of treating GLP1R-associated conditions are provided.

The invention provides an application of synbiotics in preparation of a composition for improving glucagon-like peptide-1 (GLP-1). The composition comprises litchi polyphenol, probiotics and methionine. The probiotics comprise bifidobacterium animalis BCRC910645, bifidobacterium longum BCRC910812, or a combination of the bifidobacterium animalis BCRC910645 and the bifidobacterium longum BCRC910812, so that the content of the glucagon-like peptide-1 is increased.

Combinations of fatty acid synthesis (FASN) inhibitors and glucagon-like peptide-1 (GLP-1) agonists for treating NAFLD / MAFLD, NASH / MASH, liver fibrosis and / or liver cirrhosis.

A composition comprising a glucagon-like peptide 1 (GLP-1) agonist for sublingual or buccal administration, wherein the composition comprises one or more agents selected from the group consisting of; sodium glycodeoxycholate; sodium deoxycholate; carboxymethyl cellulose; sodium alginate; SNAC (salcaprozate sodium); a non-ionic ester alkoxylate (or alkanoic acid ester alkoxylate); and soy lecithin.

Provided herein are combinations comprising a glucagon-like peptide-1 receptor (GLP-1R) agonist and a thyroid hormone receptor beta (THRβ) agonist and methods comprising administering to a subject in need thereof such combinations.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention belongs to the technical field of medicines, and particularly provides a novel application of a theaflavin compound in preparation of a product for inhibiting dipeptidyl peptidase-4 (DPP-4), and the theaflavin compound is one or more of theaflavin-3-gallate (TF2A), theaflavin-3 '-digallate (TF3) and theaflavin (TF). The research systematically proves that TF2A, TF3 and TF have new application of inhibiting DPP-4 for the first time: in-vitro enzymology and fluorescence experiments show that theaflavin can inhibit DPP-4 and interact with DPP-4, and molecular docking further shows possible binding configuration and key action sites of theaflavin. In vivo, the activity of DPP-4 in serum and different tissues of high-fat diet mice can be reduced, serum glucagon-like peptide-1 (GLP-1) can be up-regulated, and glycometabolism and inflammatory phenotype can be improved. Therefore, the theaflavin compound disclosed by the invention can be applied to preparation of products for inhibiting DPP-4, and has a good development prospect.

Methods for intranasal delivery of a GLP-1 (glucagon-like peptide-1) drug, such as tirzepatide (TZP), using a formulation of the drug encapsulated in poly(lactic-co-glycolic acid) (PLGA) nanoparticles coated with chitosan (CS) and / or polyethylenimine-grafted chitosan (CSPEI) at an optimized condition for surface charge change and particle size control. The resulting formulation successfully provides dosing-dependent body fat loss in mice, showing a significant therapeutic effect.