106 results about "Conidium" patented technology

The invention provides a Trichoderma asperellum TAZ19, a biocontrol inoculant and application of the Trichoderma asperellum TAZ19, the Trichoderma asperellum TAZ19 is preserved in the China Center for Type Culture Collection on October 25, 2024, and the preservation number of the Trichoderma asperellum TAZ19 is CCTCC M 20242341. The active ingredients of the biocontrol inoculant comprise the trichoderma asperellum TAZ19 strain, and the trichoderma asperellum TAZ19 strain is one or more of conidia, hypha, fermentation filtrate or active extracts of the trichoderma asperellum TAZ19 strain of the trichoderma asperellum TAZ19 strain. The trichoderma asperellum TAZ19 has an excellent antagonistic effect on a plurality of plant disease pathogenic bacteria such as dispora pinnatifida, a plurality of fusarium oxysporum, apple black beancurd skin fungi and botryosphaeria dothidea, has broad-spectrum antibacterial activity, is high in growth speed, high in antibacterial activity and high in hyperparasitism ability, has better saline-alkaline tolerance, also has a growth promoting effect on plants, and can be widely applied to the field of plant diseases. The strain can be used as an active component of a biocontrol inoculant to be widely applied to prevention and treatment of various plant diseases such as pine tree branch rot, wheat stem rot and tomato fusarium wilt, and has a wide application prospect.

The invention discloses a fungal virus mutant as well as a construction method and application thereof, and belongs to the technical field of fungal virus modification. The fungal virus mutant is obtained by point mutation of an initiation codon ATG for coding a protein p18 in an infectious clone pSK-ABC into ACG, a coding gene of the protein p18 is located in an open reading frame of a component C at the 3533rd-5463rd sites of a complete sequence of the infectious clone pSK-ABC, and a nucleotide sequence of the infectious clone of the mutant is shown as SEQ ID NO: 1. The phenotype of the mutant virus infected strain is observed to find that the Mp18 mutant virus can reduce the growth speed of host fungi, and causes the characteristics of abnormal host colonial morphology, conidium yield and pathogenicity reduction and the like; besides, when the attenuated strain induced by the Mp18 mutant and the virulent strain are co-inoculated, scab extension on wheat leaves can be effectively inhibited, so that the effect of preventing and controlling the fusarium graminearum virulent strain is achieved.

The invention discloses a cordyceps sinensis factory culture method which comprises the following steps: inoculating conidia of cordyceps sinensis into hepialus armoricanus larvae, and culturing bacteria-sensitive larvae; collecting an appearance image of the cordyceps sinensis, and judging the growth stage of the cordyceps sinensis according to the collected image; according to the real-time cordyceps sinensis growth stage, a corresponding environment instruction is called to control the environment parameters of the multi-layer culture frame area. According to the method, after the conidia are inoculated into the hepialus armoricanus larvae, artificial culture is carried out, the growth stages of cordyceps sinensis are judged through image acquisition, different illumination control conditions are preset for different growth stages, self-adaptive illumination control is achieved, optimal environment control is provided for growth of cordyceps sinensis, and the method is suitable for large-scale popularization and application. The grown cordyceps sinensis is good in form and rich in nutrient substances.

The invention provides metarhizium ledebusii GZFW2211 and an application of the metarhizium ledebusii GZFW2211. The green muscardine fungus GZFW2211 is preserved in Guangdong Microbial Culture Collection Center on February 13, 2025, and the preservation number is GDMCC No: 65784. The spodoptera frugiperda spore suspension is a strain separated from spodoptera frugiperda larvae, the strain is high in growth speed, short in conidium production time and large in spore production quantity, and the prepared spore emulsion suspension is high and stable in pathogenicity to important pests such as spodoptera frugiperda, prodenia litura and agrotis ypsilon. The insecticidal composition can be widely used for preventing and treating pests such as spodoptera litura, prodenia litura and agrotis ypsilon.

The invention discloses bacillus atrophaeus YL84, a microbial agent and application, and belongs to the technical field of microorganisms. The strain is preserved in the China Center for Type Culture Collection on February 20, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 2025267. Sterile fermentation filtrate of the strain YL84 can effectively inhibit germination of conidia and growth of mycelia of valsa ceratosperma of Korla pear trees, can play a good role in preventing in-vitro branches and potted pear seedlings, in addition, the strain can secrete protease and cellulase and synthesize siderophores, has the capacity of dissolving inorganic phosphorus and producing IAA at the same time, and has a good application prospect. The strain has a remarkable antagonistic effect on five common plant pathogenic fungi in the Xinjiang Uygur autonomous region and is wide in antibacterial spectrum.

The invention discloses an application of 3-phenyl propyl acetate in preparation of a medicine for preventing and treating fungal diseases of rice. Experiments show that the compound can effectively inhibit mycelial growth and conidia germination of magnaporthe oryzae, can interfere conidia of magnaporthe oryzae to form appressorium, has an obvious inhibition effect on magnaporthe oryzae, and also inhibits mycelial growth of rhizoctonia solani. The inventor also accidentally finds that the antibacterial effect of the pesticide can be promoted by adding a small amount of 3-phenyl propyl acetate into the pesticide, so that the small amount of 3-phenyl propyl acetate can be used as a pesticide synergist for preventing and treating the rice fungal diseases. Therefore, the 3-phenyl propyl acetate has good application value in the aspects of prevention and control of rice fungal diseases and drug development.

The invention provides a streptomyces graminearus strain, a streptomyces graminearus oil suspension, as well as its preparation method and application thereof. The streptomyces graminearus oil suspension contains streptomyces graminearus conidiospore powder, emulsifier, stabilizer, wetting dispersant, antioxidant, thickener, ultraviolet protectant, preservative and carrier oil. The use of carrier oil as the dispersion medium offers environmental friendliness, excellent permeability, adhesion properties, and resistance to rain washing. Additionally, the carrier oil enhances the spore germination of streptomyces graminearus. Furthermore, it has the advantages of low application cost, slow spore settling speed, easy to shake well when using, stable efficacy, long storage time, suitability for various spraying techniques and a simple preparation method. The spore survival time of the streptomyces graminearus oil suspension is prelonged, with a spore germination rate is as high as 85% after 18 months of storage. It demonstrates effective control against yam, peanut and forest nematode.

The invention belongs to the technical field of artificial cultivation of cordyceps sinensis, and particularly relates to a method for rapidly propagating and culturing cordyceps sinensis based on cordyceps sinensis infection bodies, which comprises the following steps: (1) inoculating cordyceps sinensis into a cordyceps sinensis culture solution for culturing to obtain a cordyceps sinensis infection body culture solution; the cordyceps sinensis is a cordyceps sinensis thallus separated from infected hepialus armoricanus larva or a cordyceps sinensis solid culture which has produced conidia; and (2) mixing the winter worm summer fungus infection body culture solution with the hepialus armoricanus larva feed, feeding the hepialus armoricanus larvae, and carrying out grass emergence culture after the hepialus armoricanus larvae are fed to be rigid. According to the method, the rapid propagation culture infection body is high in concentration (can reach 3.3 * 10 < 7 > / mL), short in period (about 40 days) and high in infection rate (not lower than 80%), a large number of cordyceps sinensis infection bodies can be obtained in a short time, the cordyceps sinensis infection bodies are used for infecting cordyceps sinensis hosts to obtain cordyceps sinensis, and the problems that the source of artificially matched and planted cordyceps sinensis strains is unstable, and strain preparations are difficult to store for a long time can be solved.

The invention provides an aspergillus terreus JM-F5-6 strain and application thereof in promoting tomato growth and improving soil nutrients, and belongs to the technical field of microorganisms. The preservation number of the aspergillus terreus JM-F5-6 is CCTCC (China Center For Type Culture Collection) NO: M20232616. The conidia of the aspergillus terreus JM-F5-6 are spherical or oval, the surface is smooth, hyphae are colorless or slightly colored, the wall is thick, the hyphae are separated, and hypha branches are laterally connected to form a mesh topology. The aspergillus terreus JM-F5-6 has high protein decomposition capacity and acid production capacity, is beneficial to improving the soil environment, can enhance the photosynthesis and nitrogen absorption of plants and improve the health and growth situation of the plants, effectively improves the content of soil hydrolytic nitrogen, available phosphorus, quick-acting potassium and organic matter, improves the soil fertility, and has wide market application prospects.

The invention relates to the technical field of biotechnology, in particular to an artificial cultivation method of cordyceps sinensis sporocarp, which comprises the following steps: placing cordyceps sinensis in a liquid fermentation culture medium for fermentation to obtain cordyceps sinensis conidia liquid; the method comprises the following steps: injecting a cordyceps sinensis fungus conidium solution to the surface of a hepialus armoricanus larva body to infect the larva, placing the injected hepialus armoricanus larva in a culture medium simulating natural ecological conditions, and breeding in a first artificial climate box to obtain bombyx batryticatus; putting the bombyx batryticatus in a substrate simulating natural ecological conditions, covering the bombyx batryticatus with a layer of substrate, and culturing in a second artificial climate box to obtain the bombyx batryticatus overgrown with fungus coats; and planting the bombyx batryticatus overgrown with the fungus coats in soil, and culturing in a third artificial climate box to obtain cordyceps sinensis sporocarps. The cordyceps sinensis cultivated by the method is short in production period and low in heavy metal content, and can be produced on a large scale.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

The invention relates to the technical field of bioengineering, in particular to a method for promoting cordyceps sinensis to produce conidia. The invention provides a method for promoting cordyceps sinensis to produce conidia, which comprises the following steps: (1) carrying out dark culture on cordyceps sinensis on a primary solid culture medium to obtain mycelium; and (2) transferring the mycelium obtained in the step (1) to a secondary solid culture medium, and carrying out environmental stimulation culture until conidia are generated. The method is suitable for industrial production, has the advantages of simplicity and convenience in operation, controllable cost, high repeatability and the like, can effectively shorten the fermentation period, improves the inoculation efficiency and the yield of metabolites, and provides reliable technical support for large-scale artificial culture and deep development of cordyceps sinensis.

The invention belongs to the technical field of biology, and discloses a primer pair for identifying or assisting in identifying crop fusarium oxysporum. The primer pair is composed of a primer F2 and a primer RL, the sequence of the primer F2 is 5 '-GATTGACGGATTTGGCGAACCTACC-3', and the sequence of the primer RL is 5 '-TTCGTCGCCGACAGTTTCT-3'. The invention also discloses a method for identifying or assisting in identifying whether a microorganism to be detected is fusarium oxysporum or not. The method comprises the following steps: 1) extracting genome DNA of the microorganism to be detected; 2) taking the extracted genome DNA as a template, carrying out PCR amplification by adopting a primer F2 and a primer RL to obtain an amplification product, detecting the size of the amplification product, and if the amplification product contains a DNA fragment of 897bp, determining that the microorganism to be detected is fusarium oxysporum or fusarium oxysporum as a candidate; on the contrary, the to-be-detected microorganism is the non-fusarium oxysporum or the candidate is the non-fusarium oxysporum. The primers F2 and RL designed by the invention are strong in specificity and high in sensitivity, the lower limit of detection of fusarium oxysporum genome DNA reaches 0.05 ng / mu LDNA, and the threshold value of detection of fusarium oxysporum conidia in soil is 100 spores per gram of soil.

The present disclosure provides an entomopathogenic fungi conidia powder, which comprises a powder and conidia attached to the surface of the powder. On the other hand, the present disclosure further provides a method for producing the entomopathogenic fungi conidia powder. Based on the disclosure of the present disclosure, the production method uses a powder to adhere to the entomopathogenic fungi conidia, and allowing them to be stored at room temperature for at least 7 months with a substantially same amount of conidia population. In addition, the production method using solid fermentation reduces production costs.

The present invention belongs to the field of biotechnology, and specifically relates to the FpMCoL protein of Pseudofusorium graminearum, its encoding gene and application. The FpMCoL protein provided by the present invention is shown in Sequence 2; its encoding gene is shown in Sequence 1. Experiments have shown that the protein provided by the present invention plays an important role in the growth and development of Pseudofusorium graminearum itself, which is specifically manifested in that after the protein is missing, the mycelial growth rate of Pseudofusorium graminearum slows down, the amount of conidia produced is reduced, and the pathogenicity is reduced. Therefore, the present invention provides a technical basis for exploring the growth and development and pathogenic mechanism of Pseudofusorium graminearum, and provides a potential molecular target for the research and development of new fungicides in the future.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

A Bipolaris yamadae (Y. Nisik.) shoemaker (HXDC-1-2), and a screening and identification method therefor and use thereof. The Bipolaris yamadae (Y Nisik.) strain (HXDC-1-2) is deposited in the China General Microbiological Culture Collection Center with the accession number CGMCC No. 17778. The Bipolaris yamadae (Y. Nisik.) strain (HXDC-1-2) is applied to biological weed control when the conidial concentration is 102 conidia / ml or more.

The invention belongs to the technical field of agricultural disease control, and discloses a fusarium pseudograminearum GPI anchoring protein and an application of a coding gene of the fusarium pseudograminearum GPI anchoring protein. The fusarium pseudograminearum FpPer1 gene is knocked out, so that the mycelial growth rate, conidium yield and pathogenicity of the fusarium pseudograminearum FpPer1 gene are remarkably inhibited, and meanwhile, the gene knockout strain is more sensitive to bactericides such as tebuconazole. The gene can be used as a novel target for designing a pesticide synergist; or a small molecule compound, polypeptide or nucleic acid medicine is designed based on the FpPer1 gene or the FpPer1 protein coded by the FpPer1 gene, and is compounded with the existing bactericide (such as tebuconazole) to improve the pesticide effect. A new target is provided for prevention and control of wheat stem rot, efficient prevention and control are achieved by interfering a pathogen protein post-translational modification approach, the toxin pollution risk is reduced, and wide agricultural application prospects are achieved.

The present invention relates to: a composition and a method for biologically controlling plant or crop diseases, the composition comprising three antagonistic microorganisms such as Bacillus velezensis CT-1, Bacillus amyloliquefaciens PT-1, and Paenibacillus polymyxa BW-1. The germination ability of pathogenic conidia that causes infection by adhering to and inhabiting flowers (floral organs) is suppressed by treating with a culture medium or extract of the novel strain, whereby the proliferation of pathogens is suppressed or the infiltration of bacteria into tissues is blocked, and thus the present invention can be effectively used for the stable production and environmentally friendly quality maintenance of fruits.

The present invention belongs to the technical field of aspergillosis treatment, and specifically discloses the use of carbonyl cyanide-4-trifluoromethoxyphenylhydrazone in the prevention and treatment of Aspergillus fumigatus infection, that is, using it as the sole active ingredient in the preparation of a drug for preventing or treating diseases caused by Aspergillus fumigatus infection, or for the preparation of an antibacterial and / or bactericidal product for Aspergillus fumigatus. The present invention first discovered that carbonyl cyanide-4-trifluoromethoxyphenylhydrazone has a significant inhibitory effect on both wild-type and drug-resistant strains of the human pathogenic fungus Aspergillus fumigatus, and can inhibit its colony growth, hyphal growth, and conidia formation, thereby providing a new therapeutic drug for Aspergillus fumigatus infection. At the same time, it solves the problem of antibiotic resistance that plagues the clinical treatment of Aspergillus fumigatus infection, and can circumvent the disadvantage that antibiotics are prone to drug resistance.

The invention discloses beauveria bassiana QSE-F1 and application of the beauveria bassiana QSE-F1 in preparation of a biological preparation for preventing and treating botrytis cinerea. The beauveria bassiana QSE-F1 is a plant endophyte separated and screened from tomato stems, the classification name of the beauveria bassiana QSE-F1 is Beauveria bassiana, the beauveria bassiana QSE-F1 is preserved in the China Center for Type Culture Collection, and the preservation number of the beauveria bassiana QSE-F1 is CCTCC NO: M 20241661. A bacterial colony of the beauveria bassiana QSE-F1 is flat, villus-shaped, thick in middle and thin in edge, the surface of the bacterial colony is initially milky white and gradually becomes faint yellow along with the increase of culture time, and the bacterial colony is milky white powder after spores are generated in the later period; the QSE-F1 hyphae are colorless and transparent and are provided with diaphragms, and most conidia are spherical and oval. Experiments prove that the fermentation filtrate of the beauveria bassiana QSE-F1 can remarkably inhibit spore germination and hypha growth of botrytis cinerea, has a remarkable prevention and treatment effect on the occurrence of the botrytis cinerea, can be used for preparing biological agents for preventing and treating the botrytis cinerea, and has a good market application prospect.

The invention discloses a primer group for detecting fusarium graminearum and a growth and development stage of the fusarium graminearum and application of the primer group, and belongs to the technical field of biology. The primer group comprises an upstream primer 05737-F as shown in SEQ ID NO. 2, and a downstream primer 05737-R as shown in SEQ ID NO. 3. The primer group is characterized in that the primer group comprises an upstream primer 05737-F as shown in SEQ ID NO. A pair of special primer sequences for detecting the gene is designed by utilizing the FGSG05737 gene, and the fusarium graminearum can be identified through PCR (Polymerase Chain Reaction). According to different expression quantities of FGSG05737 in different growth stages of fusarium graminearum, RT-qPCR experiments are combined to define the hypha stage and the spore stage of fusarium graminearum, semi-quantitative detection of the number of conidia of fusarium graminearum can be achieved, the growth and development stage and the infection process of fusarium graminearum can be predicted, and the effect of giving out disease early warning in advance is achieved.

The invention discloses a method for rapidly detecting aspergillus conidia in a label-free manner through terahertz near-field imaging, and belongs to the technical field of microbiological detection. The method comprises the following steps: synchronously acquiring atomic force microscope morphology images and terahertz near-field signals of spores through a scattering type terahertz time-domain spectrum near-field scanning system, and jointly extracting morphology features, multi-order harmonic signal intensity and a local near-field amplitude spectrum peak value after phase-locked amplification and demodulation processing; and combining into a feature set for spore type identification. The method provided by the invention solves the problem that high-resolution, label-free and rapid detection cannot be realized at the same time in the prior art, and is mainly used for rapid label-free accurate detection and type identification of the aspergillus conidia.

The invention relates to application of AoRis1 protein in influencing the number of three-dimensional fungus nets generated by nematode-trapping fungi or the yield of conidia. Wherein the amino acid sequence of the AoRis1 protein is shown as SEQ ID NO.2, and compared with the AoRis1 protein encoding gene expression before silencing, the AoRis1 protein expression in the nematode-trapping fungi is silenced so as to increase the number of three-dimensional fungus nets generated by the nematode-trapping fungi and / or the yield of conidia. The engineering bacterium with the AoRis1 gene knocked out or deleted can improve the pathogenicity to nematodes, so that the engineering bacterium can be used as an efficient biological nematode killing preparation, and the use cost is greatly reduced.

This invention relates to the field of plant disease biological control technology, and particularly to a Fusarium oxysporum cell wall extract, its preparation method, and its application. The extract is derived from the polysaccharide fraction of the cell wall of Fusarium oxysporum spores or hyphae, and contains at least one pathogen-associated molecular pattern (PAMP) component. This component is a non-protein, thermally stable, species-nonspecific elicitor capable of forming an aqueous dispersion system. The extract of this invention can be recognized by plant PRRs and activate PTI immunity. Rehmannia glutinosa tubers treated with the extract showed a significantly increased germination rate after inoculation with Fusarium oxysporum. It also induces superoxide anion production, upregulates the activities of superoxide dismutase, peroxidase, and catalase, and enriches differentially expressed genes in the MAPK signaling pathway, jasmonic acid metabolism pathway, and phenylpropane biosynthesis pathway. Furthermore, the extract can directly inhibit Fusarium oxysporum colony expansion, conidia production, and mycelial growth. Extracts derived from spores or hyphae show no significant difference in inducing disease resistance, and the raw materials are flexible and easy to industrialize. This extract is derived from the cell wall of the pathogen itself, making it environmentally friendly and free from the risk of chemical pesticide residues. It is suitable for the green control of root rot disease in Rehmannia glutinosa.

The invention discloses a penicillium mi bacterial strain with a broad-spectrum bacteriostatic effect and application thereof, and relates to the technical field of biocontrol fungus screening, the bacterial strain is preserved in China General Microbiological Culture Collection Center on June 3, 2024, and is classified and named as Penicilliumfratuariae-cellate, and the penicilliumfratuariae-cellate is named as Penicilliumfratuariae-cellate in China General Microbiological Culture Collection Center in China Committee for Culture Collection of Microorganisms on June 3, 2024. The strain can significantly inhibit the growth of phytopathogens such as pseudograminearum, botrytis cinerea, northern leaf spot helminthosporium botrytis, colletotrichum graminearum, alternaria alternata, phytophthora capsici, Euclidea carotovora and carrot soft rot pathotype. The conidium powder of the strain is used for dressing wheat seeds, and the wheat basal stem rot can be effectively prevented and controlled, so that the strain can be used for preparing a biocontrol agent, and the biocontrol agent is simple to use, good in effect, safe and reliable, and has a good market application prospect.

The present invention discloses a method for industrialized cultivation of Cordyceps sinensis, comprising the following steps: inoculating conidia of Cordyceps sinensis into the body of Hepialus armoricanus larvae, and culturing the infected larvae; collecting the appearance images of Cordyceps sinensis, and judging the growth stage it is in according to the collected images; according to the real-time growth stage of Cordyceps sinensis, retrieving the corresponding environmental instructions to control the environmental parameters of the multi-layer cultivation rack area. After inoculating the conidia into the body of Hepialus armoricanus larvae, the present invention conducts artificial cultivation, and uses image acquisition to judge the growth stage of Cordyceps sinensis, presetting different light control conditions for different growth stages to achieve adaptive light control, providing the best environmental control for the growth of Cordyceps sinensis, and growing Cordyceps sinensis with good morphology and rich nutrients.

The invention belongs to the technical field of microorganisms, and particularly relates to an aspergillus strain or conidia thereof and application of the aspergillus strain or the conidia thereof in insect prevention and control. The preservation number of the aspergillus is CGMCC (China General Microbiological Culture Collection Center) The aspergillus or conidia thereof has excellent insecticidal activity on solenopsis invicta, and the insecticidal activity on the solenopsis invicta in a suspension with the concentration of 1 * 10 < 8 > spore / mL can reach 99% or above.

The present invention provides a strain of Penicillium oxalicum JM‑C14‑2 and an application thereof, belonging to the field of microbial technology, and the deposit number of the Penicillium oxalicum JM‑C14‑2 is CCTCC NO: M 20232615. The front colony of the Penicillium oxalicum JM‑C14‑2 is dark green, with neat edges, a dense villi-like structure covering the surface, and a concentric ring texture formed in the center of the colony; conidiophores are usually solitary or branched, with a typical broom-like branch structure at the top, and conidia chains are arranged radially with a smooth surface. The Penicillium oxalicum strain has an obvious ability to produce cellulase, and also has a strong ability to produce neutral phosphatase, can prevent the spread and growth of pathogens, can be prepared into a biological preparation that promotes plant growth and inhibits pathogens, and at the same time improves soil nutrients, so it has a wide range of market application prospects.

The invention discloses a trichoderma inoculant fermented by utilizing mulberry branches and application of the trichoderma inoculant in preventing and treating anthracnose. The trichoderma inoculant is obtained by fermenting trichoderma by utilizing the mulberry branches. The preparation method comprises the following steps: activating and culturing a trichoderma strain, preparing a conidium suspension, carrying out enlarged fermentation culture in a culture medium containing mulberry branches, and filtering the fermentation liquor to obtain a filtrate, namely the mulberry branch fermented trichoderma agent. The trichoderma fungicide cultured by taking mulberry branches as a fermentation substrate has broad-spectrum antibacterial activity, has a relatively good antagonistic effect on mulberry anthracnose pathogens, can be used for preventing and treating mulberry and strawberry anthracnose, and has a wide application prospect.