225 results about "Aspergillus niger" patented technology

The invention discloses an aspergillus niger recombinant bacterium AnCT-XynB-K-agdA and application thereof, and belongs to the technical field of microbiology and bioengineering. According to the invention, Aspergillus niger AnCat is taken as an expression host, firstly, an acid protease regulatory factor prtT is knocked out to obtain a defective strain, and then different chaperonins are subjected to fusion expression by optimizing integration sites of a laccase lcc9 expression cassette, so that the high-expression laccase chaperonin is obtained. According to the method, an expression vector pC3-5 'agdA-PcitA-XynB-L-lcc9-hph-3' agdA is constructed, a recombinant bacterium AnCT-XynB-K-agdA is further obtained, the enzyme activity of the extracellular laccase subjected to shake flask fermentation reaches 1821.2 U / L, and finally, the recombinant efficient expression of the laccase Lcc9 in aspergillus niger is realized.

The invention discloses a traditional Chinese medicine residue organic compound fertilizer special for acid-base imbalance barren soil and a production method, and relates to the technical field of soil improvement and fertilizer.The organic compound fertilizer is prepared from, by volume, 50-70 parts of fermented traditional Chinese medicine residue matrix, 15-30 parts of mineral nutrient unit, 5-15 parts of biological activity enhancer and 3-10 parts of structure conditioner; wherein the fermented traditional Chinese medicine residue matrix is prepared by taking traditional Chinese medicine pharmacy mixed residues as raw materials and performing solid-state fermentation through a complex microbial inoculant containing aspergillus niger and the like; the mineral nutrient unit is compounded by urea and the like; the biological activity enhancer contains humic acid and the like; the structure conditioner is a mixture of attapulgite and sodium carboxymethyl cellulose (5: 1-8: 1). According to the organic compound fertilizer, the fermented traditional Chinese medicine residues with the organic matter content larger than or equal to 45% serve as a matrix, the mineral nutrient unit, the biological activity enhancer and the structural conditioner which are coated in a slow-release mode are matched, a synergistic system is formed, three-stage fermentation is adopted, the microbial activity is kept, and the pH lt can be improved; 6.0 or gt; 8.5 of sand / clayey barren soil.

The invention discloses a fermentation process of citric acid residues, and relates to the technical field of organic acid fermentation. The fermentation process comprises the following steps: mixing and crushing citric acid residues and wheat bran according to a mass ratio of (4-5): 1 to obtain a mixed material; spraying an ammonia water solution, a magnesium sulfate solution and a zinc sulfate solution into the mixed material, adjusting the pH value to 5.0-5.5, sterilizing, adding a urea solution and a basic nutrient solution, and uniformly mixing to obtain slurry; aspergillus niger and saccharomycopsis fibuligera are mixed according to the spore number ratio of 100: 1, then sterile water is added, the mixture is stirred to be uniform, and bacterial liquid with the spore concentration of 1 * 10 < 7 >-5 * 10 < 7 > / mL is obtained; spraying the bacterial liquid to the surface of the slurry, performing aerobic culture for 40-48 hours under the conditions that the temperature is 30-35 DEG C and the humidity is 80-85%, then cooling to 25-30 DEG C, reducing the humidity to 70-75%, spraying methanol at the same time, and performing sealed culture for 5-6 days; performing drying; and the acid yield and the nutrient substance yield in the finally obtained fermentation product are obviously improved.

The application provides a recombinant Aspergillus niger with high trans-aconitic acid yield and a construction method and application thereof, and relates to the technical field of genetic engineering. Specifically, the recombinant Aspergillus niger heterogeneously expresses aconitate isomerase TbrA and / or Adi1. The application provides a new engineering strain for efficient production of trans-aconitic acid, solves the source predicament of needing plant extraction or needing chemical synthesis in traditional production of trans-aconitic acid, and greatly improves the yield of trans-aconitic acid.

The invention discloses a microbial soil conditioner and a preparation method thereof, and relates to the technical field of soil improvement. The method comprises the following steps: culturing heavy metal-resistant chlorella and aspergillus niger to obtain a mixed bacterial suspension, combining the mixed bacterial suspension with a composite chelating modifier prepared by reacting chitosan quaternary ammonium salt, ethylenediamine tetraacetic acid and epichlorohydrin, carrying out crosslinking by using genipin to obtain a functional microbial agent, and carrying out pyrolysis and acid oxidation on corn straws as a raw material to obtain the heavy metal-resistant chlorella modified functional microbial agent. The preparation method comprises the following steps: preparing a nano zero-valent iron-biochar composite material, reducing and loading ferrous ions through sodium borohydride, preparing the nano zero-valent iron-biochar composite material, mixing the nano zero-valent iron-biochar composite material with zeolite, bentonite and a silane coupling agent, carrying out spray drying to prepare a porous carrier substance, and finally stirring and mixing an organic fertilizer complex microbial inoculant, the functional microbial inoculant and the carrier substance, and aging to prepare the soil conditioner. The prepared conditioner has a good remediation effect on soil heavy metal pollution.

The invention discloses a synthetic microbial agent for treating uranium-contaminated soil and a preparation method of the synthetic microbial agent. The synthetic microbial agent is prepared from the following bacteria: P.adami, P.megatherium, bacillus subtilis, Artobacter volluticus, symbiotic fungi, Aspergillus niger, sulfate reducing bacteria and Shewanella. The symbiotic fungi are mucor lastein, mucor unimingguminum, mucor circinelloides, mucor dense, rhizopus arrhizus and phylum phthochytrium parasitic fungi. The prepared synthetic microbial agent and synthetic microbial embedded balls are applied to uranium-contaminated soil remediation, the key enzyme activity can be effectively improved, the soil metabolism function is enhanced, meanwhile, exchangeable uranium with high ecological risk is converted into stable and low-harm residual uranium, the mobility and bioavailability of uranium in soil are effectively weakened, and the uranium-contaminated soil remediation effect is improved. Therefore, immobilized remediation of uranium is realized, and a good soil uranium fixing effect is achieved.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

The present application belongs to the technical field of composite Fu tea, and particularly relates to a forsythia suspense leaf tea, walnut branch wood composite Fu tea and a preparation method thereof. The forsythia suspense leaf tea, walnut branch wood composite Fu tea is prepared by adding composite strains to forsythia suspense leaf tea, black tea and branch wood silk after steam softening, and then performing two-stage fermentation and finally microwave treatment. The mass ratio of the forsythia suspense leaf tea, black tea, branch wood silk and composite strains is 40-70:20-50:10-30:0.5-1. The composite strains are prepared by mixing Eurotium cristatum liquid, Lactobacillus plantarum liquid and Aspergillus niger liquid at a mass ratio of 5-7:2-4:1. The two-stage fermentation is primary fermentation at 32-35 DEG C for 10-14 hours, and then secondary fermentation at 24-28.5 DEG C for 19-21 days. The forsythia suspense leaf tea, walnut branch wood composite Fu tea has a golden flower density of greater than 2.0*10 5 CFU / g dry tea, high forsythiaside retention rate, weak bitterness, strong aroma and good taste.

The application discloses a kind of fermentation complex microbial inoculant and preparation method and application thereof, the fermentation complex microbial inoculant includes the following weight parts of component: bacillus subtilis microbial inoculant 2-5 parts, bacillus mucilaginosus microbial inoculant 5-10 parts, yeast microbial inoculant 2-10 parts, trichoderma harzianum microbial inoculant 10-20 parts, aspergillus niger microbial inoculant 10-20 parts and streptococcus thermophilus microbial inoculant 2-5 parts;The fermentation complex microbial inoculant of the application is prepared by selecting each strain and amount, is added to pigeon manure and is fermented to prepare organic fertilizer, can better decompose macromolecular substance, significantly improve the organic matter and total nitrogen content in preparation organic fertilizer, and can better improve seed germination rate;In addition, the preparation method of pigeon manure organic fertilizer of the application is simple in process, easy to operate, and convenient for production.

The present application relates to the technical field of feed processing, and particularly relates to a preparation method of Maotai-flavor distiller's grains fermented feed, which comprises the following steps: drying treatment based on the moisture content of Maotai-flavor distiller's grains to obtain basic distiller's grains; determining the strain ratio of brewer's yeast, bacillus subtilis and aspergillus niger based on the tannin content of the basic distiller's grains to obtain a compound fermentation inoculant; inoculating and then fermenting; determining state evaluation parameters based on the total polyphenol accumulation rate, the dissolved oxygen consumption rate and the microbial activity index during the fermentation process, and performing qualified evaluation, and dynamically adjusting when unqualified; determining the fermentation end point based on the tannin degradation rate and the total polyphenol accumulation rate; and mixing the fermented distiller's grains with the basic feed at a mass ratio of 1% after low-temperature drying of the fermented distiller's grains. The present application realizes three-layer control of raw material evaluation, process control and end point determination, significantly improves the stability and content of functional active ingredients in the product, reduces the tannin and safety risk, and has a good intestinal health improvement effect on animals.

The invention provides a method for preparing high-activity chitosan oligosaccharide based on a microbial fermentation method. The method comprises the following steps: cooling a fermentation culture medium containing chitin powder, inoculating an aspergillus niger seed solution under stirring and ventilation, and fermenting for 24 hours; stopping stirring for 30 seconds, adding a soybean protein isolate solution, reducing the rotating speed to 180 rpm, and fermenting for 12 hours; continuously reducing the rotating speed to 150 rpm, adding a soybean protein isolate solution, and fermenting for 12-14 hours; and centrifuging the fermentation liquor, taking supernate, filtering, adding a xanthan gum solution, stirring, concentrating, drying in vacuum, and crushing, thereby obtaining the product. According to the method disclosed by the invention, the industrial pain points that oligosaccharide is easy to degrade and active sites are easy to oxidize in traditional fermentation are solved by virtue of segmented dynamic electrostatic combination and deep synergy of aspergillus niger directional fermentation enzyme production and soybean protein isolate, and the preparation of the high-activity chitosan oligosaccharide is realized.

The application relates to the field of genetic engineering, and discloses an Aspergillus niger, a construction method and application of the Aspergillus niger, and a method for producing citric acid and / or succinic acid. Aspergillus niger The Aspergillus niger is obtained by simultaneously overexpressing alpha-amylase and aspartic protease in a starting strain. The Aspergillus niger provided by the application can realize efficient degradation and conversion of starch by synergistically overexpressing amyA genes and pepA genes, solve the technical bottleneck that the original strain is limited in growth in a starch-based fermentation system and has insufficient acid production capacity, can efficiently produce succinic acid and citric acid by taking low-cost starch as the only carbon source, significantly reduce the industrial production cost of organic acid, and promote the green and sustainable upgrading of the fermentation industry.

Provided are an Aspergillus niger, a microbial agent thereof, a solid-state fermentation broth thereof, a preparation method therefor, and a use thereof. The Aspergillus niger is Aspergillus niger AGM01, which is preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO: M2024768. The Aspergillus niger has a relatively high enzyme activity of β-glucosidase. By performing fermentation and cultivation on the Aspergillus niger in a solid-state fermentation medium containing a small-molecule inducer so as to obtain a solid-state fermentation broth of the Aspergillus niger, the enzyme activity of β-glucosidase in the solid-state fermentation broth of the Aspergillus niger is improved.

The invention discloses a method for improving antioxidant activity of oil cakes through multi-strain fermentation combined with enzymolysis and application. The method comprises the following steps: adding a multi-strain mixed bacterium suspension into sterilized oil cakes, uniformly mixing, performing constant-temperature fermentation at 30 + / -2 DEG C, performing intermittent stirring in the fermentation process, and sequentially performing high-temperature sterilization and freeze-drying treatment after the fermentation is finished, the multi-strain mixed bacterium suspension is a mixed bacterium suspension of aspergillus niger, saccharomyces cerevisiae and bacillus subtilis, and the viable count ratio of the aspergillus niger to the saccharomyces cerevisiae to the bacillus subtilis in the multi-strain mixed bacterium suspension is (1-2): (1-2): (1-2). The application finds that a multi-strain composite fermentation combined enzymolysis technology can realize the synergistic interaction of fermentation and enzymolysis, obviously improves the antioxidant activity of the oil cake meal, and can be applied to preparation of cake meal feed.

The invention relates to the technical field of biological waste treatment, in particular to a preparation method and application of a silkworm sand feed additive. The invention provides a technical scheme for preparing a silkworm and mulberry sand feed additive rich in acid protease, pectinase and cellulase by taking silkworm sand as a core matrix and performing directional pretreatment, adaptive strain fermentation and standardized post-treatment. According to the invention, silkworm sand-corncob powder is used as a composite substrate, and the silkworm sand and the corncob powder complement each other in function, so that the problems of unbalanced nutrition and poor air permeability of a single substrate are solved. Specific aspergillus niger is used for segmented solid-state fermentation, parameters are set in a differentiated mode, and full-amount utilization of the silkworm sand is achieved; the product quality and enzyme activity are improved by optimizing the process, and the resource value is improved from the low-added-value field to the high-added-value enzyme preparation industry.

The invention belongs to the technical field of biological medicine manufacturing, and particularly relates to preparation and application of collagen peptide with whitening activity. The preparation method of the collagen peptide with the whitening activity comprises the following steps: step A, inoculating bacillus subtilis into a culture medium containing a moringa oleifera leaf extracting solution, fermenting for 6-12 hours, inoculating aspergillus niger, continuously fermenting for 36-48 hours, sterilizing, centrifuging, and taking supernate to obtain moringa oleifera leaf fermentation liquor; and step B, scaling the fish skin, cleaning, drying and crushing, adding the moringa oleifera leaf fermentation liquor, reacting for 6-10 hours at the pH value of 6.0-7.0 and the temperature of 35-45 DEG C, and performing ultrafiltration, filtrate concentration and freeze-drying to obtain the collagen peptide. The preparation process has the advantages of low cost, greenness and high efficiency, and the prepared collagen peptide shows the activity of inhibiting tyrosinase and can be applied to preparation of skin care products or medicines with a whitening function.

The application provides a kind of complex hydrolytic enzyme and its preparation method, it is related to enzyme engineering technical field.The preparation method includes: aspergillus niger is inoculated in culture medium to carry out fermentation, and the fermentation liquor containing beta-glucosidase is collected;The fermentation liquor is subjected to solid-liquid separation to obtain beta-glucosidase preparation;Add alpha-L-arabinofuranosidase and cellobiohydrolase to obtain the complex hydrolytic enzyme.This technology uses specific content of sodium carboxymethyl cellulose and wheat bran to synergistically ferment, the activity and specificity of the main enzyme beta-glucosidase are greatly improved by nutritional induction and conformation simulation;Subsequently, alpha-L-arabinofuranosidase and cellobiohydrolase are compounded, the single enzyme limitation is broken and the feedback inhibition is removed, and the overall catalytic efficiency and conversion rate are significantly improved.

The application discloses an aspergillus niger detection kit based on SERS and a preparation and detection method thereof. The kit comprises a SERS nanolabel, and the structure of the SERS nanolabel is that a bionic gold nanoflower is used as a gold core, and a Raman active dye and aspergillus niger specific aptamer are modified on the surface of the gold core. The kit has high sensitivity, specificity, reproducibility, uniformity and stability, can collect Raman spectrum through a portable Raman spectrum equipment, can be used for analyzing trace aspergillus niger in a sample, and the detection limit is lower than 10 CFU / mL. Compared with a traditional bacterial culture method, the kit has advantages in operation simplicity, detection period and analysis cost. The kit is suitable for food safety monitoring.

The present application relates to the field of biotechnology, and provides a strain capable of accelerating and promoting seed germination of old crow petal and application thereof, the strain is isolated from soil of old crow petal seedling, and is identified as Aspergillus niger through ITS sequence sequencing after purification, and the taxonomic name is Aspergillus niger, and the preservation number is CCTCC NO: M 2025709. Through the concomitant germination test of the strain and old crow petal plant seeds, the results show that the strain can obviously accelerate the seed germination of old crow petal, and improve the seed germination rate.

This invention discloses an anti-hair loss hair root mask, its preparation method, and its application, relating to the field of cosmetic technology. The anti-hair loss hair root mask comprises the following components by weight percentage: 4.0%~9.0% anti-hair loss composition; the anti-hair loss composition comprises the following raw materials: plant extracts, enzyme activators, and a reconstitution system; the enzyme activator is selected from at least one of the following: β-glucosidase derived from Aspergillus niger, β-glucosidase derived from almonds, cellulase complex enzyme, malt extract, and citrus fruit fermentation broth; the plant extract includes Platycladus orientalis leaf extract. The anti-hair loss hair root mask, its preparation method, and its application of this invention achieve a significant increase in raw material utilization and anti-hair loss efficacy through targeted enzymatic release of active ingredients; the innovative product form ensures stable enzyme activity and precise efficacy; it also has scalp oil control and soothing effects and is easily mass-produced industrially.

This invention belongs to the field of plant active ingredient extraction technology, specifically relating to a process for efficiently extracting anthocyanins from black goji berries. The process includes the following steps: Step 1: Preparing black goji berry powder; Step 2: Adding buffer solution to the black goji berry powder to obtain a black goji berry suspension; adding a complex enzyme to the black goji berry suspension for enzymatic hydrolysis, enzyme inactivation, and cooling to obtain an enzymatic hydrolysate; Step 3: Adding Aspergillus niger to the enzymatic hydrolysate for fermentation, sterilization, and obtaining a primary fermentation broth; continuing to add a complex microbial culture for anaerobic fermentation, sterilization, and cooling to obtain a final fermentation broth; Step 4: Performing alcohol extraction on the final fermentation broth to remove ethanol, obtaining a concentrated crude extract; Step 5: Purifying the concentrated crude extract using AB-8 macroporous adsorption resin, drying, and obtaining the black goji berry extract. This invention's process can simultaneously improve the extraction rates of total alkaloids and anthocyanins from black goji berry extract.

The invention discloses a special water and fertilizer integrated organic fertilizer for rosa roxburghii tratt and a fertilization method. The feed additive is prepared from the following components in parts by mass: 3-5 parts of glucose, 3-5 parts of bacillus subtilis, 5-8 parts of aspergillus niger, 5-8 parts of lactobacillus plantarum, 10-16 parts of saccharomycetes, 1-3 parts of cellulase, 12-18 parts of papain, 20-30 parts of roxburgh rose pomace, 45-60 parts of brown algae, 45-60 parts of deep-sea fish leftovers and 80-100 parts of purified water. The preparation method comprises the following steps: crushing and mixing the raw materials, fermenting for 5-8 days, and filtering to obtain the brown water-soluble fertilizer. The special organic fertilizer avoids the problems of poor solubility and pipeline blockage of organic fertilizer products, realizes cyclic utilization of the roxburgh rose pomace, and enhances the environmental adaptability of soil; rosa roxburghii growth is promoted, and yield is increased.

The invention relates to the field of gene engineering, and discloses an Aspergillus niger, a construction method and application thereof, and a method for producing citric acid. The Aspergillus niger does not express the RNA binding protein gene ssd1 in an original strain. According to the Aspergillus niger provided by the invention, multiple technical effects of remarkably reducing the diameter of a fungus ball, greatly reducing the sporulation quantity and remarkably improving the production efficiency of citric acid under a liquid submerged fermentation condition are realized, so that the problems of low mass transfer efficiency, long fermentation period and high spore pollution risk in the prior art are effectively solved; the invention provides an efficient, environment-friendly and genetically stable novel strain solution for industrial high-yield citric acid production.

The application discloses a process for improving the quality of palm kernel meal feed by enzyme and bacteria synergistic fermentation, and belongs to the field of feed biotechnology.The process is characterized by the following steps: crushing and screening palm kernel meal, mixing the palm kernel meal with 20% bran and 4% ammonium sulfate as dry matter to obtain a basic substrate;compounding bacillus subtilis, aspergillus niger and saccharomyces cerevisiae at a ratio of 1:1:1 of viable bacterial number, adding 0.67% mannanase and 0.3% xylanase to prepare a bacteria-enzyme mixed solution, inoculating the bacteria-enzyme mixed solution at a 10% inoculation amount, adjusting the moisture content to 50% and the pH to 6.4, and then sealing and storing the bacteria-enzyme mixed solution for use after 4 days of fermentation at 33.5 DEG C; and the bacteria-enzyme mixed solution can be stored for a long time.The process can efficiently degrade crude fiber and anti-nutritional factors, improve the protein content and the digestibility, is stable and easy to mass-produce, can replace part of corn and soybean meal in the daily ration of ruminants, and realizes high-value utilization of palm kernel meal.

The application belongs to the technical field of vinegar brewing, and provides a compound koji inoculated with indigenous Aspergillus oryzae and Aspergillus niger and a method for strengthening Shanxi old mature vinegar. Indigenous Aspergillus oryzae CGMCC 42103 with high yield of acid protease and glutaminease and Aspergillus niger CGMCC 15672 with high yield of saccharifying enzyme are mixed and inoculated in bran and soybean powder medium to prepare compound koji, and the prepared compound koji is applied to the fermentation process of Shanxi old mature vinegar to prepare new vinegar, the total acid, amino acid nitrogen, non-volatile acid and glutamic acid content of the new vinegar are 6.18 g / 100 mL, 0.38 g / 100 mL, 2.45 g / 100 mL and 58.83 mg / 100 mL respectively, compared with the comparative example in which only highland millet with a mass fraction of 60% is added in the alcohol fermentation stage to carry out conventional fermentation of food vinegar, the new vinegar is improved by 20.47%, 153.33%, 33.15% and 118.86% respectively, and the content of organic acid and volatile aroma components is enriched.

The application relates to the technical field of biological medicine, in particular to a preparation method of anti-aspergillus niger siRNA and a complex preparation thereof, wherein the anti-aspergillus niger siRNA comprises siR266 for a PmrA gene and / or siR505 for a SarA gene, the sequence of a sense strand and an antisense strand of the siR266 is shown in SEQ ID NO: 3-4 respectively, and the sequence of a sense strand and an antisense strand of the siR505 is shown in SEQ ID NO: 7-8 respectively. Wherein, the complex preparation adopts protamine sulfate as a carrier, and forms a complex with the anti-aspergillus niger siRNA. The complex preparation prepared by the application can effectively inhibit aspergillus niger, and can be applied to food preservation, postharvest protection of fruits and vegetables, and mildew prevention of daily necessities and the like, and is suitable for developing corresponding anti-fungal products.

This invention discloses an anti-hair loss composition, its preparation method, and its application, relating to the field of cosmetic technology. The anti-hair loss composition comprises the following raw materials: plant extracts, enzyme activators, and a reconstitution system; the enzyme activator is selected from at least one of the following: β-glucosidase from Aspergillus niger, β-glucosidase from almonds, cellulase complex enzyme, malt extract, and citrus fruit fermentation broth; the plant extract includes Platycladus orientalis leaf extract; the reconstitution system includes a moisturizing stabilizer, a chelating agent, a buffer system, and deionized water. The anti-hair loss composition, its preparation method, and its application of this invention, through targeted enzymatic hydrolysis technology, efficiently convert inactive glycoside precursors in Platycladus orientalis leaf extract into free flavonoids with targeted anti-hair loss activity, significantly improving raw material utilization and active ingredient yield, achieving a technological breakthrough from "passively adding raw materials" to "actively generating active substances."

The invention belongs to the technical field of biochemical engineering, and relates to strain breeding of microbial fermentation, in particular to aspergillus niger capable of producing fungus alpha-amylase and application of the aspergillus niger. The Aspergillus niger is specifically Aspergillus niger LKT2025-04, the preservation number is CGMCC No.42213, the Aspergillus niger LKT2025-04 is obtained by carrying out ultraviolet-diethyl sulfate compound mutation on an original strain of the Aspergillus niger and then carrying out breeding, and the Aspergillus niger is a mutant strain capable of producing fungal alpha-amylase with high temperature resistance, acid and alkali resistance and high enzyme activity. Besides, compared with an original strain, the mutant strain has the advantages that hypha expansion is advanced by 30 hours, the fermentation period is effectively shortened, the enzyme production rate is increased, a foundation is laid for low-cost and large-scale production of fungal alpha-amylase, and the mutant strain has very wide development potential and application prospects in the industrial field of enzyme preparations.

The application discloses a preparation method of small molecule peptides based on synergistic degradation of chicken eggshell membranes by molds and the small molecule peptides, and relates to the field of small molecule peptide preparation. The method comprises the following steps: mixing pretreated chicken eggshell membranes with mold fermentation liquor, and performing synergistic degradation; inactivating and centrifuging the degraded mixture, and collecting supernatant; purifying small molecule peptides in the supernatant through membrane separation technology; drying the purified small molecule peptide solution through a low-temperature spray drying method to obtain small molecule peptide powder; and the molds include Trichoderma reesei and Aspergillus niger. Through synergistic degradation of the two molds, the conversion of the chicken eggshell membranes is more thorough, the yield of the small molecule peptides is significantly improved, the total nitrogen recovery rate can reach 85.2%, and the product molecular weight distribution is concentrated.