45 results about "Conidium" patented technology

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

The invention relates to the technical field of bioengineering, in particular to a method for promoting cordyceps sinensis to produce conidia. The invention provides a method for promoting cordyceps sinensis to produce conidia, which comprises the following steps: (1) carrying out dark culture on cordyceps sinensis on a primary solid culture medium to obtain mycelium; and (2) transferring the mycelium obtained in the step (1) to a secondary solid culture medium, and carrying out environmental stimulation culture until conidia are generated. The method is suitable for industrial production, has the advantages of simplicity and convenience in operation, controllable cost, high repeatability and the like, can effectively shorten the fermentation period, improves the inoculation efficiency and the yield of metabolites, and provides reliable technical support for large-scale artificial culture and deep development of cordyceps sinensis.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

A Bipolaris yamadae (Y. Nisik.) shoemaker (HXDC-1-2), and a screening and identification method therefor and use thereof. The Bipolaris yamadae (Y Nisik.) strain (HXDC-1-2) is deposited in the China General Microbiological Culture Collection Center with the accession number CGMCC No. 17778. The Bipolaris yamadae (Y. Nisik.) strain (HXDC-1-2) is applied to biological weed control when the conidial concentration is 102 conidia / ml or more.

The invention belongs to the technical field of agricultural disease control, and discloses a fusarium pseudograminearum GPI anchoring protein and an application of a coding gene of the fusarium pseudograminearum GPI anchoring protein. The fusarium pseudograminearum FpPer1 gene is knocked out, so that the mycelial growth rate, conidium yield and pathogenicity of the fusarium pseudograminearum FpPer1 gene are remarkably inhibited, and meanwhile, the gene knockout strain is more sensitive to bactericides such as tebuconazole. The gene can be used as a novel target for designing a pesticide synergist; or a small molecule compound, polypeptide or nucleic acid medicine is designed based on the FpPer1 gene or the FpPer1 protein coded by the FpPer1 gene, and is compounded with the existing bactericide (such as tebuconazole) to improve the pesticide effect. A new target is provided for prevention and control of wheat stem rot, efficient prevention and control are achieved by interfering a pathogen protein post-translational modification approach, the toxin pollution risk is reduced, and wide agricultural application prospects are achieved.

The present invention relates to: a composition and a method for biologically controlling plant or crop diseases, the composition comprising three antagonistic microorganisms such as Bacillus velezensis CT-1, Bacillus amyloliquefaciens PT-1, and Paenibacillus polymyxa BW-1. The germination ability of pathogenic conidia that causes infection by adhering to and inhabiting flowers (floral organs) is suppressed by treating with a culture medium or extract of the novel strain, whereby the proliferation of pathogens is suppressed or the infiltration of bacteria into tissues is blocked, and thus the present invention can be effectively used for the stable production and environmentally friendly quality maintenance of fruits.

The invention discloses a method for rapidly detecting aspergillus conidia in a label-free manner through terahertz near-field imaging, and belongs to the technical field of microbiological detection. The method comprises the following steps: synchronously acquiring atomic force microscope morphology images and terahertz near-field signals of spores through a scattering type terahertz time-domain spectrum near-field scanning system, and jointly extracting morphology features, multi-order harmonic signal intensity and a local near-field amplitude spectrum peak value after phase-locked amplification and demodulation processing; and combining into a feature set for spore type identification. The method provided by the invention solves the problem that high-resolution, label-free and rapid detection cannot be realized at the same time in the prior art, and is mainly used for rapid label-free accurate detection and type identification of the aspergillus conidia.

The invention relates to application of AoRis1 protein in influencing the number of three-dimensional fungus nets generated by nematode-trapping fungi or the yield of conidia. Wherein the amino acid sequence of the AoRis1 protein is shown as SEQ ID NO.2, and compared with the AoRis1 protein encoding gene expression before silencing, the AoRis1 protein expression in the nematode-trapping fungi is silenced so as to increase the number of three-dimensional fungus nets generated by the nematode-trapping fungi and / or the yield of conidia. The engineering bacterium with the AoRis1 gene knocked out or deleted can improve the pathogenicity to nematodes, so that the engineering bacterium can be used as an efficient biological nematode killing preparation, and the use cost is greatly reduced.

This invention relates to the field of plant disease biological control technology, and particularly to a Fusarium oxysporum cell wall extract, its preparation method, and its application. The extract is derived from the polysaccharide fraction of the cell wall of Fusarium oxysporum spores or hyphae, and contains at least one pathogen-associated molecular pattern (PAMP) component. This component is a non-protein, thermally stable, species-nonspecific elicitor capable of forming an aqueous dispersion system. The extract of this invention can be recognized by plant PRRs and activate PTI immunity. Rehmannia glutinosa tubers treated with the extract showed a significantly increased germination rate after inoculation with Fusarium oxysporum. It also induces superoxide anion production, upregulates the activities of superoxide dismutase, peroxidase, and catalase, and enriches differentially expressed genes in the MAPK signaling pathway, jasmonic acid metabolism pathway, and phenylpropane biosynthesis pathway. Furthermore, the extract can directly inhibit Fusarium oxysporum colony expansion, conidia production, and mycelial growth. Extracts derived from spores or hyphae show no significant difference in inducing disease resistance, and the raw materials are flexible and easy to industrialize. This extract is derived from the cell wall of the pathogen itself, making it environmentally friendly and free from the risk of chemical pesticide residues. It is suitable for the green control of root rot disease in Rehmannia glutinosa.

The invention belongs to the technical field of microorganisms, and particularly relates to an aspergillus strain or conidia thereof and application of the aspergillus strain or the conidia thereof in insect prevention and control. The preservation number of the aspergillus is CGMCC (China General Microbiological Culture Collection Center) The aspergillus or conidia thereof has excellent insecticidal activity on solenopsis invicta, and the insecticidal activity on the solenopsis invicta in a suspension with the concentration of 1 * 10 < 8 > spore / mL can reach 99% or above.

The invention discloses a trichoderma inoculant fermented by utilizing mulberry branches and application of the trichoderma inoculant in preventing and treating anthracnose. The trichoderma inoculant is obtained by fermenting trichoderma by utilizing the mulberry branches. The preparation method comprises the following steps: activating and culturing a trichoderma strain, preparing a conidium suspension, carrying out enlarged fermentation culture in a culture medium containing mulberry branches, and filtering the fermentation liquor to obtain a filtrate, namely the mulberry branch fermented trichoderma agent. The trichoderma fungicide cultured by taking mulberry branches as a fermentation substrate has broad-spectrum antibacterial activity, has a relatively good antagonistic effect on mulberry anthracnose pathogens, can be used for preventing and treating mulberry and strawberry anthracnose, and has a wide application prospect.

The present application provides a strain of Trichoderma asperellum TAZ19, a biocontrol agent and application thereof, wherein the Trichoderma asperellum TAZ19 is preserved in China Center for Type Culture Collection on October 25, 2024, and the preservation number is CCTCC M 20242341. The active ingredient of the biocontrol agent comprises the above-mentioned Trichoderma asperellum TAZ19 strain, and the Trichoderma asperellum TAZ19 strain is one or more of conidium, mycelium, fermentation filtrate or active extract thereof. The Trichoderma asperellum TAZ19 has excellent antagonistic effect on multiple plant disease pathogens such as Diaporthe phaseolorum, multiple Fusarium oxysporum, Valsa mali, and Botryosphaeria dothidea, has broad-spectrum antibacterial property, fast growth, high antibacterial activity, strong parasitism, and good salt and alkali tolerance, and has a growth-promoting effect on plants. The Trichoderma asperellum TAZ19 can be widely applied to the prevention and treatment of multiple plant diseases such as pine branch and stem rot, wheat stem base rot, tomato wilt, and has a wide application prospect.

The invention provides application of beauveria bassiana HFBb18 in preparation of a green peach aphid biological control entomopathogenic fungus agent, and belongs to the technical field of agricultural biology. The inventor acquires and identifies three new strains of beauveria bassiana from the field, then selects three strains of beauveria bassiana preserved in a laboratory, and finds that the newly found HFBb18 strain has high toxicity to green peach aphids through indoor toxicity determination. On the basis, the influence of infection of the HFBb18 strain on the activities of detoxifying enzyme and protecting enzyme of green peach aphid is determined. Furthermore, the wettable powder taking the HFBb18 strain conidia as a main active ingredient is prepared, the potting pesticide effect test control effect of the wettable powder on green peach aphids is defined, and a foundation is laid for development and application of a novel fungal aphid killing agent.

The invention belongs to the technical field of insect prevention preparations, and particularly relates to application of aspergillus or conidia thereof to prevention and control of spodoptera frugiperda. The Aspergillus sp. With the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.42111 or conidia of the Aspergillus sp. Has excellent insecticidal activity on the spodoptera frugiperda, and the insecticidal activity on the spodoptera frugiperda in a suspension with the concentration of 1 * 10 < 8 > spore / mL can reach 99% or above. Besides, the aspergillus wettable powder containing the spore powder of the aspergillus still has excellent insecticidal activity on spodoptera frugiperda, and has excellent stability, and the stable period at normal temperature reaches 12 months or above.

The application of ceramide in the control of rice blast fungus falls within the field of biological control. This invention relates to the application of ceramide in the control of rice blast fungus: a combination of ceramide and lipopeptides is used for the control of rice blast fungus. Exogenous addition of ceramide significantly enhances the stress effect of lipopeptides on rice blast fungus. It also enhances the abnormal accumulation of glycogen and lipid droplets in conidia, promotes the bursting of ROS, and increases intracellular ceramide and calcium... 2+ The invention increases the content of malondialdehyde (MDA) in mycelium, enhances membrane lipid peroxidation, and decreases ergosterol content. Furthermore, it inhibits the expression of ergosterol synthesis genes, UPR target genes, and sphingolipid metabolism-related genes. This invention develops a highly efficient natural agent against rice blast by combining exogenous Cer with lipopeptides. This agent effectively reduces the pathogenicity of rice blast fungus and significantly inhibits its infection of rice, laying the foundation for the development of novel biological control agents.

The present application relates to a kind of spherical ring conidium and its application in the preparation of high-efficiency real fly attractant, the spherical ring conidium is (Torulaspora globose) F-HY017-Y1, the high-efficiency real fly attractant includes 20-40% of yeast source active ingredient, the yeast source active ingredient is the fermentation product of the above-mentioned spherical ring conidium.The present application is screened to obtain a kind of yeast, confirms that the fermentation product has high-efficiency attraction effect to real fly female and male, and the strain is isolated from the host of target pest feeding, and more specific;And in the preparation of high-efficiency real fly attractant, the present application optimizes the process, further enzymolysis is carried out after yeast fermentation, releases the core active ingredient, greatly improves the utilization of yeast fermentation product, and the attraction efficiency to real fly pest is higher.

The invention relates to a Streptomyces rhizosphere strain 14-3, the Streptomyces rhizosphere strain 14-3 is preserved in the Guangdong Microbiological Culture Collection Center, the preservation number is GDMCC No. 63693, and the preservation date is August 3, 2023, the preservation number is CGMCC No. 63693, the preservation number is CGMCC No. 63693, the preservation number is CGMCC No. 63693, the preservation number is CGMCC No. 63693, the preservation number is CGMCC No. 63693, and the preservation number is CGMCC No. 63693, and the preservation number is CGMCC No. 63693. The streptomyces rhizosphere strain 14-3 has a strong antagonistic effect on the main pathogenic bacterium colletotrichum truncatum causing the soybean anthracnose, and the fermentation liquor of the streptomyces rhizosphere strain 14-3 can obviously inhibit the mycelial growth of the colletotrichum truncatum, completely inhibit the germination of conidia and cause the splitting decomposition of spore cells; and the obtained fermentation liquor not only has an excellent prevention and treatment effect on soybean anthracnose, but also has no influence on soybean growth.

The invention belongs to the technical field of agricultural biology, and particularly relates to trichoderma asperellum 1271 for specifically preventing and treating root-knot nematode and application of the trichoderma asperellum 1271. The invention provides the trichoderma asperellum 1271 with the preservation number of CGMCC No.42153, hyphae of the trichoderma asperellum 1271 are white filamentous and grow rapidly, conidia close to the center are dark green, conidiophore is dispersed in the whole bacterial colony or gathered into concentric rings, the conidia are spherical, and the trichoderma asperellum 1271 can be used for preventing and treating root-knot nematode, especially cucumber phaseolus calcaratus root-knot nematode. On the basis, the invention further provides a bacterium-pesticide combination for preventing and treating the root-knot nematode, after the bacterium-pesticide combination is applied to cucumbers, an excellent prevention and treatment effect is achieved for the auricularia auricula-bean root-knot nematode, and the prevention effect of the bacterium-pesticide combination is obviously superior to that of a chemical agent with the same concentration and a single biocontrol bacterium; meanwhile, the dosage of chemical agents is effectively reduced, the generation of the drug resistance of pathogens to the chemical agents is retarded, and the fungicide combination is environment-friendly, green and safe.

The invention belongs to the technical field of microorganisms, and discloses an African trichoderma harzianum strain and application thereof in inhibition of a fusarium graminearum source. The African trichoderma harzianum is separated from wheat field soil, the strain number of the African trichoderma harzianum is XY8-4, and the preservation number of the African trichoderma harzianum is CGMCC (China General Microbiological Culture Collection Center) No.41512. The strain can inhibit the growth of fusarium graminearum hyphae and the generation and germination of conidia, has a hyperparasitism effect, can also significantly inhibit the fusarium graminearum from forming ascocysts on sick residues, reduces the number of initial infection sources, can be applied to preparation of a wheat scab biocontrol agent, and has a broad application prospect. Microbial resources and technical approaches are provided for reducing the use of chemical pesticides and realizing green prevention and control of the gibberellic disease.

The invention discloses an Aspergillus ochraceus Slt L1 strain and application thereof. The Aspergillus ochraceus Slt L1 strain has the morphological characteristics that after the Aspergillus ochraceus Slt L1 strain is cultured on a PDA culture medium for 7 days, typical Aspergillus ochraceus colony characteristics are formed, hyphae are separated and branched, conidiophore is upright, and conidia are spherical to nearly spherical. The prodenia litura strain has obvious pathogenicity to prodenia litura eggs, can lead to 100% of egg death rate, and has wide metabolic adaptability and environmental tolerance. Through the determination of a Biolog phenotype chip system, the bacterium can efficiently utilize a carbon source, a nitrogen source, a phosphorus source, a sulfur source and a plurality of biosynthetic pathways, and can keep the growth activity under the extreme conditions of osmotic pressure and pH. The microbial inoculum can be used for biological control of prodenia litura, and has the characteristics of greenness, high efficiency, environmental friendliness and the like.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

The invention discloses bacillus velezensis CX-065 with broad-spectrum antibacterial property and application of the bacillus velezensis CX-065, and belongs to the technical field of microorganisms. The invention discloses bacillus velezensis CX-065 which is classified and named as bacillus velezensis, the preservation number of the bacillus velezensis CX-065 is CGMCC No.36269, the bacterial colony of the bacillus velezensis CX-065 is irregular and is off-white to milk white, the surface of the bacillus velezensis CX-065 is rough and wrinkled, and the thalli are rod-shaped. The bacillus velezensis CX-065 disclosed by the invention has a broad-spectrum antibacterial property, can inhibit 10 kinds of wheat soil-borne pathogenic bacteria, also can destroy cell membranes of conidia of pathogenic bacteria and inhibit germination of the conidia, and has the functions of producing urea, cellulase and amylase and producing iron; the bacillus velezensis CX-065 is used for inhibiting soil-borne pathogenic bacteria or improving crop growth, the application prospect is wide, and a new direction and a new way are provided for biocontrol preparations of crops.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

A biocontrol formulation for plant pathogens includes a Trichoderma viride filtrate and an inert substance selected from the group consisting of a viscosity reducer, a surfactant, flour, clay, and combinations thereof. In an embodiment, the filtrate includes conidia of the Trichoderma viride. In an embodiment, the filtrate includes byproducts obtained from the fermentation of Trichoderma viride. In an embodiment, the byproducts include at least one of the organic acids, growth regulators, and amino acids.

The invention relates to a method for culturing conidia of cucumber target leaf pathogen, which comprises the following steps of: inoculating target leaf pathogen into a PDA (potato dextrose agar) culture medium, and culturing at room temperature under the condition of complete illumination. Preferably, the yield of the conidia is the highest after the conidia are cultured for 7-8 days under the conditions of continuous white light irradiation at room temperature and the illumination intensity of 6000 Lus, the method disclosed by the invention can be used for remarkably improving the generation of the conidia of the cucumber target leaf spot pathogen and improving the culture efficiency and yield of the conidia, and a simple and stable technical system for improving the generation of the conidia of the cucumber pathogenic bacteria is established. The method provides better technical support for stably screening out excellent target leaf spot resistant cucumber germplasm and for creation of target leaf spot resistant cucumber germplasm and research of new variety breeding.

The present disclosure provides antifungal compositions comprising a conidium germination inhibition (CGI) factor, a CGI factor precursor, a CGI factor fragment, and a CGI factor motif and a fungicide. In addition, the disclosure provides methods of controlling or inhibiting fungal growth and infection, as well as methods of treating fungal diseases using compositions comprising CGI factor, CGI factor precursors, CGI factor fragments, and CGI factor motifs, and fungicides.

The invention provides a YOLOv8-based pathogenic bacteria conidium detection method. The method comprises the following steps: 1) collecting and making pathogenic bacteria conidium data; 2) construction of a pathogenic bacteria conidium detection model, the pathogenic bacteria conidium detection model is divided into a trunk part, a neck part and a head part based on a YOLOv8 network structure, a space depth conversion convolution module and a partial self-attention mechanism module are introduced into the trunk part, and a tiny target detection head is added to the head part; 3) training a pathogenic bacteria conidium detection model, and obtaining an optimal weight file after training is completed; (4) acquiring and preprocessing a conidium image of pathogenic bacteria to be detected, and (5) inputting the conidium image of the pathogenic bacteria to be detected preprocessed in the step (4) into the conidium detection model of the pathogenic bacteria which is trained in the step (3) and loaded with the optimal weight file to obtain a conidium detection result of the pathogenic bacteria.

The invention discloses Purpureocillium lilacinum DC-2 and application thereof, and the Purpureocillium lilacinum DC-2 has the morphological characteristics that: within 2 days after inoculation, a bacterial colony is in a white round shape and a regular round shape, and after 3 days of inoculation, the bacterial colony is in a purple color, smooth in edge, felt-shaped in surface and compact, and hyphae are easy to pick. The bacterial strain grows fast on a PDA plate, and the diameter of the bacterial colony reaches 2 cm after the bacterial strain is inoculated for 5 days. An optical microscope is used for observing and finding that hyphae are colorless, conidiophore is in a wheel-shaped branch and has 3-5 wheel layers, single hyphae and spores are generated from main hyphae, and the conidiospores are in chain-shaped attachment, have single spores, are colorless and are mostly elliptical. The Purpureocillium lilacinum disclosed by the invention has a remarkable inhibition effect on bifidobacterium keratinoides, cladosporium angustifolium, penicillium oxalicum, epicoccum tritici, mucor sulaginosus, varicella ocularis and nimeraea in leaf pathogenic mycetes of large cherries.

The invention discloses a trehalose polymer as well as a preparation method and application thereof. The structural formula of the trehalose polymer is as follows: trithioester on a main chain of the trehalose polymer can absorb ultraviolet rays; the hydrophobic carbon chain on the main chain of the polymer and the hydrophobic chain dodecyl acrylate on the side chain of the polymer can be embedded on the surface of metarhizium robertii conidia through hydrophilic and hydrophobic interaction, the polymer has the capability of protecting the conidia against ultraviolet stress, and the hydrophilic chain trehalose can reduce the influence of heat stress on the conidia. In practical application of metarhizium anisopliae, the trehalose polymer material is attached to the surfaces of metarhizium anisopliae spores, and a protective shell is formed on the surfaces of pathogenic unit conidia of the metarhizium anisopliae spores, so that the heat resistance and ultraviolet resistance of the metarhizium anisopliae are improved, and the problem that the metarhizium anisopliae is limited by high temperature and ultraviolet stress during field pest control is solved.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.