423 results about "Genetic resources" patented technology

The invention belongs to the field of molecular biological identification, and particularly relates to a specific SNP (Single Nucleotide Polymorphism) site combination for identifying a Wuzhishan pig variety and application. The specific SNP site combination for identifying the Wuzhishan pig variety comprises 77 SNP sites, and the physical positions of the SNP sites are determined by sequence comparison based on a pig reference genome Sscrofa11.1. The specific SNP site combination is screened based on a method of combining whole genome association analysis with selection signal analysis so as to ensure the accuracy of site selection. The selected specific SNP site combination can rapidly realize accurate identification of the Wuzhishan pig variety on the gene level, and has significant application value in the aspects of genetic resource accurate protection and variety utilization of Hainan Wuzhishan pigs.

The invention discloses a gene PtoMYB20 for regulating and controlling salt tolerance and drought resistance of poplars. A nucleotide sequence of the gene comprises a sequence as shown in SEQ ID NO. 1. The gene interference fragment is introduced into a plant to obtain a silent transgenic plant, under the conditions of salt stress, drought stress and salt-drought composite stress, the H2O2 and MDA contents of the silent transgenic plant are lower than those of a wild plant, and the SOD and POD activities of the silent transgenic plant are higher than those of the wild plant, so that the damage degree of the plant is effectively reduced; the method is of great significance in improving salt tolerance and drought resistance of the poplar and relieving damage of adversity stress to forestry yield. The invention also discloses a breeding method of the transgenic poplar with strong salt tolerance and drought resistance, provides a new poplar germplasm which not only improves the stress resistance of the poplar but also does not influence the wood yield, and lays a theoretical and gene resource foundation for the stress-resistant molecular breeding of the poplar.

The invention relates to the technical field of bioinformatics, in particular to a goat selective breeding method and system based on a genetic algorithm, and the method comprises the following steps: based on goat population genetic initialization data, extracting a character characteristic index and a genetic relationship parameter of each pairing combination in a population, analyzing genetic diversity, character matching degree and genetic relationship, and calculating the genetic diversity, character matching degree and genetic relationship; and screening matched individuals and pairing hereditary characteristics, and rearranging and recombining to obtain primary pairing data of goat breeding. According to the method, genetic diversity and character matching degree are analyzed, genetic diversity and excellent character inheritance are balanced, genetic resource utilization efficiency is improved, local optimal combinations are accurately screened, genetic drift risks are reduced, character stability is enhanced, a two-point crossing rule and global character dynamic analysis are combined, and global breeding layout is optimized; according to the method, short-term improvement and long-term stability are both considered, the genetic structure is optimized through Pareto rule screening and global state updating, and the sustainability and accuracy of a breeding scheme are improved.

The present invention discloses a gene, GmCDK8, that negatively regulates soybean resistance to Phytophthora spp., and its applications. The disclosed GmCDK8 knockout soybean plants exhibit enhanced resistance to the fungus. Specifically, the results of the soybean cultivar "Williams 82," which lacks GmCDK8, under Phytophthora stress, including root lesion length, leaf lesion area, Phytophthora accumulation, and infected necrotic area on leaves, indicate that knocking out GmCDK8 significantly improves plant resistance to Phytophthora spp. Genetic engineering of this gene for plant resistance to Phytophthora root rot not only provides an important genetic resource for plant molecular breeding but also offers an effective means for achieving high plant yields.

The invention discloses a gene GmCDK8 for negative regulation and control of phytophthora sojae resistance and application of the gene GmCDK8. GmCDK8-knocked-out soybean plants disclosed by the invention enhance the resistance of soybeans to phytophthora sojae; the results of root scab length, leaf scab area, phytophthora accumulation amount, leaf infected and necrotic areas and the like of the soybean cultivar Williams 82 without the GmCDK8 under the stress of phytophthora show that the resistance of the plant to the phytophthora can be remarkably improved by knocking out the GmCDK8. Genetic engineering improvement of plant phytophthora root rot resistance is carried out through the gene, important gene resources are provided for plant molecular breeding, and an effective means is provided for high yield of plants.

The invention belongs to the field of plant genetic engineering, and discloses application of a PtNF-YB9 gene of trifoliate orange in drought-resistant genetic improvement of plants. The PtNF-YB9 gene is a transcription factor gene which is separated and cloned from Poncirus trifoliata, and the sequence of the PtNF-YB9 gene is as shown in SEQ ID NO. 1. The gene or the homologous gene thereof is knocked out or inhibited in a plant, the drought resistance of the plant is remarkably reduced, and the drought resistance of the plant is remarkably enhanced by overexpressing the gene or the homologous gene thereof. The development and utilization of the genetic resource are beneficial to reducing the agricultural production cost and realizing the green and environment-friendly agricultural goal.

The invention discloses application of an OsCPN10a gene in regulation and control of vigor, grain shape and drought tolerance of rice seeds, and belongs to the technical field of rice gene engineering. The invention particularly relates to the research of the OsCPN10a gene in the aspects of regulating and controlling the germination rate, the germination potential, the germination index, the grain length, the grain width, the thousand grain weight, the drought tolerance of the rice seeds and the like. Experimental results show that the grain shape of the OsCPN10a knockout mutant seed is obviously lengthened and widened, and the grain shape of the OsCPN10a overexpression seed is opposite; the yield of the Ocpn10a mutant is higher than that of a TNG67 plant; overexpression of the OsCPN10a has the potential of improving the drought resistance of the rice. The invention reveals that OsCPN10a affects genetic mechanisms such as rice seed vigor, grain length, grain width and storability, provides important gene resources and theoretical basis for genetic improvement of rice, and is beneficial to cultivation of a new rice variety with better grain shape and higher yield.

The invention discloses application of a rice OsbHLH083 gene in regulation and control of seed germination capability, and relates to the technical field of plant genetic engineering. The CDS sequence of the rice OsbHLH083 gene is as shown in SEQ ID NO. 2, and the amino acid sequence of the coded protein is as shown in SEQ ID NO. 3. The molecular biology function of the rice OsbHLH083 gene for regulating rice germination is studied, after the rice OsbHLH083 gene is edited through CRISPR / Cas9, compared with a wild type, the rice OsbHLH083 gene mutant rice seeds germinate slower, the rice OsbHLH083 gene and a protein coded by the rice OsbHLH083 gene can be used for regulating the phenotype of seed germination, and the rice OsbHLH083 gene mutant rice seeds germinate more slowly. And a gene resource is provided for the genetic improvement of rapid germination and seedling formation characters of the direct seeding rice seeds in the field.

The invention belongs to the technical field of agricultural biology, and particularly relates to a transcription factor StBSB with a regulation effect on steroid glycoalkaloid accumulation of potatoes and application of the transcription factor StBSB, the transcription factor StBSB is encoded by a potato gene Soltu.DM.05G001620, and the nucleotide sequence of the potato gene Soltu.DM.05G001620 is shown as SEQ ID NO.1. The invention further discloses a preparation method of the transcription factor StBSB. According to the application, a new insight is provided for understanding a transcriptional regulation mechanism of SGAs in solanaceae plants, and a key theoretical basis and genetic resources are provided for directionally improving the content of anti-nutritional compounds through genetic means.

The invention belongs to the technical field of agricultural biology, and particularly relates to a sisal hemp Aux / IAA gene and application of protein of the sisal hemp Aux / IAA gene in plants. The sisal hemp Aux / IAA gene provided by the invention comprises a first SNP (Single Nucleotide Polymorphism) site or a second SNP site. Research finds that the Aux / IAA gene can increase the number of the vascular tissues of the plant, construct a plant model related to the vascular tissues and cultivate the multi-vascular tissue plant; the first SNP site or the second SNP site on the gene is significantly related to the number of vascular bundles of sisal hemp leaves, and can be used for screening and cultivating multi-vascular tissue plants, thereby providing a theoretical basis and gene resources for genetic breeding.

The invention relates to a wheat stem rot regulatory gene Tatrx-m, and an encoding protein, a recombinant vector and an application of the wheat stem rot regulatory gene Tatrx-m. The genomic sequence of the gene is SEQ ID NO.1, the CDS sequence of the gene is SEQ ID NO.2, and thioredoxin shown as SEQ ID NO.3 is encoded. The invention further provides a specific primer pair used for gene identification, a silent vector (Tatrx-m-VIGS) and an overexpression vector (LGY-OE3-Tatrx-m) are constructed, and the function of the primer pair is verified through a virus-induced gene silencing (VIGS) technology and agrobacterium-mediated transformation of wheat. Experiments show that silence of Tatrx-m results in significant reduction of wheat stem rot resistance, and overexpression of the gene can improve resistance. Based on hypha quantification, DAB staining, H2O2 content and cell death analysis, Tatrx-m is revealed to enhance wheat resistance by regulating active oxygen removal and cell wall strengthening pathways. The gene TaTrx-m has the positive regulation effect in wheat stem rot for the first time, can be applied to disease-resistant molecular marker development, gene editing and transgenic breeding, provides core genetic resources for disease-resistant variety breeding, and has theoretical and application values.

The invention belongs to the technical field of plant molecular biology, and discloses an application of a soybean GmSW10 gene in reducing soybean plant height, grain weight and grease content and / or increasing protein content. The CDS sequence of the soybean GmSW10 gene is as shown in SEQ ID NO: 1. Knockout of the soybean GmSW10 gene can directly influence the plant height, the grain weight, the oil content and the protein content of soybean seeds, after the soybean GmSW10 gene is knocked out, the weight of soybean seeds and hundred grains is remarkably reduced, the plant height is reduced, the protein content is increased, and the oil content is reduced, which indicates that the GmSW10 gene is a key gene for regulating and controlling the plant height, the grain weight, the oil content and the protein content of the soybean, and the GmSW10 gene can be used for preparing the soybean GmSW10 gene for regulating and controlling the plant height, the grain weight, the oil content and the protein content of the soybean. And a new genetic resource is provided for genetic improvement of soybeans.

The invention provides a local livestock and poultry variety identification method based on an SNP marker, and relates to the field of variety identification, and the method comprises the following steps: S1, genotype data acquisition, S2, genotype data quality control, S3, variety identification standard library establishment, and S4, bloodline content evaluation. According to the method, on the basis of a standardized molecular identification analysis process of genomic SNP marker bloodline content evaluation, genotype information of a core SNP site is analyzed, so that whole analysis process processing from original genotyping data to variety identity judgment is realized; the method can provide standardized, convenient and efficient molecular detection technical support for protection and utilization of genetic resources of local livestock and poultry in China, germplasm innovation and industrial development.

The invention belongs to the technical field of biology, and particularly relates to a TaGAT2-1B gene resistant to wheat stripe rust and application of the TaGAT2-1B gene, and the nucleotide sequence of the TaGAT2-1B gene is shown as SEQ ID NO.3. It is found that the TaGAT2-1B gene and the encoding protein thereof can effectively improve the wheat stripe rust resistance, the TaGAT2-1B gene is a new stripe rust resistance gene in the wheat adult-plant stage, infection of various stripe rust strains can be effectively resisted, the field phenotype of the TaGAT2-1B gene shows the characteristic of slow rust, and the TaGAT2-1B gene and the encoding protein thereof have good application prospects. The discovery of the gene provides a new genetic resource for the research of the wheat stripe rust resistance mechanism and the wheat stripe rust resistance breeding.

The invention relates to the technical field of biology, in particular to a primer combination for identifying Leyping spotted pigs and an identification method of the primer combination, six specific SNP molecular markers (SNP1-SNP6) are obtained through whole genome screening, six pairs of specific PCR primers are designed and developed on the basis of the sites, the nucleotide sequences of the primers are shown as SEQ ID NO.1-12, and the primer combination is used for identifying the Leyping spotted pigs. And when the genotypes of the to-be-detected sample at the SNP1-SNP6 sites are CC, TT, TT, AA, CC and GG respectively, the to-be-detected sample can be confirmed as a purebred individual of the Licping spotted pig. Compared with a traditional phenotype identification method, the molecular marker detection system established by the invention has the advantages of high detection efficiency, good accuracy and flux. The technical scheme provided by the invention provides important technical support for genetic resource conservation, variety purity identification and genetic improvement of the Leyping spotted pigs, and has remarkable application value in the field of livestock breeding.

The invention discloses application of a watermelon WRKY transcription factor ClWRKY60 in drought stress resistance, and belongs to the technical field of gene engineering. The invention discloses an application of a watermelon WRKY transcription factor ClWRKY60 in drought stress resistance. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is as shown in SEQ ID NO. 1. The WRKY transcription factor ClWRKY60 is a positive regulation factor of watermelon responding to drought stress, the gene can provide gene resources for creation of drought-resistant new germplasm and breeding of special high-resistance new varieties, and meanwhile, the gene has very important scientific and production application significance for promoting resistance breeding, improving economic benefits of watermelons and the like.

The invention provides application of a poplar PtoHsfB1 gene in plant growth, and belongs to the technical field of gene engineering. The function of promoting plant growth of the populus tomentosa gene PtoHsfB1 is found for the first time. Experimental results show that the expression quantity of the PtoHsfB1 gene in the transgenic populus tomentosa is greatly improved compared with that of non-transgenic populus tomentosa, the height, dry weight and fresh weight of a transgenic plant are higher than those of a non-transgenic plant, ABA synthesis and signal transduction can be reduced through overexpression of the gene PtoHsfB1, growth and development of the populus tomentosa are promoted, and the yield of the populus tomentosa is increased. Therefore, a new genetic resource is provided for improvement and molecular breeding of the poplar and other woody plants.

The invention belongs to the field of biotechnology and livestock breeding, and relates to an SNP (Single Nucleotide Polymorphism) molecular marker closely related to sheep weight traits, a primer group, a kit and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.4, and Ggt exists at the 46th bp position of the sequence as shown in SEQ ID NO.4; c mutation. According to the method, the sheep population with excellent genetic resources can be rapidly established by rapidly and accurately detecting the SNP marker related to the weight character of the sheep genetic resource population of the'Auodur Lake ', so that the marker-assisted selection breeding process of the weight character of the sheep is accelerated.

Higher LOG L1 transcript abundance correlates with lower grain weight under HNT stress. This is supported by higher grain weight of log l1 mutants relative to wild type plants under HNT stress. This finding provides a genetic resource to increase rice adaptation to warming nights. This disclosure describes a novel nucleic acid sequence that, when expressed in a plant (e.g., rice), regulates grain weight and grain number. This disclosure also describes mutant plants and transgenic plants.

The invention discloses a method for separating and transplanting spermatogonial stem cells of Chinese sturgeons, and belongs to the technical field of separation of germline stem cells of fishes. The separation method comprises the following steps: washing Chinese sturgeon testis tissues with an L-15 culture medium containing penicillin / streptomycin double antibodies, and carrying out physical shearing, digestive enzyme enzymolysis and screen filtration to obtain a Chinese sturgeon testis cell suspension; performing percoll density gradient centrifugation to obtain high-purity spermatogonial stem cells of the Chinese sturgeons; and dyeing, washing, resuspending and carrying out micro-injection transplantation to enter the gonad primordium reproductive ridge part of the juvenile acceptor fish. According to the physical characteristics of the spermatogonial stem cells of the Chinese sturgeons, the spermatogonial stem cells with high purity are obtained by adopting percoll density gradient centrifugation, and the purpose of abdomen borrowing reproduction is achieved by adopting a microinjection mode, so that the preservation of germ cells of endangered fishes and the reconstruction of artificial populations are realized; and a new technical approach is provided for protecting genetic resources of the Chinese sturgeons and breaking through artificial propagation bottlenecks.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a sweet potato IbGSTU7 gene for regulating and controlling drought resistance and skin color of sweet potatoes and application of the sweet potato IbGSTU7 gene, the nucleotide sequence of the sweet potato IbGSTU7 gene is shown as SEQ ID NO.1, and the amino acid sequence of the sweet potato IbGSTU7 gene is shown as SEQ ID NO.2. According to the invention, the IbGSTU7 gene is successfully cloned from sweet potatoes for the first time, and the positive regulation effect of the IbGSTU7 gene on the color of sweet potato skins and the positive influence on drought resistance are confirmed. A new genetic resource is provided for sweet potato variety improvement, and research and development of a new variety of high-quality and drought-resistant sweet potatoes can be promoted so as to meet agricultural production and market requirements. By deeply analyzing the potential effect of the IbGSTU7 gene in sweet potato anthocyanin synthesis and drought resistance, a new gene resource and theoretical basis are expected to be provided for sweet potato quality improvement and stress resistance breeding, and the IbGSTU7 gene has important significance in accelerating breeding of sweet potato varieties with high anthocyanin content and stress resistance.

The invention provides application of a transcription factor LcNF-YB3 of lycoris chinensis in regulating and controlling the flowering time of plants, and belongs to the technical field of molecular breeding. The invention provides a lycoris chinensis transcription factor LcNF-YB3. The amino acid sequence of the lycoris chinensis transcription factor LcNF-YB3 is as shown in SEQ ID NO: 1. The Lycoris chinensis transcription factor LcNF-YB3 delays plant flowering through forward regulation, the flowering time of an arabidopsis thaliana plant for heterologous expression of LcNF-YB3 is delayed, rosette leaves are increased, and the flowering time of the plant Lycoris chinensis is obviously advanced by silencing the LcNF-YB3 gene in Lycoris chinensis. The Lycoris chinensis transcription factor LcNF-YB3 can effectively regulate and control the flowering time, solves the problems of asynchronous flowering phases and the like in breeding, and provides a new genetic resource for the improvement of Lycoris and other bulb flower varieties.

The invention discloses a tomato Solyc08g008190 gene and a tomato Solyc08g008200 gene and application of the tomato Solyc08g008190 gene and the tomato Solyc08g008200 gene. A CDS (Coding Sequence) sequence of the Solyc08g008190 gene is shown as SEQ ID NO. 1, and a CDS sequence of the Solyc08g008200 gene is shown as SEQ ID NO. 2. A tomato transporter mutant library is constructed through a CRISPR (clustered regularly interspaced short palindromic repeats) technology, and a mutant 0990-32 which simultaneously covers expression of two homologous genes of an NHE family is screened. Based on observation of the phenotype of the mutant, the inventor preliminarily determines that the two genes are related to tomato fruit quality and fruit volume increase. Compared with a wild type, the tomato fruit of the mutant has the advantages that the brix content is increased, and the fruit becomes larger. It is shown that the Solyc08g008190 gene and the Solyc08g008200 gene play an important role in regulating and controlling the growth, development and quality of the tomato fruits. The invention lays a good gene genetic resource foundation for the cultivation of new varieties of high-quality tomatoes.

The invention discloses a CAPS molecular marker of a GhFRO7 gene of upland cotton and application of the CAPS molecular marker in early blossoming character identification and breeding, and belongs to the field of molecular biology. Whole genome association analysis is carried out based on a high-density SNP marker, an SNP site which is located on an upland cotton GhFRO7 gene and is remarkably related to the flowering time character is identified and obtained, and then a CAPS molecular marker with the sequence shown as SEQ ID NO.34 and a primer pair with the sequence shown as SEQ ID NO.3-4 are developed. The CAPS molecular marker and the primer pair thereof provided by the invention can be applied to identification of early flowering upland cotton varieties and molecular marker-assisted selective breeding, and can effectively save the detection cost, shorten the period and improve the detection efficiency. The invention provides a new method for genetic improvement of cotton prematurity, and provides important genetic resources for developing cotton varieties adapting to specific climate conditions.

The invention belongs to the technical field of agricultural biology, and particularly discloses a molecular marker site related to gray mold resistance of Chinese roses and application of the molecular marker site. Specifically, the invention provides application of an SNP site in Chinese rose gray mold resistance molecular marker assisted breeding. The SNP loci are located at the 74bp site and the 108bp site from the 5'end of a sequence shown as SEQ ID NO.1, and when basic groups of the two loci present GT, the germplasm is judged as the germplasm with high gray mold resistance. Through analysis of a plurality of germplasm resources, it is found that the haplotype is GT, the germplasm has a smaller scab area and shows higher gray mold resistance, and the germplasm with high gray mold resistance is obtained. The method is mainly derived from genetic resources of Asian wild type and ancient Chinese varieties, and by means of the technical scheme, the breeding process can be accelerated, and Chinese rose germplasm with disease resistance can be rapidly obtained.

The invention discloses an application of a Solyc02g060560 gene in regulation and control of sugar content and size of tomato fruits, wherein a CDS (Coding Sequence) sequence of the Solyc02g060560 gene is as shown in SEQ ID NO. 1. A tomato transcription factor mutant library is constructed through a CRISPR (clustered regularly interspaced short palindromic repeats) technology, and a mutant TOM6-126 with unknown functions at present in a C2H2 family is screened. Based on observation of the phenotype of the mutant, the inventor determines that the gene is related to the sugar content and the fruit size of tomato fruits. Compared with a wild type, the soluble solid content (brix) of tomato fruits of the mutant is increased, and the fruits become larger. It is indicated that the Solyc02g060560 gene plays an important role in negative regulation of tomato fruit growth and development and sugar content. According to the invention, a good gene genetic resource foundation is laid for the cultivation of a new variety of tomatoes with high sugar content.

The invention belongs to the technical field of gene engineering, and particularly relates to application of a wheat gene to regulation and control of plant drought tolerance. The wheat gene provided by the invention is a TaANK-TPR44 gene, and the nucleotide sequence of the TaANK-TPR44 gene is as shown in SEQ ID NO. 1. In order to develop the specific functional characteristics of ankyrin genes from different plant sources, the TaANK-TPR44 gene is over-expressed and transformed into arabidopsis thaliana for functional verification, and the result shows that the drought tolerance of the arabidopsis thaliana with the over-expressed TaANK-TPR44 gene is remarkably improved compared with that of wild arabidopsis thaliana, and the drought tolerance of the arabidopsis thaliana with the over-expressed TaANK-TPR44 gene is remarkably improved compared with that of wild arabidopsis thaliana. Therefore, the TaANK-TPR44 gene plays a positive regulation role in the wheat drought tolerance process, a theoretical basis and gene resources are provided for wheat molecular breeding, and the TaANK-TPR44 gene has very important significance for obtaining drought-tolerant high-yield strains and improving the wheat drought tolerance in the future.

The invention belongs to the technical field of biology, and discloses a cattle SNP chip and application thereof, the detection object of the liquid phase chip comprises 7,829 SNP sites located on a common cattle reference genome AR-UCD 1.2, and the position information of the SNP sites is shown in the specification table 3. The liquid chip provided by the invention highlights the specificity of the local cattle variety in the Tibet autonomous region, and by analyzing the local cattle population structure, sites capable of effectively distinguishing the population are screened, so that the problems of strong universality and poor specificity of a commercial chip are solved. The liquid-phase chip can also realize flexible selection and upgrading of sites, and breaks through the limitation that a solid-phase chip cannot flexibly supplement or update the sites. The whole method can be stably operated on the premise of limited sample size and complex population structure, and is suitable for genetic resource protection and application scenarios of rare varieties. The method can also be expanded into a standardized typing tool, and is suitable for various applications such as local cattle germplasm registration, variety identification, region identification and the like.

The invention relates to the field of genetic engineering and molecular biology, in particular to application of an SlGT2 gene in regulation and control of plant dwarfing. The nucleotide sequence of the SlGT2 gene is a nucleotide sequence as shown in SEQ ID NO: 1. The expression level of the SlGT2 gene is regulated and controlled through an SlGT2 overexpression plant so as to research the regulation and control mechanism of the SlGT2 gene on the tomato plant height. Results show that stem cells of the SlGT2 overexpressed tomato plant become smaller, the stem node spacing is shortened, and the plant height is reduced. Gene resources are provided for cultivating new tomato dwarfing varieties, potential application value is achieved, and meanwhile a theoretical basis is laid for researching a tomato dwarfing molecular mechanism.