Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof

A powdery mildew resistance gene, pea technology, applied in the field of plant pathology and crop resistance genetic breeding, can solve the problem that the effectiveness of functional markers has not been verified

Inactive Publication Date: 2015-12-16
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Subsequently, based on different molecular marker techniques, Pavan et al. (2013) and Sun et al. (2015) developed functional molecular markers of the six alleles of er1, except that the functional markers of the alleles er1-5 and er1-6 have been inherited Validated in the population, the validity of the functional markers of the other 4 alleles has not been validated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof
  • Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof
  • Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1, the acquisition of the Indel marker InDel111-120 of the present invention

[0056] 1.1er1-7 feature flag development

[0057] According to the comparative analysis of the PsMLO1 candidate gene sequences of the resistant variety G0003967 and the susceptible variety Bawan 6 and the wild-type PsMLO1 sequence (FJ463618) (Humphry et al., 2011), it was found that the open reading frame 111-120 of the PsMLO1 cDNA sequence of G0003967 The base deletion, which has not been reported yet, is a new variant of PsMLO1. This result indicates that G0003967 contains a new powdery mildew resistance allele, named er1-7. According to the 10bp deletion on the first exon of the PsMLO1 gene of G0003967, the upstream and downstream primers were designed with PrimerPremier5.0 software to develop InDel functional markers, and the Indel markers were named InDel111-120.

[0058] The nucleotide sequence of the upstream and downstream primers of the Indel marker InDel111-120 is as follow...

Embodiment 2

[0070]Embodiment 2, the assembly of kit of the present invention

[0071] Based on the Indel marker InDel111-120 obtained in Example 1, the kit described in the present invention was assembled. The kit includes upstream and downstream primers having sequences shown in SeqID No.1 and SeqID No.2 for amplifying the Indel marker InDel111-120.

[0072] The kit also includes conventional reagents for PCR reactions and / or electrophoresis. Specifically, the conventional reagents used for PCR reaction include: dNTPs, TaqDNA polymerase, Mg 2+ , PCR reaction buffer, standard positive template, double distilled water, etc., can also be common commercially available PCR kits, PCR reaction Mix, etc.; the conventional reagents for electrophoresis include: TE buffer, polyacrylamide , agarose, tetramethylethylenediamine, formaldehyde, silver nitrate, etc.

Embodiment 3

[0073] Example 3, Verification and application of the Indel marker or kit of the present invention

[0074] 1.1 Validity verification and screening application of the Indel marker or kit of the present invention in screening hybrid offspring containing gene er1-7

[0075] Use the Indel marker InDel111-120 obtained in Example 1 or the kit obtained in Example 2 for population verification to identify the F 1、 f 2 The genotype of each individual plant in the population. InDel111-120 in all F 1 Two target bands were amplified in the plants, which were 183bp and 193bp respectively. InDel111-120 in F 2 There are three situations in the amplification results of individual plant materials in the population: homozygous disease-resistant genotype (183bp), homozygous disease-resistant genotype (193bp) and heterozygous genotype (183bp, 193bp). Band type and F 2 There is a one-to-one correspondence between the traits and phenotypes of the population. The three genotypes shown corres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an Indel mark InDel111-120 co-separated with a powdery mildew resistance allele er1-7 of peas and application thereof, and belongs to the field of plant pathology and crop disease resistance genetics and breeding. A primer for amplifying the Indel mark has the following nucleotide sequence of InDe1111-120-F:GGAGTTAAGGAACGAACTTTGG, InDel111-120-R:CCATGTCTGCGTCTGTATCTTT; a characteristic strip of the Indel mark which is amplified by the primer and co-separated with the powdery mildew resistance allele erl-7 adopts 183bp, and the nucleotide sequence is shown as Seq ID No.3. The invention further provides a kit for screening a pea genetic resource containing the er1-7 gene on the basis of the Indel mark. By adopting the Indel mark or the kit, the pea resource containing the resistance allete er1-7 can be rapidly and precisely distinguished out, so that the mark or the kit can be effectively applied to molecular assisted selection of the powdery mildew resistance of the peas, high efficiency, precision, convenience and rapidness are achieved, the breeding cycle is greatly shortened, and the breeding process is sped up.

Description

technical field [0001] The invention belongs to the fields of plant pathology and genetic breeding for crop disease resistance, and specifically relates to an Indel marker co-separated with pea powdery mildew resistance er1 allele er1-7 and application thereof. Background technique [0002] Pea powdery mildew caused by Erysiphepisi D.C. is an important disease worldwide. It causes 25%-50% yield loss in production, and the loss of severely infected pea varieties can reach more than 80% (Nisar et al., 2011; Fondevilla et al., 2012). Pea powdery mildew occurs in both southern and northern pea producing areas of my country. Under favorable climatic conditions, the infection rate of susceptible varieties can be as high as 100%, greatly affecting the yield and quality of pea, and causing serious economic losses (Peng Huaxian et al., 1991). [0003] Planting disease-resistant varieties is the most economical, effective and environmentally safe way to control pea powdery mildew. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor孙素丽朱振东邓东王仲怡李银萍段灿星武小菲王晓鸣
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI