79 results about "Conidium" patented technology

The invention provides metarhizium ledebusii GZFW2211 and an application of the metarhizium ledebusii GZFW2211. The green muscardine fungus GZFW2211 is preserved in Guangdong Microbial Culture Collection Center on February 13, 2025, and the preservation number is GDMCC No: 65784. The spodoptera frugiperda spore suspension is a strain separated from spodoptera frugiperda larvae, the strain is high in growth speed, short in conidium production time and large in spore production quantity, and the prepared spore emulsion suspension is high and stable in pathogenicity to important pests such as spodoptera frugiperda, prodenia litura and agrotis ypsilon. The insecticidal composition can be widely used for preventing and treating pests such as spodoptera litura, prodenia litura and agrotis ypsilon.

The invention discloses bacillus atrophaeus YL84, a microbial agent and application, and belongs to the technical field of microorganisms. The strain is preserved in the China Center for Type Culture Collection on February 20, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 2025267. Sterile fermentation filtrate of the strain YL84 can effectively inhibit germination of conidia and growth of mycelia of valsa ceratosperma of Korla pear trees, can play a good role in preventing in-vitro branches and potted pear seedlings, in addition, the strain can secrete protease and cellulase and synthesize siderophores, has the capacity of dissolving inorganic phosphorus and producing IAA at the same time, and has a good application prospect. The strain has a remarkable antagonistic effect on five common plant pathogenic fungi in the Xinjiang Uygur autonomous region and is wide in antibacterial spectrum.

The invention belongs to the technical field of artificial cultivation of cordyceps sinensis, and particularly relates to a method for rapidly propagating and culturing cordyceps sinensis based on cordyceps sinensis infection bodies, which comprises the following steps: (1) inoculating cordyceps sinensis into a cordyceps sinensis culture solution for culturing to obtain a cordyceps sinensis infection body culture solution; the cordyceps sinensis is a cordyceps sinensis thallus separated from infected hepialus armoricanus larva or a cordyceps sinensis solid culture which has produced conidia; and (2) mixing the winter worm summer fungus infection body culture solution with the hepialus armoricanus larva feed, feeding the hepialus armoricanus larvae, and carrying out grass emergence culture after the hepialus armoricanus larvae are fed to be rigid. According to the method, the rapid propagation culture infection body is high in concentration (can reach 3.3 * 10 < 7 > / mL), short in period (about 40 days) and high in infection rate (not lower than 80%), a large number of cordyceps sinensis infection bodies can be obtained in a short time, the cordyceps sinensis infection bodies are used for infecting cordyceps sinensis hosts to obtain cordyceps sinensis, and the problems that the source of artificially matched and planted cordyceps sinensis strains is unstable, and strain preparations are difficult to store for a long time can be solved.

The invention provides an aspergillus terreus JM-F5-6 strain and application thereof in promoting tomato growth and improving soil nutrients, and belongs to the technical field of microorganisms. The preservation number of the aspergillus terreus JM-F5-6 is CCTCC (China Center For Type Culture Collection) NO: M20232616. The conidia of the aspergillus terreus JM-F5-6 are spherical or oval, the surface is smooth, hyphae are colorless or slightly colored, the wall is thick, the hyphae are separated, and hypha branches are laterally connected to form a mesh topology. The aspergillus terreus JM-F5-6 has high protein decomposition capacity and acid production capacity, is beneficial to improving the soil environment, can enhance the photosynthesis and nitrogen absorption of plants and improve the health and growth situation of the plants, effectively improves the content of soil hydrolytic nitrogen, available phosphorus, quick-acting potassium and organic matter, improves the soil fertility, and has wide market application prospects.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

The invention relates to the technical field of bioengineering, in particular to a method for promoting cordyceps sinensis to produce conidia. The invention provides a method for promoting cordyceps sinensis to produce conidia, which comprises the following steps: (1) carrying out dark culture on cordyceps sinensis on a primary solid culture medium to obtain mycelium; and (2) transferring the mycelium obtained in the step (1) to a secondary solid culture medium, and carrying out environmental stimulation culture until conidia are generated. The method is suitable for industrial production, has the advantages of simplicity and convenience in operation, controllable cost, high repeatability and the like, can effectively shorten the fermentation period, improves the inoculation efficiency and the yield of metabolites, and provides reliable technical support for large-scale artificial culture and deep development of cordyceps sinensis.

The invention belongs to the technical field of biology, and discloses a primer pair for identifying or assisting in identifying crop fusarium oxysporum. The primer pair is composed of a primer F2 and a primer RL, the sequence of the primer F2 is 5 '-GATTGACGGATTTGGCGAACCTACC-3', and the sequence of the primer RL is 5 '-TTCGTCGCCGACAGTTTCT-3'. The invention also discloses a method for identifying or assisting in identifying whether a microorganism to be detected is fusarium oxysporum or not. The method comprises the following steps: 1) extracting genome DNA of the microorganism to be detected; 2) taking the extracted genome DNA as a template, carrying out PCR amplification by adopting a primer F2 and a primer RL to obtain an amplification product, detecting the size of the amplification product, and if the amplification product contains a DNA fragment of 897bp, determining that the microorganism to be detected is fusarium oxysporum or fusarium oxysporum as a candidate; on the contrary, the to-be-detected microorganism is the non-fusarium oxysporum or the candidate is the non-fusarium oxysporum. The primers F2 and RL designed by the invention are strong in specificity and high in sensitivity, the lower limit of detection of fusarium oxysporum genome DNA reaches 0.05 ng / mu LDNA, and the threshold value of detection of fusarium oxysporum conidia in soil is 100 spores per gram of soil.

The present disclosure provides an entomopathogenic fungi conidia powder, which comprises a powder and conidia attached to the surface of the powder. On the other hand, the present disclosure further provides a method for producing the entomopathogenic fungi conidia powder. Based on the disclosure of the present disclosure, the production method uses a powder to adhere to the entomopathogenic fungi conidia, and allowing them to be stored at room temperature for at least 7 months with a substantially same amount of conidia population. In addition, the production method using solid fermentation reduces production costs.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

A Bipolaris yamadae (Y. Nisik.) shoemaker (HXDC-1-2), and a screening and identification method therefor and use thereof. The Bipolaris yamadae (Y Nisik.) strain (HXDC-1-2) is deposited in the China General Microbiological Culture Collection Center with the accession number CGMCC No. 17778. The Bipolaris yamadae (Y. Nisik.) strain (HXDC-1-2) is applied to biological weed control when the conidial concentration is 102 conidia / ml or more.

The invention belongs to the technical field of agricultural disease control, and discloses a fusarium pseudograminearum GPI anchoring protein and an application of a coding gene of the fusarium pseudograminearum GPI anchoring protein. The fusarium pseudograminearum FpPer1 gene is knocked out, so that the mycelial growth rate, conidium yield and pathogenicity of the fusarium pseudograminearum FpPer1 gene are remarkably inhibited, and meanwhile, the gene knockout strain is more sensitive to bactericides such as tebuconazole. The gene can be used as a novel target for designing a pesticide synergist; or a small molecule compound, polypeptide or nucleic acid medicine is designed based on the FpPer1 gene or the FpPer1 protein coded by the FpPer1 gene, and is compounded with the existing bactericide (such as tebuconazole) to improve the pesticide effect. A new target is provided for prevention and control of wheat stem rot, efficient prevention and control are achieved by interfering a pathogen protein post-translational modification approach, the toxin pollution risk is reduced, and wide agricultural application prospects are achieved.

The present invention relates to: a composition and a method for biologically controlling plant or crop diseases, the composition comprising three antagonistic microorganisms such as Bacillus velezensis CT-1, Bacillus amyloliquefaciens PT-1, and Paenibacillus polymyxa BW-1. The germination ability of pathogenic conidia that causes infection by adhering to and inhabiting flowers (floral organs) is suppressed by treating with a culture medium or extract of the novel strain, whereby the proliferation of pathogens is suppressed or the infiltration of bacteria into tissues is blocked, and thus the present invention can be effectively used for the stable production and environmentally friendly quality maintenance of fruits.

The present invention belongs to the technical field of aspergillosis treatment, and specifically discloses the use of carbonyl cyanide-4-trifluoromethoxyphenylhydrazone in the prevention and treatment of Aspergillus fumigatus infection, that is, using it as the sole active ingredient in the preparation of a drug for preventing or treating diseases caused by Aspergillus fumigatus infection, or for the preparation of an antibacterial and / or bactericidal product for Aspergillus fumigatus. The present invention first discovered that carbonyl cyanide-4-trifluoromethoxyphenylhydrazone has a significant inhibitory effect on both wild-type and drug-resistant strains of the human pathogenic fungus Aspergillus fumigatus, and can inhibit its colony growth, hyphal growth, and conidia formation, thereby providing a new therapeutic drug for Aspergillus fumigatus infection. At the same time, it solves the problem of antibiotic resistance that plagues the clinical treatment of Aspergillus fumigatus infection, and can circumvent the disadvantage that antibiotics are prone to drug resistance.

The invention discloses a method for rapidly detecting aspergillus conidia in a label-free manner through terahertz near-field imaging, and belongs to the technical field of microbiological detection. The method comprises the following steps: synchronously acquiring atomic force microscope morphology images and terahertz near-field signals of spores through a scattering type terahertz time-domain spectrum near-field scanning system, and jointly extracting morphology features, multi-order harmonic signal intensity and a local near-field amplitude spectrum peak value after phase-locked amplification and demodulation processing; and combining into a feature set for spore type identification. The method provided by the invention solves the problem that high-resolution, label-free and rapid detection cannot be realized at the same time in the prior art, and is mainly used for rapid label-free accurate detection and type identification of the aspergillus conidia.

The invention relates to application of AoRis1 protein in influencing the number of three-dimensional fungus nets generated by nematode-trapping fungi or the yield of conidia. Wherein the amino acid sequence of the AoRis1 protein is shown as SEQ ID NO.2, and compared with the AoRis1 protein encoding gene expression before silencing, the AoRis1 protein expression in the nematode-trapping fungi is silenced so as to increase the number of three-dimensional fungus nets generated by the nematode-trapping fungi and / or the yield of conidia. The engineering bacterium with the AoRis1 gene knocked out or deleted can improve the pathogenicity to nematodes, so that the engineering bacterium can be used as an efficient biological nematode killing preparation, and the use cost is greatly reduced.

This invention relates to the field of plant disease biological control technology, and particularly to a Fusarium oxysporum cell wall extract, its preparation method, and its application. The extract is derived from the polysaccharide fraction of the cell wall of Fusarium oxysporum spores or hyphae, and contains at least one pathogen-associated molecular pattern (PAMP) component. This component is a non-protein, thermally stable, species-nonspecific elicitor capable of forming an aqueous dispersion system. The extract of this invention can be recognized by plant PRRs and activate PTI immunity. Rehmannia glutinosa tubers treated with the extract showed a significantly increased germination rate after inoculation with Fusarium oxysporum. It also induces superoxide anion production, upregulates the activities of superoxide dismutase, peroxidase, and catalase, and enriches differentially expressed genes in the MAPK signaling pathway, jasmonic acid metabolism pathway, and phenylpropane biosynthesis pathway. Furthermore, the extract can directly inhibit Fusarium oxysporum colony expansion, conidia production, and mycelial growth. Extracts derived from spores or hyphae show no significant difference in inducing disease resistance, and the raw materials are flexible and easy to industrialize. This extract is derived from the cell wall of the pathogen itself, making it environmentally friendly and free from the risk of chemical pesticide residues. It is suitable for the green control of root rot disease in Rehmannia glutinosa.

The present invention discloses a method for industrialized cultivation of Cordyceps sinensis, comprising the following steps: inoculating conidia of Cordyceps sinensis into the body of Hepialus armoricanus larvae, and culturing the infected larvae; collecting the appearance images of Cordyceps sinensis, and judging the growth stage it is in according to the collected images; according to the real-time growth stage of Cordyceps sinensis, retrieving the corresponding environmental instructions to control the environmental parameters of the multi-layer cultivation rack area. After inoculating the conidia into the body of Hepialus armoricanus larvae, the present invention conducts artificial cultivation, and uses image acquisition to judge the growth stage of Cordyceps sinensis, presetting different light control conditions for different growth stages to achieve adaptive light control, providing the best environmental control for the growth of Cordyceps sinensis, and growing Cordyceps sinensis with good morphology and rich nutrients.

The invention belongs to the technical field of microorganisms, and particularly relates to an aspergillus strain or conidia thereof and application of the aspergillus strain or the conidia thereof in insect prevention and control. The preservation number of the aspergillus is CGMCC (China General Microbiological Culture Collection Center) The aspergillus or conidia thereof has excellent insecticidal activity on solenopsis invicta, and the insecticidal activity on the solenopsis invicta in a suspension with the concentration of 1 * 10 < 8 > spore / mL can reach 99% or above.

The present invention provides a strain of Penicillium oxalicum JM‑C14‑2 and an application thereof, belonging to the field of microbial technology, and the deposit number of the Penicillium oxalicum JM‑C14‑2 is CCTCC NO: M 20232615. The front colony of the Penicillium oxalicum JM‑C14‑2 is dark green, with neat edges, a dense villi-like structure covering the surface, and a concentric ring texture formed in the center of the colony; conidiophores are usually solitary or branched, with a typical broom-like branch structure at the top, and conidia chains are arranged radially with a smooth surface. The Penicillium oxalicum strain has an obvious ability to produce cellulase, and also has a strong ability to produce neutral phosphatase, can prevent the spread and growth of pathogens, can be prepared into a biological preparation that promotes plant growth and inhibits pathogens, and at the same time improves soil nutrients, so it has a wide range of market application prospects.

The invention discloses a trichoderma inoculant fermented by utilizing mulberry branches and application of the trichoderma inoculant in preventing and treating anthracnose. The trichoderma inoculant is obtained by fermenting trichoderma by utilizing the mulberry branches. The preparation method comprises the following steps: activating and culturing a trichoderma strain, preparing a conidium suspension, carrying out enlarged fermentation culture in a culture medium containing mulberry branches, and filtering the fermentation liquor to obtain a filtrate, namely the mulberry branch fermented trichoderma agent. The trichoderma fungicide cultured by taking mulberry branches as a fermentation substrate has broad-spectrum antibacterial activity, has a relatively good antagonistic effect on mulberry anthracnose pathogens, can be used for preventing and treating mulberry and strawberry anthracnose, and has a wide application prospect.

The present application provides a strain of Trichoderma asperellum TAZ19, a biocontrol agent and application thereof, wherein the Trichoderma asperellum TAZ19 is preserved in China Center for Type Culture Collection on October 25, 2024, and the preservation number is CCTCC M 20242341. The active ingredient of the biocontrol agent comprises the above-mentioned Trichoderma asperellum TAZ19 strain, and the Trichoderma asperellum TAZ19 strain is one or more of conidium, mycelium, fermentation filtrate or active extract thereof. The Trichoderma asperellum TAZ19 has excellent antagonistic effect on multiple plant disease pathogens such as Diaporthe phaseolorum, multiple Fusarium oxysporum, Valsa mali, and Botryosphaeria dothidea, has broad-spectrum antibacterial property, fast growth, high antibacterial activity, strong parasitism, and good salt and alkali tolerance, and has a growth-promoting effect on plants. The Trichoderma asperellum TAZ19 can be widely applied to the prevention and treatment of multiple plant diseases such as pine branch and stem rot, wheat stem base rot, tomato wilt, and has a wide application prospect.

The present invention provides a Streptomyces gracilis, a Streptomyces gracilis oil suspension, and a preparation method and application thereof. The Streptomyces gracilis oil suspension of the present invention comprises Streptomyces gracilis conidia powder, an emulsifier, a stabilizer, a wetting dispersant, an antioxidant, a thickener, a UV protectant, a preservative, and a carrier oil. The carrier oil is used as a dispersion medium, which is environmentally friendly and has good permeability and adhesion, and is resistant to rain erosion. The carrier oil has a synergistic effect on the germination of Streptomyces gracilis spores. It also has low application cost, slow spore sedimentation rate, is easy to shake during use, has stable control effect, long storage time, is suitable for various spraying technologies, and has a simple preparation method. The Streptomyces gracilis oil suspension of the present invention has a long spore survival period, with a spore germination rate of up to 85% after 18 months of storage. It has good control effect on yam, peanut, forest nematodes, etc., such as yam coffee nematode, peanut root-knot nematode, tomato southern root-knot nematode, pine wood nematode, etc.

The present invention belongs to the field of biological genetic engineering, and specifically relates to a Magnaporthe oryzae MoPCP1 gene and its application. The full-length sequence of the Magnaporthe oryzae MoPCP1 gene is shown in SEQ ID NO.1, the cDNA sequence is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3. Experiments show that after replacing the Magnaporthe oryzae MoPCP1 gene with the hygromycin resistance gene, the obtained Magnaporthe oryzae knockout mutant has obvious changes in vegetative growth ability, appressorium formation ability, and conidia morphology and size compared with the wild-type Magnaporthe oryzae, and there are obvious differences in the response to external environmental factors; the pathogenicity experiment shows that MoPCP1 the deletion of the gene significantly reduces the pathogenicity of Magnaporthe oryzae, indicating that MoPCP1 the gene plays a significant role in regulating the pathogenicity of Magnaporthe oryzae. The MoPCP1 gene and its application provided by the present invention play an important role in the pathogenicity of Magnaporthe oryzae, providing a new direction for further using this gene to control Magnaporthe oryzae.

The invention provides application of beauveria bassiana HFBb18 in preparation of a green peach aphid biological control entomopathogenic fungus agent, and belongs to the technical field of agricultural biology. The inventor acquires and identifies three new strains of beauveria bassiana from the field, then selects three strains of beauveria bassiana preserved in a laboratory, and finds that the newly found HFBb18 strain has high toxicity to green peach aphids through indoor toxicity determination. On the basis, the influence of infection of the HFBb18 strain on the activities of detoxifying enzyme and protecting enzyme of green peach aphid is determined. Furthermore, the wettable powder taking the HFBb18 strain conidia as a main active ingredient is prepared, the potting pesticide effect test control effect of the wettable powder on green peach aphids is defined, and a foundation is laid for development and application of a novel fungal aphid killing agent.

The invention belongs to the technical field of insect prevention preparations, and particularly relates to application of aspergillus or conidia thereof to prevention and control of spodoptera frugiperda. The Aspergillus sp. With the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.42111 or conidia of the Aspergillus sp. Has excellent insecticidal activity on the spodoptera frugiperda, and the insecticidal activity on the spodoptera frugiperda in a suspension with the concentration of 1 * 10 < 8 > spore / mL can reach 99% or above. Besides, the aspergillus wettable powder containing the spore powder of the aspergillus still has excellent insecticidal activity on spodoptera frugiperda, and has excellent stability, and the stable period at normal temperature reaches 12 months or above.

The present invention provides a strain of Aspergillus terreus JM-F5-6 and its application in promoting tomato growth and improving soil nutrients, belonging to the field of microbial technology. The preservation number of the Aspergillus terreus JM-F5-6 is CCTCC NO: M20232616. The conidia of the Aspergillus terreus JM-F5-6 are spherical or oval, with a smooth surface. The hyphae are colorless or slightly colored, with thick walls and septa. The hyphal branches are laterally connected to form a reticular topology. The Aspergillus terreus JM-F5-6 has strong proteolytic ability and acid-producing ability, which helps to improve the soil environment, enhance plant photosynthesis and nitrogen absorption, improve plant health and growth, and at the same time effectively increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium and organic matter in the soil, improve soil fertility, and has broad market application prospects.

The application of ceramide in the control of rice blast fungus falls within the field of biological control. This invention relates to the application of ceramide in the control of rice blast fungus: a combination of ceramide and lipopeptides is used for the control of rice blast fungus. Exogenous addition of ceramide significantly enhances the stress effect of lipopeptides on rice blast fungus. It also enhances the abnormal accumulation of glycogen and lipid droplets in conidia, promotes the bursting of ROS, and increases intracellular ceramide and calcium... 2+ The invention increases the content of malondialdehyde (MDA) in mycelium, enhances membrane lipid peroxidation, and decreases ergosterol content. Furthermore, it inhibits the expression of ergosterol synthesis genes, UPR target genes, and sphingolipid metabolism-related genes. This invention develops a highly efficient natural agent against rice blast by combining exogenous Cer with lipopeptides. This agent effectively reduces the pathogenicity of rice blast fungus and significantly inhibits its infection of rice, laying the foundation for the development of novel biological control agents.

The invention discloses Streptomyces sp.Zm3-3, a microbial agent and application of the microbial agent, and belongs to the technical field of microorganisms. According to the invention, a strain of Streptomyces sp.Zm3-3 is separated and screened from corn leaves, and the strain can antagonize the growth of hyphae of Zea maydis and curvularia lunata. Indoor potting and field control effect determination results show that the control effect of the Zm3-3 fungicide on corn southern leaf blight and corn curvularia leaf spot exceeds 70%, and the control effect on corn rust exceeds 60%. The Zm3-3 microbial inoculum and the fermentation filtrate thereof can digest hyphae of Zea maydis and curvularia lunata and inhibit germination of conidia of pathogenic bacteria. The biocontrol microbial inoculum prepared from the strain can replace or reduce the use of chemical pesticides, accords with the new idea of green plant protection development, is beneficial to guarantee of food and ecological safety, and has good economic and social benefits.

The invention discloses application of Purpureocillium spp. And microtablets thereof in prevention and treatment of Solenopsis invicta. According to the invention, the Purpureocillium aureum PTG35 is separated from the death lychee bugs in the field, and the preservation number of the Purpureocillium aureum PTG35 is GDMCC No.65103; the bacterium has high pathogenicity to solenopsis invicta of different grades and insect states. The micro-tablets prepared by taking the Purpureocillium spp. PTG35 conidia as the active ingredient are applied to prevention and treatment of Solenopsis invicta, and the population quantity of Solenopsis invicta can be effectively controlled. The Purpureocillium aureum PTG35 and the micro-tablet thereof have the advantages of natural components, strong stress resistance, environmental friendliness and the like, and have good application potential in biological control of Solenopsis invicta.

The present invention constructs a method for engineering strains without plate operation based on flow cytometry, which combines the transformation of a DNA sequence carrying a selective marker gene into the genome of the target fungal protoplast, flow cytometric sorting, deep-well plate culture, and rapid phenotypic analysis. It can be directly used for screening and separating protoplasts after genetic transformation of filamentous fungi, solving the bottleneck problems of long time, laboriousness, and low throughput in the process of plate culture, transformant selection, conidia preparation, and shake flask identification in existing filamentous fungi technology. The method of the present invention is easy to operate, saves time and labor, greatly improves the efficiency of filamentous fungal engineering, and can conveniently and effectively carry out high-throughput construction of high-yield engineered filamentous fungi.