392 results about "Aspergillus niger" patented technology

The invention discloses an aspergillus niger recombinant bacterium AnCT-XynB-K-agdA and application thereof, and belongs to the technical field of microbiology and bioengineering. According to the invention, Aspergillus niger AnCat is taken as an expression host, firstly, an acid protease regulatory factor prtT is knocked out to obtain a defective strain, and then different chaperonins are subjected to fusion expression by optimizing integration sites of a laccase lcc9 expression cassette, so that the high-expression laccase chaperonin is obtained. According to the method, an expression vector pC3-5 'agdA-PcitA-XynB-L-lcc9-hph-3' agdA is constructed, a recombinant bacterium AnCT-XynB-K-agdA is further obtained, the enzyme activity of the extracellular laccase subjected to shake flask fermentation reaches 1821.2 U / L, and finally, the recombinant efficient expression of the laccase Lcc9 in aspergillus niger is realized.

The invention belongs to the technical field of agricultural biology, and particularly relates to a compound bacterial fertilizer with a soil structure repairing function and a preparation method thereof. The three-layer embedding structure is more beneficial to improving the survival rate of strains, the limitation of traditional single-layer embedding is broken through through the three-stage structure design of inner core slow release, middle layer regulation and control and shell adsorption, integration of salt adsorption, structure improvement and flora colonization is achieved through cooperation of multiple materials including PGA, biochar and montmorillonite, and saline-alkali soil can be well repaired and improved. Besides, compared with conventional Aspergillus niger, the Aspergillus niger GRJC004 provided by the invention is suitable for survival in a saline-alkali environment, and is especially suitable for restoration and improvement of saline-alkali soil in combination with the three-stage structural design of the Aspergillus niger GRJC004.

The application discloses an Aspergillus niger strain and a culture method and application thereof, the Aspergillus niger strain is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20241727. The fermented tea product obtained by fermenting tea leaves or tea leaf extracts by using the Aspergillus niger strain CCTCC NO: M 20241727 has prominent sweet and floral fragrance, and the astringency is obviously reduced; the contents of tea polyphenols, free amino acids and flavones are higher than those of a fermented tea product of an existing Aspergillus niger strain; the antioxidant activity is enhanced; the tea soup color is orange red and bright; and the color, fragrance and taste qualities are all superior to those of the fermented tea product of the existing Aspergillus niger strain.

The present invention belongs to the technical field of biomass resource utilization and microbial fertilizers, and specifically relates to a fertilizer based on oil-tea camellia cattail, a preparation method and its application. The fertilizer described in the present invention is prepared by a collaborative fermentation process of Aspergillus niger, Phanerochaete chrysosporium and Bacillus subtilis. The obtained fermentation product is separated into solid and liquid to obtain a solid, the solid being a solid fertilizer, and the liquid being a foliar fertilizer after post-treatment. Both can be used for the cultivation of crops such as tangerines and oil-tea camellias. Based on the microbial collaborative fermentation process, the content of anti-nutritional factors tannin and tea saponin in the obtained solid fertilizer is significantly reduced, which is less than 1.8 g / kg and 0.1% respectively on a dry basis, while maintaining a seed germination index higher than 95%. According to a planting comparative test, the average yield per mu of oil-tea camellias using the solid fertilizer and liquid fertilizer obtained in this application increased by 12%. The average yield per mu of tangerines increased by about 11%, and the sugar, vitamin C, and trace element contents in tangerines were higher than those using traditional fertilizers.

The invention discloses a culture method for increasing the protein content of aspergillus niger mycelia by using corn steep liquor as a culture medium, and belongs to the technical field of biological fermentation. Aiming at insufficient resource utilization of corn steep liquor and substitute protein production requirements, a corn processing by-product corn steep liquor is creatively adopted to directly replace a traditional PDB culture medium, and the mycelium protein content is remarkably increased by optimizing a fermentation system. Results show that the corn steep liquor is used as a culture medium, aspergillus niger with the preservation number of CCTCC M 2013703 is inoculated, and aspergillus niger mycelium protein can be obtained through fermentation. The protein content of the mycelium obtained by the process disclosed by the invention reaches 50.62-53.56%, and the total amino acid content is increased by 64-76%. According to the method, high-value conversion of agricultural corn byproducts is realized, and an efficient and low-cost industrial solution is provided for alternative protein production.

The embodiment of the invention discloses a Yarrowia guilliermondii as well as a separation and screening method, an identification method and application of the Yarrowia guilliermondii. The preservation number of the Yarrowia guilliermondii is CGMCC (China General Microbiological Culture Collection Center) No.27603, and the preservation number of the Yarrowia guilliermondii is CGMCC No.27603. The Yarrowia guilliermondii disclosed by the embodiment of the invention has a very good prevention and control effect on postharvest diseases of fruits, and the prevention and control effect of the Yarrowia guilliermondii on the diseases can be enhanced by respectively adding auxiliary factors, namely calcium chloride, alginate oligosaccharide (AOS), phytic acid (PA) and metschhia yeast. Through identification, the antagonistic bacterium is a Yeyrozyma guilliermondii, and the antagonistic bacterium is a Yeyrozyma guilliermondii. The M.guilliermonii has a good control effect on gray mold, penicilliosis, black spot and aspergillus niger of strawberry, apple, pear and tomato fruits, can be rapidly colonized on fruit wounds, and can enhance the resistance-related enzyme activity of the fruits, occupy the wound space and induce the fruit resistance to reduce the morbidity of diseases.

The invention discloses a traditional Chinese medicine residue organic compound fertilizer special for acid-base imbalance barren soil and a production method, and relates to the technical field of soil improvement and fertilizer.The organic compound fertilizer is prepared from, by volume, 50-70 parts of fermented traditional Chinese medicine residue matrix, 15-30 parts of mineral nutrient unit, 5-15 parts of biological activity enhancer and 3-10 parts of structure conditioner; wherein the fermented traditional Chinese medicine residue matrix is prepared by taking traditional Chinese medicine pharmacy mixed residues as raw materials and performing solid-state fermentation through a complex microbial inoculant containing aspergillus niger and the like; the mineral nutrient unit is compounded by urea and the like; the biological activity enhancer contains humic acid and the like; the structure conditioner is a mixture of attapulgite and sodium carboxymethyl cellulose (5: 1-8: 1). According to the organic compound fertilizer, the fermented traditional Chinese medicine residues with the organic matter content larger than or equal to 45% serve as a matrix, the mineral nutrient unit, the biological activity enhancer and the structural conditioner which are coated in a slow-release mode are matched, a synergistic system is formed, three-stage fermentation is adopted, the microbial activity is kept, and the pH lt can be improved; 6.0 or gt; 8.5 of sand / clayey barren soil.

The invention discloses a fermentation process of citric acid residues, and relates to the technical field of organic acid fermentation. The fermentation process comprises the following steps: mixing and crushing citric acid residues and wheat bran according to a mass ratio of (4-5): 1 to obtain a mixed material; spraying an ammonia water solution, a magnesium sulfate solution and a zinc sulfate solution into the mixed material, adjusting the pH value to 5.0-5.5, sterilizing, adding a urea solution and a basic nutrient solution, and uniformly mixing to obtain slurry; aspergillus niger and saccharomycopsis fibuligera are mixed according to the spore number ratio of 100: 1, then sterile water is added, the mixture is stirred to be uniform, and bacterial liquid with the spore concentration of 1 * 10 < 7 >-5 * 10 < 7 > / mL is obtained; spraying the bacterial liquid to the surface of the slurry, performing aerobic culture for 40-48 hours under the conditions that the temperature is 30-35 DEG C and the humidity is 80-85%, then cooling to 25-30 DEG C, reducing the humidity to 70-75%, spraying methanol at the same time, and performing sealed culture for 5-6 days; performing drying; and the acid yield and the nutrient substance yield in the finally obtained fermentation product are obviously improved.

The invention belongs to the technical field of cosmetic raw materials, and particularly relates to shea butter fermentation liquor as well as a preparation method and application thereof. Lactobacillus plantarum, lactobacillus fermentum and lactobacillus gasseri in a specific proportion are adopted to construct a composite fermentation system, acid-resistant aspergillus niger lipase is combined, and shea butter is treated through a one-step fermentation process. By means of the synergistic effect of the three strains and the synergistic effect of the enzyme and the strains, efficient fermentation can be achieved, the content of active ingredients such as polysaccharide, amino acid and polypeptide in fermentation liquor is remarkably increased, meanwhile, the technological process is simple and stable, and the infectious microbe pollution risk is avoided. According to the fermentation liquor prepared by the process, on the basis of enhancing the original moisturizing and soothing effects of the shea butter, the problems of greasy skin feeling and poor permeation and absorption of the shea butter are effectively solved, the shea butter is further endowed with new functions of repairing skin barriers and balancing skin micro-ecology, and the application values of the shea butter and the fermentation liquor are greatly improved.

The application provides a recombinant Aspergillus niger with high trans-aconitic acid yield and a construction method and application thereof, and relates to the technical field of genetic engineering. Specifically, the recombinant Aspergillus niger heterogeneously expresses aconitate isomerase TbrA and / or Adi1. The application provides a new engineering strain for efficient production of trans-aconitic acid, solves the source predicament of needing plant extraction or needing chemical synthesis in traditional production of trans-aconitic acid, and greatly improves the yield of trans-aconitic acid.

The invention provides a cattle fermentation bed composite padding based on bacterium-enzyme synergistic effect and a preparation method thereof, and relates to the technical field of livestock and poultry breeding, the cattle fermentation bed composite padding comprises a rice hull layer located at the top, a slow release layer located in the middle and a fermentation layer located at the bottom, the rice hull layer comprises hydrophobic modified rice hulls, the slow release layer comprises PLA melt-blown cloth, and the fermentation layer comprises PLA melt-blown cloth. The PLA melt-blown cloth is compounded with microspheres through hot pressing, and the fermentation layer comprises the following components in parts by mass: 0.5-2 parts of aspergillus niger spores, 8-15 parts of bran and 90-110 parts of bagasse. The method has the beneficial effects that turning-free, self-oxygen-adjusting and long-acting fermentation can be realized, and efficient fermentation and long-term stable operation are realized by adopting a three-layer sandwich structure and combining hydrophobic modification, gas slow release and bacterium-enzyme synergistic degradation technologies.

The invention discloses a method for preparing live pig feed through mixed solid-state fermentation of feed rape and rapeseed meal. The method specifically comprises the following steps: harvesting feed rape from a full-bloom stage to a final bloom stage, adding rapeseed dregs, and uniformly mixing to obtain a fermentation substrate with the water content of 55-65%; spraying the compound enzyme bacterium preparation on the fermentation substrate, uniformly stirring, finally compacting by using a packer, sealing, packing and storing, and fermenting for 45 days; the compound enzyme bacterial preparation comprises a bacterial agent and an enzyme agent; the fungicide comprises lactobacillus plantarum, bacillus subtilis, saccharomyces cerevisiae and aspergillus niger; the enzyme agent is prepared from phytase, cellulase, hemicellulase, pectinase, tannase, xylanase and alpha-galactosidase. The feed rape and the rapeseed meal are subjected to mixed solid fermentation, so that the content of phytic acid, glucosinolate and crude fiber is greatly reduced, the content of crude protein is increased, and the nutritional quality of the feed is remarkably improved. The fermented feed is used for replacing part of corn, soybean meal and wheat bran, and the use amount of concentrated feed in live pig breeding is reduced.

The invention discloses a method for increasing the content of total saponins in polygonatum kingianum through solid-state fermentation of aspergillus niger. According to the method, the polygonatum kingianum is subjected to solid-state fermentation by utilizing the aspergillus niger, the content of total saponins in the polygonatum kingianum after solid-state fermentation is 2-3 times that of the total saponins in unfermented polygonatum kingianum, and high-quality raw materials and technical supports are provided for increasing the additional value of polygonatum kingianum resources and developing functional products. According to the method disclosed by the invention, the polygonatum kingianum original product is fermented, so that the content of active ingredients of polygonatum kingianum is comprehensively increased, redundant wastes are not generated, the waste of resources is not caused, and an idea is broadened for developing high-added-value healthy foods and other medicinal products.

The invention discloses a microbial soil conditioner and a preparation method thereof, and relates to the technical field of soil improvement. The method comprises the following steps: culturing heavy metal-resistant chlorella and aspergillus niger to obtain a mixed bacterial suspension, combining the mixed bacterial suspension with a composite chelating modifier prepared by reacting chitosan quaternary ammonium salt, ethylenediamine tetraacetic acid and epichlorohydrin, carrying out crosslinking by using genipin to obtain a functional microbial agent, and carrying out pyrolysis and acid oxidation on corn straws as a raw material to obtain the heavy metal-resistant chlorella modified functional microbial agent. The preparation method comprises the following steps: preparing a nano zero-valent iron-biochar composite material, reducing and loading ferrous ions through sodium borohydride, preparing the nano zero-valent iron-biochar composite material, mixing the nano zero-valent iron-biochar composite material with zeolite, bentonite and a silane coupling agent, carrying out spray drying to prepare a porous carrier substance, and finally stirring and mixing an organic fertilizer complex microbial inoculant, the functional microbial inoculant and the carrier substance, and aging to prepare the soil conditioner. The prepared conditioner has a good remediation effect on soil heavy metal pollution.

The invention discloses a synthetic microbial agent for treating uranium-contaminated soil and a preparation method of the synthetic microbial agent. The synthetic microbial agent is prepared from the following bacteria: P.adami, P.megatherium, bacillus subtilis, Artobacter volluticus, symbiotic fungi, Aspergillus niger, sulfate reducing bacteria and Shewanella. The symbiotic fungi are mucor lastein, mucor unimingguminum, mucor circinelloides, mucor dense, rhizopus arrhizus and phylum phthochytrium parasitic fungi. The prepared synthetic microbial agent and synthetic microbial embedded balls are applied to uranium-contaminated soil remediation, the key enzyme activity can be effectively improved, the soil metabolism function is enhanced, meanwhile, exchangeable uranium with high ecological risk is converted into stable and low-harm residual uranium, the mobility and bioavailability of uranium in soil are effectively weakened, and the uranium-contaminated soil remediation effect is improved. Therefore, immobilized remediation of uranium is realized, and a good soil uranium fixing effect is achieved.

The invention relates to the technical field of agricultural microorganisms, and provides a microbial agent for promoting growth of fruits and vegetables, the microbial agent is mainly prepared from a compound bacteria liquid, the total viable count of the compound bacteria liquid is greater than or equal to 1 * 10 < 10 > CFU / g, and the compound bacteria liquid comprises the following components in percentage by viable bacteria: 35-40% of aspergillus terreus, 10-20% of aspergillus niger, 5-10% of aspergillus niger, 5-10% of aspergillus niger, and the balance of water. 10 to 20% of bacillus subtilis; 15 to 20% of streptomyces sp. 10-12% of saccharomyces cerevisiae; and 18 to 25% of pseudomonas chlororaphis. The invention overcomes the defects of the prior art, is reasonable in design and relatively comprehensive in function, and also solves the technical problems that the function of the existing single microbial agent is limited and the activity of the complex microbial agent is relatively low under a high-temperature condition.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

The invention discloses a micropterus salmoides intestinal function feed additive based on composite synergy and application thereof, and belongs to the technical field of feed additives. The feed additive for improving the intestinal function of the largemouth bass comprises the following raw materials: clostridium butyricum, tributyrin, aspergillus niger and a plant source carrier. The invention provides a compound feed additive capable of remarkably improving the growth performance of the largemouth bass, improving the digestive enzyme activity of the intestinal tract and optimizing the intestinal barrier, and the compound feed additive can remarkably improve the weight gain rate and the specific growth rate of the largemouth bass, remarkably improve the digestive enzyme activity of the intestinal tract of the largemouth bass and maintain the integrity of the tissue structure of the intestinal tract. Compared with a single additive, the compound additive shows a better synergistic gain effect in the aspect of comprehensive effects, has important value for promoting research, development and practical application of novel feed additives of micropterus salmoides, has good popularization and application prospects, and is expected to bring remarkable economic benefits to the breeding industry.

The invention discloses a modified chitosan-based antibacterial material as well as a preparation method and application thereof, and belongs to the technical field of antibacterial materials. The ciprofloxacin grafted quaternized chitosan is successfully synthesized by taking the chitosan as a raw material, and the water solubility and the antibacterial ability of the chitosan are effectively improved. The antibacterial diameters of the ciprofloxacin grafted quaternized chitosan prepared by the preparation method disclosed by the invention on escherichia coli and staphylococcus aureus are respectively 35.34 to 39.06 mm and 40.45 to 44.51 mm, and the minimum MIC (Minimum Inhibitory Concentration) and MBC (Minimum Mass Chitosan) can reach 0.0005 mg / mL. In addition, the antibacterial material has an obvious inhibition effect on colletotrichum gloeosporioides and aspergillus niger, and the highest antifungal rates respectively reach 53.81 + / -2.17% and 54.88 + / -1.3%. Compared with the raw materials, the antibacterial ability is greatly improved, and the grafted and modified composite material is environment-friendly and can be used for antibacterial food packaging materials.

The invention provides a phosphorus release improving type compound fertilizer based on a fungal extracellular polymer, a preparation method and application, and belongs to the technical field of microorganisms, the phosphorus release improving type compound fertilizer is prepared by compounding the extracellular polymer generated by specific rhodotorula mucilaginosa WTSX01 and inorganic phosphate according to the mass ratio of 1: 9; the preparation method comprises the following steps: extracting and purifying high-activity EPS from a strain fermentation broth by a low-temperature dialysis method, separating lipid from EPS as a natural adhesive by a cosolvent extraction method, and finally mixing EPS, lipid and inorganic phosphate. The invention also discloses a synergistic application of the fertilizer and a phosphorus-solubilizing fungus aspergillus niger (CCTCC No. M2023240), so that the release efficiency of phosphorus in soil is improved; the fertilizer provided by the invention provides exclusive nutrition for phosphate-solubilizing microorganisms, effectively overcomes indigenous microorganism competition, remarkably promotes microorganism growth and phosphorus release, and realizes reduction and synergism of phosphate fertilizer and yield increase of crops.

The present application belongs to the technical field of composite Fu tea, and particularly relates to a forsythia suspense leaf tea, walnut branch wood composite Fu tea and a preparation method thereof. The forsythia suspense leaf tea, walnut branch wood composite Fu tea is prepared by adding composite strains to forsythia suspense leaf tea, black tea and branch wood silk after steam softening, and then performing two-stage fermentation and finally microwave treatment. The mass ratio of the forsythia suspense leaf tea, black tea, branch wood silk and composite strains is 40-70:20-50:10-30:0.5-1. The composite strains are prepared by mixing Eurotium cristatum liquid, Lactobacillus plantarum liquid and Aspergillus niger liquid at a mass ratio of 5-7:2-4:1. The two-stage fermentation is primary fermentation at 32-35 DEG C for 10-14 hours, and then secondary fermentation at 24-28.5 DEG C for 19-21 days. The forsythia suspense leaf tea, walnut branch wood composite Fu tea has a golden flower density of greater than 2.0*10 5 CFU / g dry tea, high forsythiaside retention rate, weak bitterness, strong aroma and good taste.

The application discloses a kind of fermentation complex microbial inoculant and preparation method and application thereof, the fermentation complex microbial inoculant includes the following weight parts of component: bacillus subtilis microbial inoculant 2-5 parts, bacillus mucilaginosus microbial inoculant 5-10 parts, yeast microbial inoculant 2-10 parts, trichoderma harzianum microbial inoculant 10-20 parts, aspergillus niger microbial inoculant 10-20 parts and streptococcus thermophilus microbial inoculant 2-5 parts;The fermentation complex microbial inoculant of the application is prepared by selecting each strain and amount, is added to pigeon manure and is fermented to prepare organic fertilizer, can better decompose macromolecular substance, significantly improve the organic matter and total nitrogen content in preparation organic fertilizer, and can better improve seed germination rate;In addition, the preparation method of pigeon manure organic fertilizer of the application is simple in process, easy to operate, and convenient for production.

The present application relates to the technical field of feed processing, and particularly relates to a preparation method of Maotai-flavor distiller's grains fermented feed, which comprises the following steps: drying treatment based on the moisture content of Maotai-flavor distiller's grains to obtain basic distiller's grains; determining the strain ratio of brewer's yeast, bacillus subtilis and aspergillus niger based on the tannin content of the basic distiller's grains to obtain a compound fermentation inoculant; inoculating and then fermenting; determining state evaluation parameters based on the total polyphenol accumulation rate, the dissolved oxygen consumption rate and the microbial activity index during the fermentation process, and performing qualified evaluation, and dynamically adjusting when unqualified; determining the fermentation end point based on the tannin degradation rate and the total polyphenol accumulation rate; and mixing the fermented distiller's grains with the basic feed at a mass ratio of 1% after low-temperature drying of the fermented distiller's grains. The present application realizes three-layer control of raw material evaluation, process control and end point determination, significantly improves the stability and content of functional active ingredients in the product, reduces the tannin and safety risk, and has a good intestinal health improvement effect on animals.

The invention discloses an Aspergillus niger detection kit based on SERS (Surface Enhanced Raman Scattering) and a preparation and detection method thereof, the kit comprises an SERS nano-label, the structure of the SERS nano-label takes bionic gold nanoflower as a gold core, and the surface of the gold core is modified with a Raman reactive dye and an Aspergillus niger specific aptamer. The kit has high sensitivity, specificity, reproducibility, uniformity and stability, Raman spectrum can be collected through portable Raman spectrum equipment, the kit can be used for analysis of trace Aspergillus niger in a sample, and the detection limit is lower than 10 CFU / mL. Compared with a traditional bacterial culture method, the method has the advantages in the aspects of simplicity and convenience in operation, detection period, analysis cost and the like. The method is suitable for food safety monitoring.

The invention provides a method for preparing high-activity chitosan oligosaccharide based on a microbial fermentation method. The method comprises the following steps: cooling a fermentation culture medium containing chitin powder, inoculating an aspergillus niger seed solution under stirring and ventilation, and fermenting for 24 hours; stopping stirring for 30 seconds, adding a soybean protein isolate solution, reducing the rotating speed to 180 rpm, and fermenting for 12 hours; continuously reducing the rotating speed to 150 rpm, adding a soybean protein isolate solution, and fermenting for 12-14 hours; and centrifuging the fermentation liquor, taking supernate, filtering, adding a xanthan gum solution, stirring, concentrating, drying in vacuum, and crushing, thereby obtaining the product. According to the method disclosed by the invention, the industrial pain points that oligosaccharide is easy to degrade and active sites are easy to oxidize in traditional fermentation are solved by virtue of segmented dynamic electrostatic combination and deep synergy of aspergillus niger directional fermentation enzyme production and soybean protein isolate, and the preparation of the high-activity chitosan oligosaccharide is realized.

The application relates to the field of genetic engineering, and discloses an Aspergillus niger, a construction method and application of the Aspergillus niger, and a method for producing citric acid and / or succinic acid. Aspergillus niger The Aspergillus niger is obtained by simultaneously overexpressing alpha-amylase and aspartic protease in a starting strain. The Aspergillus niger provided by the application can realize efficient degradation and conversion of starch by synergistically overexpressing amyA genes and pepA genes, solve the technical bottleneck that the original strain is limited in growth in a starch-based fermentation system and has insufficient acid production capacity, can efficiently produce succinic acid and citric acid by taking low-cost starch as the only carbon source, significantly reduce the industrial production cost of organic acid, and promote the green and sustainable upgrading of the fermentation industry.

Provided are an Aspergillus niger, a microbial agent thereof, a solid-state fermentation broth thereof, a preparation method therefor, and a use thereof. The Aspergillus niger is Aspergillus niger AGM01, which is preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO: M2024768. The Aspergillus niger has a relatively high enzyme activity of β-glucosidase. By performing fermentation and cultivation on the Aspergillus niger in a solid-state fermentation medium containing a small-molecule inducer so as to obtain a solid-state fermentation broth of the Aspergillus niger, the enzyme activity of β-glucosidase in the solid-state fermentation broth of the Aspergillus niger is improved.

The invention discloses a method for improving antioxidant activity of oil cakes through multi-strain fermentation combined with enzymolysis and application. The method comprises the following steps: adding a multi-strain mixed bacterium suspension into sterilized oil cakes, uniformly mixing, performing constant-temperature fermentation at 30 + / -2 DEG C, performing intermittent stirring in the fermentation process, and sequentially performing high-temperature sterilization and freeze-drying treatment after the fermentation is finished, the multi-strain mixed bacterium suspension is a mixed bacterium suspension of aspergillus niger, saccharomyces cerevisiae and bacillus subtilis, and the viable count ratio of the aspergillus niger to the saccharomyces cerevisiae to the bacillus subtilis in the multi-strain mixed bacterium suspension is (1-2): (1-2): (1-2). The application finds that a multi-strain composite fermentation combined enzymolysis technology can realize the synergistic interaction of fermentation and enzymolysis, obviously improves the antioxidant activity of the oil cake meal, and can be applied to preparation of cake meal feed.

The invention relates to the technical field of biological waste treatment, in particular to a preparation method and application of a silkworm sand feed additive. The invention provides a technical scheme for preparing a silkworm and mulberry sand feed additive rich in acid protease, pectinase and cellulase by taking silkworm sand as a core matrix and performing directional pretreatment, adaptive strain fermentation and standardized post-treatment. According to the invention, silkworm sand-corncob powder is used as a composite substrate, and the silkworm sand and the corncob powder complement each other in function, so that the problems of unbalanced nutrition and poor air permeability of a single substrate are solved. Specific aspergillus niger is used for segmented solid-state fermentation, parameters are set in a differentiated mode, and full-amount utilization of the silkworm sand is achieved; the product quality and enzyme activity are improved by optimizing the process, and the resource value is improved from the low-added-value field to the high-added-value enzyme preparation industry.

The invention belongs to the technical field of biological medicine manufacturing, and particularly relates to preparation and application of collagen peptide with whitening activity. The preparation method of the collagen peptide with the whitening activity comprises the following steps: step A, inoculating bacillus subtilis into a culture medium containing a moringa oleifera leaf extracting solution, fermenting for 6-12 hours, inoculating aspergillus niger, continuously fermenting for 36-48 hours, sterilizing, centrifuging, and taking supernate to obtain moringa oleifera leaf fermentation liquor; and step B, scaling the fish skin, cleaning, drying and crushing, adding the moringa oleifera leaf fermentation liquor, reacting for 6-10 hours at the pH value of 6.0-7.0 and the temperature of 35-45 DEG C, and performing ultrafiltration, filtrate concentration and freeze-drying to obtain the collagen peptide. The preparation process has the advantages of low cost, greenness and high efficiency, and the prepared collagen peptide shows the activity of inhibiting tyrosinase and can be applied to preparation of skin care products or medicines with a whitening function.