Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

48 results about "Plant pathology" patented technology

Plant pathology (also phytopathology) is the scientific study of diseases in plants caused by pathogens (infectious organisms) and environmental conditions (physiological factors). Organisms that cause infectious disease include fungi, oomycetes, bacteria, viruses, viroids, virus-like organisms, phytoplasmas, protozoa, nematodes and parasitic plants. Not included are ectoparasites like insects, mites, vertebrate, or other pests that affect plant health by eating of plant tissues. Plant pathology also involves the study of pathogen identification, disease etiology, disease cycles, economic impact, plant disease epidemiology, plant disease resistance, how plant diseases affect humans and animals, pathosystem genetics, and management of plant diseases.

Phytophthora capsici pectate lyase (PL) Pcpel1 gene, protein preparation method and application thereof

The invention belongs to the technical field of biology and in particular provides a pectate lyase (PL) gene Pcpel1 which is cloned from phytophthora capsici and protein preparation technology thereof. Gene and protein levels prove that the gene is effectively involved in the process that the phytophthora capsici infects hot pepper hosts and results in occurrence of the course of diseases on hot pepper leaves. Plant pathology and cytochemistry technology further prove that after the protein coded by the gene is inoculated onto the hot pepper leaves, obvious withering and shrinking occur on theinoculated parts of the leaves and the cell walls on the affected parts of the leaves are obviously degraded, namely the gene code is an important protein related to the course of diseases or is possibly an important target pathogenic gene of a phytophthora capsici PL gene cluster. The invention provides important technical reserve for further developing phytophthora capsici molecule detection technology.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof

The invention relates to an Indel mark InDel111-120 co-separated with a powdery mildew resistance allele er1-7 of peas and application thereof, and belongs to the field of plant pathology and crop disease resistance genetics and breeding. A primer for amplifying the Indel mark has the following nucleotide sequence of InDe1111-120-F:GGAGTTAAGGAACGAACTTTGG, InDel111-120-R:CCATGTCTGCGTCTGTATCTTT; a characteristic strip of the Indel mark which is amplified by the primer and co-separated with the powdery mildew resistance allele erl-7 adopts 183bp, and the nucleotide sequence is shown as Seq ID No.3. The invention further provides a kit for screening a pea genetic resource containing the er1-7 gene on the basis of the Indel mark. By adopting the Indel mark or the kit, the pea resource containing the resistance allete er1-7 can be rapidly and precisely distinguished out, so that the mark or the kit can be effectively applied to molecular assisted selection of the powdery mildew resistance of the peas, high efficiency, precision, convenience and rapidness are achieved, the breeding cycle is greatly shortened, and the breeding process is sped up.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Method for preserving primary colors of red and yellow plant disease specimens

The invention provides a method for preserving the primary colors of red and yellow plant disease specimens. The method comprises the following steps: (1) collecting, finishing and sterilizing the plant disease specimens; (2) carrying out color fixation; (3) carrying out color repairing; (4) preserving the primary colors. The method creatively comprises the three color processing steps, i.e., color fixation, color repairing and primary color preservation, and the specimens of two colors can be preserved by using one method. The raw materials used in the method are safe and environment-friendly; the method is simple and easy to implement as well as time-saving and labor-saving, can be used for making while collecting, can realize batch production, and is used for preserving the original shapes and primary colors of the specimens; the preserving fluid is clear and transparent; therefore, the method has positive practical significance for application in the field of plant pathology teaching and scientific research.
Owner:GUANGXI AGRI VOCATIONAL COLLEGE

Cotton fungal endophyte CEF-082 and application of cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt

The invention relates to phytopathology, in particular to cotton fungal endophyte CEF-082 and an application of the cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt. The preservation serial number of the cotton fungal endophyte CEF-082 is CGMCCNo.11313; the suppression rate of the metabolite of the CEF-082 to colony growth of the cotton verticillium wilt reaches 100%, and the suppression rate to the conidium yield is 70.73%. Greenhouse experimental results show that cotton is pre-inoculated through CEF-082 culture filtrate when true leaves of cotton seedlings appear for the first time, and the control effect on the cotton verticillium wilt is 62.37%; the corn sand grain culture of the CEF-082 is connected into a matrix at the percentage of 2%, and then the cotton seedlings are cultivated, so that the control effect on the cotton verticillium wilt is 66.88%. Compared with bacillus subtilis which is greatly used in production, the control effect is increased by 30.7% on average; the expressions of defense related genes beta-1,3-glucanase, POD, PPO, PAL and the like are improved by inoculating the cotton through the CEF-082, hence, the resistance of plants to the cotton verticillium wilt is enhanced, and the damage of pathogenic bacteria is reduced.
Owner:中农科创(河南)生物科技有限公司

Quantitative dip in bacterial suspension method for identifying resistance to cotton verticillium wilt using vermiculite sandy soil bottomless bowl of paper

The invention relates to the plant pathology field, and specially relates to a quantitative dip in bacterial suspension method for identifying resistance to cotton verticillium wilt using vermiculite sandy soil bottomless bowl of paper. The method in the invention includes the following steps: 1) making a nutrient bowl by mixing vermiculite and sandy soil and putting them into a paper bowl; 2) sowing and culturing cotton sprouts; 3) inoculating pathogen, which requires inoculating bacterium spore suspension of cotton verticillium wilt when one true leaf of a cotton sprout grows to be flat, wherein the inoculation concentration is in the range of from 1*10<6> to 5*10<6> spores per ml, and every cotton sprout is inoculated with bacteria liquid about from 2 to 3 ml; 4) evaluating the resistance to cotton verticillium wilt. The invention is characterized by being fast, accurate, economical, environmental beneficial and so on.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Phytophthora capsici polygalacturonase (PG) Pcipg5 gene, protein preparation method and application thereof

The invention belongs to the technical field of biology and in particular provides a polygalacturonase (PG) gene Pcipg5 which is cloned from phytophthora capsici and protein preparation technology thereof. Gene and protein levels prove that the gene is effectively involved in the process that the phytophthora capsici infects hot pepper hosts and results in occurrence of the course of diseases on hot pepper leaves. Plant pathology and cytochemistry technology further prove that after the protein coded by the gene is inoculated onto the hot pepper leaves, obvious withering and shrinking occur on the inoculated parts of the leaves and the cell walls on the affected parts of the leaves are obviously degraded, namely the gene code is an important protein related to the course of diseases or is possibly an important target pathogenic gene of a phytophthora capsici PG gene cluster. The invention provides important technical reserve for further developing phytophthora capsici molecule detection technology.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Rubber tree powdery mildew in vitro culture method and culture medium thereof

InactiveCN102002464AAchieve in vitro cultureSolve cultureFungiMicroorganism based processesAlcoholPlant pathology
The invention discloses a rubber tree powdery mildew in vitro culture method and a culture medium thereof, belonging to the technical field of plant pathology. The rubber tree powdery mildew in vitro culture method comprises the following steps of: firstly, preparing a nutrient solution and a culture disc; secondly, preparing an in vitro leaf; and thirdly, inserting the in vitro leaf after treating into a PCR plate hole filled with the nutrient solution, lightly brushing powdery mildew on an infected rubber tree leaf on the in vitro leaf which is treated with the nutrient solution by using a writing brush or a brush which is sterilized in 75 percent alcohol, arranging in an artificial climate box with the temperature of 23 DEG C and the moisture of 90 percent, carrying out light culture for 16h per day and carrying out dark culture for 8h per day. The rubber tree powdery mildew in vitro culture method has the advantages of convenience, durability and high efficiency and can be used for culturing rubber tree powdery mildew in a large scale, thereby realizing in vitro culture of the rubber tree powdery mildew on the leaf and solving the problems of culture and preservation of the rubber tree powdery mildew.
Owner:RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI

Non-destructive stalk and root contact sensor with variable rate tensioner

An apparatus and methods for non-destructively analyzing the strength of plant roots and stalks, and uses of this information in plant breeding, crop production, and detection of plant pathology. The apparatus and methods involve the use of a variable rate tensioner that may be automatically or remotely adjusted based on crop conditions.
Owner:PIONEER HI BRED INT INC

Plant antiviral agent, preparation method and application thereof

The invention discloses a plant active ingredient of Cynanchum Komarovii extract with 7-defluvium unguium oxyl tylophorine as effective component and accessory ingredient of plant source antiviral agent preferably water, emulsifiable concentrate and wettable powder; preparation method and application against plant virus.Through indoor farm testing, the antiviral preparation can be used for preventing and treating pathology caused by single virus infecting different host or two or more viruses mixed infecting the same host or homogeneous host, especially plant pathology caused by 5 virus distributing world widely with severe hazard. The preventing and treating effect can reach up to 40-50%. The antiviral preparation has ideal effect in preventing and treating multi-viruses mixed infected tobacco. The inventive antiviral agent has no toxicity to human and livestock and high safety and performance.
Owner:姚宇澄 +2

Endophytic fungi CEF-193 of cotton and application thereof

The invention relates to phytopathology, and particularly relates to endophytic fungi CEF-193 of cotton and application thereof. The bacterial strain CEF-193 (Acremonium alternatum) with a significant induced immune function on cotton verticillium wilt is obtained from the endophytic fungi of the cotton by separation, screening, identifying and biological assay of a greenhouse, the preservation number is CGMCC No.8302, and CEF-193 can be cultivated on an artificial medium, and is easily obtained and cultivated. Thus, industrialized production and popularization and application are facilitated. An indoor bacteriostatic test shows that the control effect on greensickness is good, verticillium dahlia is inoculated 4 days after the CEF-193 is firstly inoculated, the prevention and control effect on the cotton verticillium wilt achieves 74.1%, and the endophytic fungi CEF-193 have significant control action on the greensickness. Compared with the bacillus subtilis mainly applied to production, the prevention and control effect is improved by about 40%, and the endophytic fungi CEF-193 are safe on people and livestock, insects and crops, and friendly to environment.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP

The invention relates to the plant pathology field. A gene VdGFP playing an important role in pathogenicity is cloned from verticillium dahliae V07DF2 strains, and a nucleotide sequence of the gene and an amino acid sequence of an encoded protein are provided. Specifically, the invention discloses the verticillium dahliae pathogenicity-related gene VdGFP. The gene has the nucleotide sequence shown in SEQIDNO:1 or SEQIDNO:2, and the gene-encoded protein has the sequence shown in SEQIDNO:3. The verticillium dahliae pathogenicity-related gene VdGFP can be used for reducing the pathogenicity of verticillium dahliae.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Biocontrol trichoderma agent prepared with active sludge and abandoned biomass

The invention relates to a method producing trichodermin prophylactic by utilizing remained activated sludge and agriculture and forestry scrap biomass, which belongs to the technical field of biopesticide and environmental pollution treatment. The method mainly takes the remained activated sludge and scrap biomas generated during sewage disposal as the producing raw material and producing the trichodermin prophylactic by adopting the method of solid state fermentation. The manufacturing technique comprises: (1), crushing and pretreating scrap biomass; (2), preparing culture medium of sludge and biomass; (3), inoculating trichoderma viride after sterilizing the culture medium for solid state fermentation; (5), appending stabilizer and auxiliary agent into the leavening after being dried. The method can be used for crushing and packing and also can be directly used in agricultural soils, which can prevent and cure soil-borne disease and improve soil and increase soil fertility. The trichodermin prophylactic produced with the technics can effectively prevent and cure various diseases caused by plant pathology with low producing cost; besides, the product can effectively treat the castoff, thus reducing the pollution for environment.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI

Verticillium dahliae 171 (Vd171) for preventing and treating cotton verticillium wilt and application of Vd171

The invention relates to plant pathology and particularly relates to verticillium dahliae 171 (Vd171) and an application of the Vd171 in prevention and treatment on cotton verticillium wilt. On the basis of an attenuated strain of the cotton verticillium wilt, the Vd171 is obtained through separation, screening, identification and biological assay in a greenhouse. The Vd171 has a remarkable control function on the cotton verticillium wilt, and the preservation number of the Vd171 is CGMCC (China General Microbiological Culture Collection Center) N0.5903. The Vd171 can be cultured on a synthetic medium and is easy to be obtained and cultured, thus being beneficial to industrialization production as well as promotion and application. The Vd171 has a good control effect on the verticillium, and after the Vd171 is inoculated for four days, and Vd991 is inoculated, so that the cotton verticillium wilt control efficiency can reach 85.0%. The Vd171 has the remarkable control function on the cotton verticillium wilt, and compared with bacillus subtilis usually applied in a market, the control efficiency of the Vd171 is improved by about 50%, and the Vd171 does no harm to people, livestock, insects and crops and is environment-friendly.
Owner:中农科创(河南)生物科技有限公司

Cotton endophytic bacteria YUPP-10 and application thereof in cotton verticillium wilt controlling

The invention relates to the field of plant pathology, in particular to cotton endophytic bacteria YUPP-10 and application thereof in cotton verticillium wilt controlling. The strain preservation number of the cotton endophytic bacteria YUPP-10 is CCTCC No:M2017141. The experimental result shows that the cotton endophytic bacteria YUPP-10 has inhibitory effect on the growth of verticillium wilt pathogen, corn vermiculite culture of the cotton endophytic bacteria YUPP-10 has a high controlling effect on the verticillium wilt, and the cotton endophytic bacteria YUPP-10 is suitable as a biological resource for verticillium wilt controlling. The cotton endophytic bacteria YUPP-10 and application in cotton verticillium wilt controlling provide new resources for enriching biological controllingof agricultural diseases and has practical application guidance for pollution-free green agricultural systems.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI +1

Non-destructive stalk and root contact sensor with variable rate tensioner

An apparatus and methods for non-destructively analyzing the strength of plant roots and stalks, and uses of this information in plant breeding, crop production, and detection of plant pathology. The apparatus and methods involve the use of a variable rate tensioner that may be automatically or remotely adjusted based on crop conditions.
Owner:PIONEER HI BRED INT INC

Preparation method of green fluorescent protein marked coconut stem bleeding disease bacterium protoplast

The invention belongs to the field of molecular plant pathology, and particularly relates to a preparation method of a green fluorescent protein marked coconut stem bleeding disease bacterium protoplast. The preparation method has the beneficial effects that appropriate conditions for protoplast formation are determined, the high-quality protoplast is prepared by using 1mol / L mannitol as an osmotic stabilizer and 7.5mg / mL driselase as lyase, GFP (green fluorescent protein) is transferred to a coconut stem bleeding disease bacterium so as to obtain a stable genetic GFP pathogenic bacterium strain; therefore, a solid foundation is laid for genetic operations of the disease bacterium, such as GFP transformation and genetic expression, the cost is saved, the working efficiency can be greatly improved, and the research time is shortened; and meanwhile, the green fluorescent protein marked coconut stem bleeding disease bacterium facilitate the research on histopathology, disease epidemiology and the like of the disease.
Owner:FUJIAN AGRI & FORESTRY UNIV +1

Celest coated bacterium soil nutrition pot method for authenticating cotton fusarium wilt resistance

The invention relates to the field of plant pathology, in particular to a celest coated bacterium soil nutrition pot method for authenticating cotton fusarium wilt resistance. The celest coated bacterium soil nutrition pot method for authenticating cotton fusarium wilt resistance comprises the following steps that (1) pathogenic bacteria are cultivated, cotton fusarium wilt germs are inoculated into a czapek fluid medium and cultivated for 4 days to 5 days, and the germs are then transferred to a corn sandy soil medium; (2) a wilt bacterium soil nutrition pot is prepared, greensand soil is blended with a corn sandy soil culture of cotton fusarium wilt bacteria and with 06% by mass, and the greensand soil and the culture are placed in a non-bottom paper pot; (3) cotton seedings are sown and managed, sowing is conducted with 1% celest coating, and cotton seedings are cultivated in a solar greenhouse with temperature and humidity controllable; (4) cotton fusarium wilt resistance is evaluated, disease happening conditions are investigated in a classified mode, and disease indexes are calculated. The celest coated bacterium soil nutrition pot method for authenticating cotton fusarium wilt resistance has the advantages of being rapid, accurate, economical and the like.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Cytospora chrysosperma protoplast preparation method and prepared protoplast conversion method

The invention provides cytospora chrysosperma protoplast preparation and genetic transformation methods, and belongs to the field of molecular plant pathology. The cytospora chrysosperma protoplast preparation method comprises the following steps: inoculating cytospora chrysosperma into a YEPD liquid culture medium for mycelium culture, and performing enzymolysis treatment on the cytospora chrysosperma mycelia, thereby obtaining protoplast. In addition, a PEG mediated method is adopted for genetic transformation on the prepared protoplast, and thus a mutant can be obtained. The method provided by the invention is high in protoplast preparation efficiency, low in cost and simple to operate, the number of protoplast after enzymolysis can be as high as 10<8>-10<9> / mL, the transformation efficiency is high, the protoplast is good in activity, the transformation efficiency can be improved, and the research time can be greatly shortened. By adopting the method, a good base is made for molecular biology study on cytospora chrysosperma in the future, and furthermore potential utilization values can be made for prevention and treatment and histopathologic study on cytospora chrysosperma.
Owner:BEIJING FORESTRY UNIVERSITY

Method for rapid separation of phytophthora capsici and special culture medium thereof

The invention provides a method for rapid separation of phytophthora capsici and a special culture medium thereof, and belongs to the technical field of phytopathology research. The separation method comprises the steps of sick sample treatment, disinfection, culture medium preparation, and the like. The sick sample is selected from a freshly-picked sick stem, and a sick sample tissue of 9-11 cm is taken with a juncture of the sick part and the healthy part of the sick sample as a center; the tissue is cleaned with tap water, and is dried in the air to remove surface moisture; the dried tissue is uniformly sprayed with 75% alcohol, then soaked with a 1% sodium hypochlorite solution, and cleaned with sterile water; after drying in the air, the disinfected large block of the sick sample is cut into small blocks on an aseptic operating floor; and separation culture is performed with special culture medium. With the method of the invention, the separation rate of phytophthora capsici reaches 81.99% on average, which is increased by 32.6% when compared with the separation rate of a routine (small block disinfection treatment, small block separation) treatment method on average; the separation time is only 31.6 minutes on average; the separation time is shortened by 50.1% on average; and the operations are simple and practical.
Owner:INST OF AGRI ENVIRONMENT & RESOURCES YUNNAN ACAD OF AGRI SCI

Peanut ralstonia solanacearum effect protein RipAU and application thereof in peanut bacterial wilt resistance

ActiveCN114656530AReduce pathogenicityHypersensitivity necrotic reactionBiocideBacteria peptidesBiotechnologyPlant pathology
The invention provides peanut ralstonia solanacearum effect protein RipAU, and belongs to the field of research on plant pathology and crop disease control. The peanut ralstonia solanacearum RS-P.362200 effect protein RipAU has an amino acid sequence as shown in SEQ ID No.2, and the nucleotide sequence of the coding gene is as shown in SEQ ID No.1. The invention also discloses a preparation method of the Ralstonia solanacearum RS-P.362200 effect protein The RipAU gene is transiently expressed in nicotiana benthamiana, and an allergic necrosis reaction can be generated. After the RipAU is knocked out, the pathogenicity of the ralstonia solanacearum to the peanuts can be remarkably reduced, and it is indicated that the RipAU serves as a virulence factor. According to a yeast two-hybrid method, a target protein AhSBT1.7 of RipAU is screened out. The invention has important application value in the aspects of disclosing the pathogenesis of ralstonia solanacearum and preventing and treating peanut bacterial wilt.
Owner:FUJIAN AGRI & FORESTRY UNIV

Gene for enhancing plant disease resistance and function thereof

The invention relates to a disease resistance function of a gene of a model plant arabidopsis thaliana, and belongs to the field of plant pathology research. The invention discloses an arabidopsis thaliana gene AT5G02580. The nucleotide sequence of the arabidopsis thaliana gene AT5G02580 is as shown in SEQ ID NO: 1. The invention further discloses application / functions of the arabidopsis thaliana gene AT5G02580. The disease resistance of plants can be remarkably improved by knocking out the AT5G02580 gene in arabidopsis thaliana. According to the invention, an sgRNA sequence of AT5G02580 gene targeted knockout is firstly designed, then a carrier is constructed, and arabidopsis thaliana is subjected to genetic transformation by the carrier, so that a corresponding transgenic plant is obtained, and two strains ko-1 and ko-2 of different mutation types of the AT5G02580 gene are identified from the transgenic plant.
Owner:ZHEJIANG NORMAL UNIVERSITY

Rapid identification method for resistance of field tobacco alternaria alternata to three types of germicides

The invention discloses a rapid identification method for resistance of field tobacco alternaria alternata to three types of germicides, namely dicarboximide type germicide, phenylpyrrole type germicide and aromatic hydrocarbon type germicide, based on a culture-independent and PCR (Polymerase Chain Reaction) amplification technology, belonging to the fields of plant pathology and molecular biology. In the method, tobacco alternaria alternata genome DNA (Deoxyribonucleic Acid) in a tobacco alternaria alternata scab tissue block is extracted and is used as a template, and six groups of amino acid repeating regions, 92 in total, at an end N of bi-component histidine kinase are rapidly amplified by applying a specific primer. Whether the drug resistance of the tobacco alternaria alternata to the dicarboximide type germicide, the phenylpyrrole type germicide and the aromatic hydrocarbon type germicide is generated is determined by comparing gene sequences. The method has the advantages of rapidness, easiness, convenience, accuracy and the like and has a broad application prospect in resistance monitoring of the tobacco alternaria alternata.
Owner:KUNMING UNIV OF SCI & TECH

Application for natural pyrethrin emulsion preparation

The invention relates to the application of natural pyrethrum emulsifiable concentrate preparation as bactericide for killing wheat scab pathogen and wheat Rhizoctonia cerealis. The invention is pure natural plant source bactericide, its solvent, synergist, and stabilizer are all plant extracts. It has no residues as pyrethrin will decompose into water and carbon dioxide in nature. The preparation has low toxicity and no residues, generates no pesticide toxicity to the seedling, flower, and fruit of plants, even overcommiting. The inventive pyrethrum emulsifiable concentrate preparation can be used for preventing and treating plant pathology, and exploits new field for the application of pyrethrum. The inventive pyrethrin emulsifiable concentrate preparation can be used as bactericide in the production of green food and organic food due to its no residue.
Owner:红河森菊生物有限责任公司

Setosphaeria turcica attenuated strain STAM-226 and application thereof

The invention relates to phytopathology, in particular to a setosphaeria turcica attenuated strain STAM-226 and application thereof, and particularly relates to the setosphaeria turcica attenuated strain and application thereof in prevention and treatment of northern leaf blight of corn. Through ATMT conversion, screening, identification, pot culture experiments and field experiments, a setosphaeria turcica attenuated strain with a significant control effect on the northern leaf blight of corn is obtained, and the preservation number is CGMCC NO.20269. Test results show that the setosphaeria turcica attenuated strain is firstly inoculated, the setosphaeria turcica virulent strain STAM-YC is inoculated after 1-3 days, and a remarkable mild strain cross protection (MSCP) effect is shown in each growth period. The STAM-YC is inoculated after the setosphaeria turcica attenuated strain is inoculated for 2 d, so that the prevention and control effect on the northern leaf blight of corn is most remarkable, reaching 89.6%. The setosphaeria turcica attenuated strain for preventing and treating the northern leaf blight of corn is safe to people, livestock, insects and crops, and is environmentally friendly.
Owner:TANGSHAN NORMAL UNIV

Method for counting plant pathogenic oomycetes zoospores

The invention relates to the fields of microorganisms and phytopathology, and particularly discloses a method for counting plant pathogenic oomycetes zoospores. According to the invention, the cameraphase parameter is set, so that the two morphological characteristics of the zoospores, namely blue spores and orange spores, can be clearly observed, thereby realizing the counting of the zoospores.According to the method, the zoospores and the resting spores can be counted simultaneously, so that the related experiments of the oomycetes zoospores are facilitated, and the accuracy and the precision of experimental results are improved. The method disclosed by the invention is simple and reliable, and all microscopes with imaging equipment can be suitable for counting oomycetes zoospores, sothat an evaluation index is provided for evaluating the severity of plant diseases and the pesticide effect of the bactericide.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Digital modeling of disease on crops on agronomics fields

A system and method for identifying a probability of disease affecting a crop based on data received over a network is described herein, and may be implemented using computers for providing improvements in plant pathology, plant pest control, agriculture, or agricultural management. In an embodiment, a server computer receives environmental risk data, crop data, and crop management data relating to one or more crops on a field. Agricultural intelligence computer system 130 computes one or more crop risk factors based, at least in part, the crop data, one or more environmental risk factors based, at least in part, the environmental data, and one or more crop management risk factors based, at least in part, on the crop management data. Using a digital model of disease probability, agricultural intelligence computer system 130 computes a probability of onset of a particular disease for the one or more crops on the field based, at least in part, on the one or more crop risk factors, the one or more environmental risk factors, and the one or more crop management factors.
Owner:THE CLIMATE CORP

Insect thin film virus feeding method and application thereof

The invention belongs to the technical field of wheat aphid physiology and phytopathology, and particularly relates to a piercing-sucking type insect thin film virus feeding method and application thereof. The method comprises the following steps: (1) uniformly thinning a plastic film, and covering the upper end of a container with openings at the two ends with the plastic film; (2) dropwise adding a virus feeding solution on the thin film; (3) uniformly thinning the plastic film, and covering the virus feeding solution with the plastic film; (4) inclining the opening at the lower end of the container upwards, and putting the insects into the container through the opening at the lower end; and (5) putting the container filled with the insects onto absorbent paper with the lower end opening facing downwards, and putting the container onto a plane for virus feeding. The method is simple and convenient to operate, effectively improves the efficiency of sucking food or virus solution by the insects, and provides convenience for further research on the virus transmission efficiency between the insects and plants.
Owner:INST OF PLANT PROTECTION SICHUAN ACAD OF AGRI SCI

Cotton endophytic fungus cef-082 and its application in the control of cotton Verticillium wilt

The invention relates to phytopathology, in particular to cotton fungal endophyte CEF-082 and an application of the cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt. The preservation serial number of the cotton fungal endophyte CEF-082 is CGMCCNo.11313; the suppression rate of the metabolite of the CEF-082 to colony growth of the cotton verticillium wilt reaches 100%, and the suppression rate to the conidium yield is 70.73%. Greenhouse experimental results show that cotton is pre-inoculated through CEF-082 culture filtrate when true leaves of cotton seedlings appear for the first time, and the control effect on the cotton verticillium wilt is 62.37%; the corn sand grain culture of the CEF-082 is connected into a matrix at the percentage of 2%, and then the cotton seedlings are cultivated, so that the control effect on the cotton verticillium wilt is 66.88%. Compared with bacillus subtilis which is greatly used in production, the control effect is increased by 30.7% on average; the expressions of defense related genes beta-1,3-glucanase, POD, PPO, PAL and the like are improved by inoculating the cotton through the CEF-082, hence, the resistance of plants to the cotton verticillium wilt is enhanced, and the damage of pathogenic bacteria is reduced.
Owner:中农科创(河南)生物科技有限公司

Biocontrol trichoderma agent prepared with active sludge and abandoned biomass

The invention relates to a method producing trichodermin prophylactic by utilizing remained activated sludge and agriculture and forestry scrap biomass, which belongs to the technical field of biopesticide and environmental pollution treatment. The method mainly takes the remained activated sludge and scrap biomas generated during sewage disposal as the producing raw material and producing the trichodermin prophylactic by adopting the method of solid state fermentation. The manufacturing technique comprises: (1), crushing and pretreating scrap biomass; (2), preparing culture medium of sludge and biomass; (3), inoculating trichoderma viride after sterilizing the culture medium for solid state fermentation; (5), appending stabilizer and auxiliary agent into the leavening after being dried. The method can be used for crushing and packing and also can be directly used in agricultural soils, which can prevent and cure soil-borne disease and improve soil and increase soil fertility. The trichodermin prophylactic produced with the technics can effectively prevent and cure various diseases caused by plant pathology with low producing cost; besides, the product can effectively treat the castoff, thus reducing the pollution for environment.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI