Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP

A disease-related gene, Verticillium dahliae technology, applied in the field of plant pathology research, can solve the problems of different functions of homologous genes, different biological characteristics and genetic backgrounds, etc.

Inactive Publication Date: 2016-04-27
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biological characteristics and genetic background of Verticillium dahliae are different from other pathogenic fungi, and the functions of homologous genes in Verticillium dahliae may also be different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP
  • Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP
  • Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0014] 1. The construction of the knockout vector and the complementation vector of the VdGFP gene, and the constructed vector was introduced into the Agrobacterium AGL-1 strain by the chemical transformation method, and the AGL-1 with the knockout function and complementation function of the VdGFP gene were obtained respectively One for each Agrobacterium, the specific process is described as follows:

[0015] A. Use the biological information resources shared online (see: http: / / www.broadinstitute.org / annotation / genome / verticillium_dahliae / MultiHome.html), respectively design two pairs of nucleic acid primers, that is, the upstream of the 5′ flank amplification primer: GGGGACAGCTTTCTTGTACAAAGTGGAATCGGAACTGTGCGATGATGT ; Downstream of the 5' flanking amplification primer: GGGGACTGCTTTTTTGTACAAACTTGTGTGGAGGCTGGTCGTGTCTT; Upstream of the 3' flanking amplification primer: GGGGACAACTTTGTATAGAAAAGTTGTTCCGCCTTTGTCATCCCTCTTC; Downstream of the 3' flanking amplification primer: GGGGACA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the plant pathology field. A gene VdGFP playing an important role in pathogenicity is cloned from verticillium dahliae V07DF2 strains, and a nucleotide sequence of the gene and an amino acid sequence of an encoded protein are provided. Specifically, the invention discloses the verticillium dahliae pathogenicity-related gene VdGFP. The gene has the nucleotide sequence shown in SEQIDNO:1 or SEQIDNO:2, and the gene-encoded protein has the sequence shown in SEQIDNO:3. The verticillium dahliae pathogenicity-related gene VdGFP can be used for reducing the pathogenicity of verticillium dahliae.

Description

technical field [0001] The invention relates to the functional analysis of the pathogenicity-related gene VdGFP of Verticillium dahliae and the research on its potential application, and belongs to the field of plant pathology research. Background technique [0002] Verticillium dahliae (Verticillium dahliae Kleb.) is an important soil-borne pathogenic fungus that causes Verticillium wilt. It has a wide range of hosts and can harm many important economic and horticultural crops. Traditional control techniques, such as crop rotation, selection of resistant varieties, and chemical agents, have certain effects on the control of Verticillium wilt. However, due to the rich genetic diversity of Verticillium dahliae, the pathogenicity is prone to differentiation, and It mainly survives in the soil with a micro-sclerotia structure with strong stress resistance, so the harm of Verticillium wilt is still serious worldwide. [0003] To clarify the infection and pathogenic mechanism of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/37C12N15/31C12N15/80C12R1/645
CPCC07K14/37C12N15/80
Inventor 张昕林玲邓晟
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com