94 results about "Sclerotium" patented technology

The invention provides a preparation method and application of a bacterium-enzyme-magnetic nano-cluster composite detoxicating agent, the detoxicating agent takes a Fe3O4-HAP nano-cluster as a magnetic core, the surface of the detoxicating agent is subjected to functional modification, a composite flora composed of bacillus amyloliquefaciens, lactobacillus plantarum and saccharomyces cerevisiae is loaded to form sclerotia, a chitosan shell layer is constructed on the outermost layer, and the bacterium-enzyme-magnetic nano-cluster composite detoxicating agent is prepared. And a compound enzyme consisting of aflatoxin Bdegrading enzyme, zearalenone hydrolase and deoxynivalenol invertase is immobilized. The carrier can efficiently and synchronously degrade aflatoxin, vomitoxin and zearalenone, and can realize rapid separation and recovery through an external magnetic field.

The invention relates to the technical field of pest prevention and control, in particular to a method for treating pine wood nematode infected wood through poria cocos. The method comprises the following steps: cutting down current-year epidemic wood, and treating tree heads, tree trunks and boughs to complete peeling and tendon retaining treatment; uniformly cutting the trunk and the boughs into standard cut-logs; the method comprises the following steps: selecting fresh poria cocos sclerotium skin tissues as strains, and cutting according to an area greater than 50% of a cross section; pit pits are dug in the sunny slope; laying small branches on the bottom layer, placing the cut-logs in the pits, fixing the cut-logs with non-woven fabrics after inoculation, covering the upper layer with thin branches and leaves, and covering with soil; the two-stage biological process of mycelium planting, propagation expanding and pine wood nematode and medium insect killing is sequentially completed through a soil heat and moisture preservation environment; the propagation path of pine wood nematodes is blocked through the natural isolation effect of soil, deadwood obtained after poria cocos is subjected to biological verification and then smashed on site to return to forests or be made into fuel particles, and harmless and resource recycling of epidemic wood is achieved. According to the method, the problems of pine wood nematode propagation and epidemic wood treatment are synchronously solved.

The invention provides a core-shell microsphere for feed detoxification and a preparation method and application thereof.The core-shell microsphere comprises a sclerotium layer, a magnetic shell layer and a catalytic layer from inside to outside, and the sclerotium layer is composed of bacillus licheniformis and lactobacillus rhamnosus composite flora and a chitosan-sodium tripolyphosphate semipermeable membrane wrapping thalli; the magnetic shell layer is a Fe3O4 nano-particle coating, and the catalytic layer is a porous Mn-Ce-O shell. The microspheres have the double functions of biodegradation and chemical catalysis, the internal flora can degrade various toxins, the external catalytic layer efficiently decomposes stubborn toxins, the magnetic layer realizes rapid magnetic separation and recovery, and the microspheres are suitable for removing mycotoxins from feed raw materials such as corn and soybean meal.

Disclosed is a method of reducing fine lines or wrinkles on skin. The method can include applying a topical skin care composition to skin with fine lines or wrinkles. The composition can include lactobacillus ferment, ascorbyl glucoside, Terminalia ferdinandiana fruit extract, Helianthus annuus (Sunflower) seed extract, glycerin, Persea gratissima (avocado) oil, Butyrospermum parkii (shea) butter, coco-caprylate / caprate, Sclerotium gum, sodium benzoate, and tocopherol.

The invention discloses application of m-cresol to prevention and treatment of pepper southern blight, and belongs to the field of plant disease prevention and treatment. According to the invention, it is found for the first time that m-cresol has an inhibition effect on sclerotium rolfsii, wherein EC50 of m-cresol is 0.1560 [mu] L / mL; the m-cresol with the concentration of 2 * EC50 can completely inhibit sclerotium germination, sclerotium generation and hypha growth of the sclerotium rolfsii. Furthermore, m-cresol can be used for preventing and treating pepper southern blight caused by sclerotium rolfsii, the morbidity and disease index of pepper southern blight can be effectively reduced by using a m-cresol solution with the concentration of 0.125% to perform root irrigation treatment on pepper planted in pathogenic bacteria soil, the relative prevention and treatment effect reaches 100%, and adverse reaction of pepper plants cannot be caused. The invention provides a new method for controlling the pepper southern blight by using a medicament, and the method has the advantages of high efficiency, low cost, low environmental harm and the like.

The invention discloses a strain of Lysinibacillus bacilli B1 and application thereof, and belongs to the technical field of microorganisms. The preservation number of the bacstein lysine bacillus B1 is GDMCC No: 66653, and the preservation number of the bacstein lysine bacillus B1 is GDMCC No: 66653. The bacstein lysine bacillus has an inhibition effect on penicillium expansum, aspergillus ochraceus, botrytis cinerea, escherichia coli, listeria monocytogenes, sclerotium rolfsii, root rot bacteria, ralstonia solanacearum and fusarium oxysporum. The strain can be used for preventing and treating southern blight and root rot of siraitia grosvenorii, banana fusarium wilt, mycosis of navel oranges and the like; the bacterial fertilizer can be applied to the fields of fruit preservation and bacterial fertilizer biocontrol of the plants; meanwhile, the strain can also be applied to the field of food preservation, is a bacterial strain with multiple functions and wide application fields, and has a good application prospect.

The invention discloses paenibacillus FHY1 and application thereof, and belongs to the field of microorganisms. A strain of paenibacillus FHY1 is screened from Xinjiang populus euphratica juice, and experimental verification shows that a liquid culture of the paenibacillus FHY1 strain provided by the invention has a remarkable inhibition effect on magnaporthe oryzae, the bacteriostasis rate can reach 84%, and the inhibition rate on magnaporthe oryzae spore germination is 92%. And the rice growth can be promoted under the conditions of 150mM NaCl and 250mM NaCl. Meanwhile, the strain also has a good inhibition effect on pyricularia grisea, fusarium oxysporum, fusarium graminearum, sclerotinia sclerotiorum and colletotrichum gloeosporioides. Therefore, the invention provides a new strain with a good control effect on pathogenic fungi, and meanwhile, the growth and development of rice are remarkably promoted in a salt stress environment.

The application belongs to the field of agricultural fungicide compound, discloses a composition containing new white folium altheae alkaloid derivative Z-24 and anthraquinone components (emodin, emodin methyl ether, chrysophanol, aloe emodin) in rhubarb and mixed concentration thereof. The application of the composition in preventing and treating plant diseases caused by rhizoctonia solani, sclerotinia sclerotiorum, fusarium graminearum, botrytis cinerea, pyricularia oryzae and phytophthora capsici is disclosed, and the mass percentage of new white folium altheae alkaloid derivative Z-24 and anthraquinone components is 1:500, 1:100, 1:50 or 1:25. The fungicidal composition disclosed in the application has the advantages of wide fungicidal spectrum, low toxicity, effective delay of drug resistance of plant pathogens and the like, and has the value of further research and development.

The invention discloses a natural plant soothing and moisturizing composition and a preparation method thereof, and belongs to the technical field of cosmetics. Comprising the following steps: mixing a dendrobium stem extract, an aloe barbadensis leaf extract, a radix sophorae flavescentis root extract, an Ningxia wolfberry fruit extract, an echinacea purpurea extract, a skin conditioner, a humectant, a hydrolyzed pansy extract, hydrolyzed sclerotium gum and deionized water, and uniformly stirring to obtain the natural plant soothing and moisturizing composition. Through a multi-dimensional synergistic mechanism, the effects of efficient soothing and moisturizing, safety, mildness, excellent skin feeling, stability and reliability are achieved.

This invention discloses an auricular acupressure pellet for treating epileptic seizures, as well as its preparation and usage methods. The auricular acupressure pellet is composed of the following ingredients in the indicated weight percentages: Gastrodia elata 25-35 parts, Fritillaria cirrhosa 25-35 parts, Pinellia ternata 25-35 parts, Poria cocos 25-35 parts, Poria cocos sclerotium 25-35 parts, Bambusa textilis 10-20 parts, Acorus tatarinowii 10-20 parts, Buthus martensii 3-9 parts, Bombyx mori 3-9 parts, Amber 10-20 parts, Uncaria rhynchophylla 10-20 parts, Citrus reticulata 5-12 parts, Polygala tenuifolia 10-15 parts, Salvia miltiorrhiza 25-35 parts, Ophiopogon japonicus 25-35 parts, Margarita 25-35 parts, and Dragon bone 25-35 parts. This invention solves the problems of limited efficacy and inconvenience in use of existing technologies, providing a highly efficient and safe new option for the treatment of epileptic seizures.

This invention belongs to the field of microbial fermentation technology and discloses a method and application for improving the production of staminodesmotic acid (Sclerotium sclerotiorum) based on dynamic osmotic pressure regulation. The method uses *Sclerotium sclerotiorum* as the production strain and employs a synergistic strategy of initial culture medium component optimization, precise osmotic pressure regulation during fermentation, and dynamic feeding to enhance synthesis. Utilizing the dual characteristics of sucrose as a carbon source and osmotic pressure regulator, and the osmotic pressure regulating effect of KCl, the osmotic pressure during fermentation is precisely controlled between 1050-1300 mOsmol / kg. This activates the MAPK-CWI signaling pathway and FKs2 gene expression, directionally promoting staminodesmotic acid synthesis and increasing staminodesmotic acid yield. This invention, by optimizing the initial carbon source and inorganic salt concentration, precisely regulating osmotic pressure during fermentation through feeding, and combining molecular mechanism analysis, achieves a significant increase in staminodesmotic acid yield, reduces industrial production costs, and provides technical support for the large-scale industrial production of staminodesmotic acid.

The invention discloses a quinolinic acid diaryl ether derivative, a preparation method and application thereof and a bacteriostatic agent or bactericide, relates to the technical field of medicinal chemistry, solves the problems that existing pesticides are high in toxicity and not environmentally friendly, easily cause drug resistance of pathogenic bacteria and possibly have negative effects on the environment and an ecological system, can efficiently prevent and treat fungal diseases of plants, and also can effectively prevent and treat the pathogenic bacteria of the plants. The quinolinic acid diarylether derivative has the advantages that the quinolinic acid diarylether derivative has excellent inhibition activity on agricultural fungi such as rhizoctonia solani, sclerotinia sclerotiorum, botrytis cinerea, fusarium graminearum and fusarium pseudograminearum, and the quinolinic acid diarylether derivative has the characteristics of simple synthesis process, cheap and easily available raw materials, good control effect, wide bactericidal spectrum and the like.

This invention discloses a specific DNA fragment, primers, and applications for sex identification of the longfin sclerotium. PCR amplification and agarose gel electrophoresis were performed using PCR primers. The results showed that individuals with a specific 271bp band were male, while those without a band were female. This invention discloses a molecular marker, primers, and identification method for sexing the longfin sclerotium. Sexing can be determined by taking fin rays without killing the fish; it can also identify the sex of juvenile fish whose sex cannot be determined by appearance. It has advantages such as accuracy, simplicity, speed, and minimal harm to the fish, providing important assistance for the conservation of wild longfin sclerotium resources and the development of the aquaculture industry.

The invention belongs to the technical field of traditional Chinese medicines, and discloses a traditional Chinese medicine composition and a traditional Chinese medicine decoction for treating insomnia, which have obvious curative effects and low toxic and side effects and have obvious curative effects on insomnia and dreaminess, palpitation and restlessness, anxiety and depression, chest and hypochondrium fullness and stuffiness and other symptoms. The traditional Chinese medicine composition is prepared from the following raw medicinal materials in parts by weight: 10-20 parts of radix bupleuri, 5-10 parts of scutellaria baicalensis, 15-20 parts of codonopsis pilosula, 9-15 parts of rhizoma pinelliae preparata, 20-30 parts of poria cocos, 15-30 parts of cassia twig, 10-20 parts of calcined ruddle, 20-30 parts of crude dragon bone, 25-45 parts of raw oyster shell, 15-25 parts of acanthopanax, 15-25 parts of poria with hostwood, 5-10 parts of fried spina date seed, 10-20 parts of honey-fried licorice root, 5-15 parts of stiff silkworm, 6-10 parts of cicada slough, 1-2 parts of scorpion and 10-15 parts of endothelium corneum gigeriae galli. , 10-15 parts of fingered citron, 15-30 parts of dark plum, 20-30 parts of white peony root and 5-15 parts of Chinese magnoliavine fruit. The scorpion is provided in a powder grinding form; the calcined ruddle, the crude dragon bone and the raw oyster shell are decocted with water and then mixed with the other raw medicinal materials, water is added for immersion and decoction for 2-3 times, decoction solutions are combined and mixed uniformly, and the traditional Chinese medicine decoction is obtained. The traditional Chinese medicine composition is prepared from traditional Chinese medicine decoction and scorpion powder.

The invention provides a strain of Chryseobacterium ZJU645, a biological preparation, a culture method, a fermentation method and application, and particularly belongs to the technical field of microbial control. The Chryseobacterium sp. ZJU645 disclosed by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO.35186, and the preservation date is July 10, 2025. The Chryseobacterium ZJU645 disclosed by the invention has a broad-spectrum antifungal effect, and has a relatively high antibacterial effect on alternaria alternata, sclerotinia sclerotiorum, fusarium oxysporum, paniculate corn, colletotrichum gloeosporioides and botrytis cinerea, and a fermentation product of the Chryseobacterium ZJU645 is stable. Through further optimization of fermentation conditions of the Chryseobacterium sp. ZJU645, the disease resistance of the Chryseobacterium sp. ZJU645 is improved, and a new biological control means is provided for more efficient prevention and treatment of agricultural diseases, especially mulberry diseases.

The invention belongs to the technical field of microorganisms, and particularly relates to a sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V, a fungicide and application of the fungicide. The invention provides a sclerotinia sclerotiorum pathopoiesis and reproduction dual deletion strain (Sclerotinia sclerotiorum) SD3-9V, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 2026255. The sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V provided by the invention has no pathogenicity, and sclerotium formation ability is deleted, so that the sclerotinia sclerotiorum can be used as a plant vaccine for preventing sclerotinia rot, and has multiple advantages of high biological safety, reduction of sclerotinia rot morbidity and promotion of crop growth and flowering. The invention provides an effective way for providing a safer and more reliable microbial agent for preventing and treating sclerotiniose.

This invention discloses a medicinal mud for treating blood stasis and heat-induced arthralgia, its preparation method, and its application. The medicinal mud is composed of the following raw materials in parts by weight: 30-70 parts of *Hedyotis diffusa*, 30-70 parts of *Caesalpinia sappan*, 30-70 parts of *Gardenia jasminoides*, 30-70 parts of *Rheum palmatum* (processed with wine), 15-45 parts of *Stephania tetrandra*, 10-30 parts of *Sparganium stoloniferum*, 10-30 parts of *Curcuma zedoaria*, 10-30 parts of *Ligusticum chuanxiong*, 10-30 parts of *Smilax glabra*, 10-30 parts of *Geranium wilfordii*, 10-30 parts of *Polygonum cuspidatum*, 5-15 parts of *Cinnamomum cassia*, 5-15 parts of *Cyperus rotundus*, and 5-15 parts of *Citrus reticulata* (green tangerine peel). The above-mentioned treatment method scientifically combines a large number of heat-clearing, blood-cooling, and detoxifying herbs such as gardenia bark, rhubarb, Japanese knotweed, and smilax glabra with powerful blood-breaking and stasis-removing herbs such as sparganium rhizome, turmeric rhizome, sappanwood, and sclerotium tsao-ko. It is also supplemented with herbs that dispel dampness, unblock the meridians, promote qi circulation, and relieve pain. This method directly targets the three core elements of "blood stasis and heat arthralgia": "heat," "stasis," and "congestion." It treats internal diseases from the outside, with significant curative effects, and avoids the systemic toxic side effects of oral medications.

The invention provides a method for preparing DMOA mixed-source terpenoids from penicillium sclerotiorum HY5, the DMOA mixed-source terpenoids and application of the DMOA mixed-source terpenoids in herbicides, and belongs to the technical field of weed control. The penicillium sclerotiorum HY5 is utilized to successfully prepare the DMOA mixed-source terpenoid compound capable of regulating and controlling the growth of the weeds, the growth of the weeds can be promoted or inhibited, and the penicillium sclerotiorum HY5 has the development potential of serving as a green pesticide lead compound and can be used for developing natural product herbicides or plant growth regulator products with brand-new structures and unique action mechanisms.

The invention relates to the technical field of protoplast preparation, in particular to a preparation method of protoplast of sclerotium rolfsii. The method comprises the following steps: carrying out enzymolysis on sclerotium rolfsii by adopting protoplast enzymatic hydrolysate; a Miracloth filter membrane is adopted for filtering, a container for collecting filtrate is placed on ice, and a precooled 0.6 M sorbitol solution is used for flushing; centrifuging the collected filtrate, collecting precipitates, cleaning the precipitates by using a precooled 0.6 M sorbitol solution to remove enzymatic hydrolysate, and then carrying out resuspension centrifugation by using STC to collect precipitates so as to obtain protoplasts; according to the characteristics of sclerotium rolfsii, a corresponding enzymolysis system is established, the enzymolysis condition is mild and easy to control, the obtained protoplast is complete and stable in form and high in yield, and the quantity of the protoplast reaches up to 1 * 10 < 8 > / mL.

The invention discloses a method for separating strains from dried diced poria cocos, and relates to the technical field of strain separation, and the key points of the technical scheme are as follows: the method comprises the following steps: cutting poria cocos sclerotium into 1.5 cm < 3 > specifications, drying at a low temperature of 35 DEG C to prepare the dried diced poria cocos, performing surface sterilization for 30 seconds by 75% alcohol, and performing quadruple control of soaking in sterile water for 30 minutes, so that the metabolic activity of the dried strains can be activated. According to the method, a dry diced poria cocos strain separation method is provided, normal-temperature preservation for 6 months is achieved, and a fresh poria cocos cold chain system is replaced. By drying at 35 DEG C, protein denaturation is avoided; 75% alcohol is used for 30s surface sterilization, so that infectious microbe pollution is reduced; and soaking in sterile water for 30 minutes to realize accurate recovery of osmotic pressure, so that the separation success rate is increased to 95%. The specification of 1.5 cm < 3 > diced poria cocos is quantified, surface sterilization is conducted for 30 s, a window is soaked for 30 min, and the pollution rate is compressed to be smaller than 5%.

The application belongs to the field of antibacterial activity research, and discloses a preparation method of guaiane sesquiterpenes and application thereof in resisting plant pathogenic fungi. Firstly, leaf blades of Artemisia stolonifera are dried, extracted, concentrated, and then a crude fraction is obtained through extraction, and then the crude fraction is further purified through normal silica gel, dextran gel and reversed-phase macroporous resin column chromatography, and finally three guaiane sesquiterpenes are obtained through liquid phase preparation. The compounds can effectively inhibit the growth of Sclerotinia sclerotiorum, Cochliobolus sativus and Verticillium dahliae, and the minimum inhibitory concentration (MIC) of moxartenolide is 6.25, 12.5 and 12.5 μg / mL respectively, the minimum inhibitory concentration (MIC) of artemdubolide C is 12.5, 12.5 and 12.5 μg / mL respectively, and the minimum inhibitory concentration (MIC) of artemvulactone F is 12.5, 12.5 and 12.5 μg / mL respectively, and the compounds have great application potential in resisting plant pathogenic fungi.

The present application belongs to the field of microbial technology, and discloses a new Trichoderma azadirachtae 3302 strain and application thereof in biocontrol and growth promotion. The Trichoderma azadirachtae 3302 has been preserved in the China General Microbiological Culture Collection Center on May 6, 2024, and the strain preservation number is CGMCC No. 3.27235. The Trichoderma azadirachtae 3302 of the present application is a new species, has the effects of antagonizing Fusarium oxysporum and Sclerotium rolfsii, has a good control effect on related diseases such as banana wilt, and can be used for the control of related diseases of food crops and economic crops; meanwhile, the strain has a good salt stress resistance and a good environmental adaptability; in addition, the strain also has a good effect of promoting plant growth and development, has a significant promoting effect on the germination and root length of rice seeds and the growth of banana seedlings, and has a good application value.

The invention discloses a soothing gel composition and a preparation method thereof, and belongs to the technical field of gel. The soothing gel composition comprises the following components based on the total mass of the soothing gel composition: 8.5000% of a humectant; 5.9000% of a skin conditioning agent; 2.0000% of a surface active agent; 0.5300% of a thickening agent; 0.2000% of an astringent; 0.0800% of a preservative; 0.0500% of a repairing agent; 0.0003% of a coloring agent; 0.1130% of a soothing factor; 82.6267% of a solvent; the soothing factor is prepared from an abelmoschus esculentus flower extract, aloe barbadensis leaf juice, a scenedesmus sibiricus extract, a kalimeris crassifolia extract and sclerotium gum; the soothing effect of the soothing gel composition is improved through the synergistic interaction effect of the mallow flower extract, the aloe barbadensis leaf juice, the scenedesmus western extract, the kalimeris crassifolia extract and the sclerotium rolfsii gum.

The invention discloses application of any compound of 8-substituted berberine derivatives in prevention and treatment of agricultural diseases. A biological activity test shows that the derivative has a significant effect on four plant pathogenic bacteria such as Xanthomonas oryzae pv. Oryzae, Xanthomonas citri, pseudomonas solanacearum and Ralstonia solanacearum, and four plant pathogenic fungi such as rhizoctonia solanacearum, sclerotinia sclerotiorum, botrytis cinerea and fusarium graminearum. The compound shows certain inhibitory activity on pathogenic bacteria of rice bacterial leaf blight, pathogenic bacteria of citrus canker, rhizoctonia solani, sclerotinia sclerotiorum, botrytis cinerea and pine wood nematodes, and has a good inhibitory effect on pathogenic bacteria of rice bacterial leaf blight, pathogenic bacteria of citrus canker, rhizoctonia solani, sclerotinia sclerotiorum, botrytis cinerea and pine wood nematodes. The compound is low in preparation difficulty, raw materials are cheap and easy to obtain, and the compound is expected to be developed into a novel plant disease resistant medicine.

The invention relates to the technical field of bacteriostatic preparations, in particular to mugwort essential oil as well as a preparation method and application thereof. Mixing mugwort with a sodium chloride solution, and soaking to obtain a soaked material; the material-liquid ratio of the soaked material is 4-12 mL / g; the mass percentage content of sodium chloride in the sodium chloride solution is 5-20%; the soaking time is 1-4 hours; distilling the soaked material, standing and layering distillate, and collecting upper-layer essential oil to obtain artemisia argyi essential oil; the distillation time is 1 to 5 hours. The mugwort essential oil provided by the invention has a relatively good inhibition effect on the growth of common plant pathogenic fungi such as rhizoctonia solani, sclerotinia sclerotiorum and fusarium oxysporum, so that the mugwort essential oil is used as a biological bactericide in future agricultural production, and the effect of preventing and treating diseases can be achieved to a certain extent.

This invention discloses a strain of Bacillus subtilis FHY1 and its applications, belonging to the field of microbiology. The present invention obtained a strain of Bacillus subtilis FHY1 from the juice of Populus euphratica in Xinjiang. Experimental verification shows that the liquid culture of the Bacillus subtilis FHY1 strain provided by this invention has a significant inhibitory effect on rice blast fungus, with an inhibition rate of 84% and an inhibition rate of 92% on rice blast fungus spore germination. It can promote rice growth under conditions of 150mM NaCl and 250mM NaCl. Simultaneously, this strain also has good inhibitory effects on rice blast fungus, Fusarium oxysporum, Fusarium graminearum, Sclerotinia sclerotiorum, and Anthracnose fungus. Therefore, this invention provides a new strain with good control effect against pathogenic fungi, and significantly promotes rice growth and development under salt stress.

This invention discloses a primer set for PCR detection of *Sclerotium rigescens*, along with its detection method and application, belonging to the field of microbial detection technology. The primer set includes primers SR-F and SR-R, with the following specific primer sequences: SR-F: TTCGTGGGGTGCTAAGGGAGT; SR-R: TTGTCGTGTCAGCGGGGAGAG. Detection method: (1) Collect rhizosphere soil samples from economic crops and extract total soil DNA; (2) Use the total soil DNA as a template for PCR amplification using the primer set; (3) Perform nucleic acid electrophoresis on the amplified products. If a specific amplification band of 361 bp is detected in the soil sample, it indicates the presence of *Sclerotium rigescens* in the soil sample. The primer set and detection method of this invention have high sensitivity and specificity, allowing direct detection of *Sclerotium rigescens* from soil samples without pure culture. The identification time is shortened from 3-5 days to 2-3 hours, making it suitable for early disease monitoring and control in the field.

The invention relates to application of bisindole alkaloid iheyamine A and derivatives thereof in treatment of plant virus pathogens, and finds that iheyamine A and derivatives I-1-I-15 thereof show good anti-plant virus pathogen activity for the first time, and can well inhibit tobacco mosaic virus (TMV), cucumber fusarium wilt, peanut brown spot, apple ring rot, wheat sheath blight, tomato early blight and rice blast. , phytophthora capsici and sclerotium of rape.

The invention discloses application of an ASF1 gene to improvement of plant disease resistance or cultivation of disease-resistant plants, and belongs to the technical field of gene engineering. The ASF1 gene comprises an ASF1A gene and an ASF1B gene, the nucleotide sequence of the ASF1A gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the ASF1B gene is shown as SEQ ID NO. 2. Phenotypes of ASF1A single knockout strains, ASF1B single knockout strains, ASF1A double knockout strains and ASF1B double knockout strains and influences on rice disease resistance are studied, and results show that compared with a wild type, a mutant plant is short and small, and the phenotype of the double knockout mutant is more obvious than that of a single knockout mutant; the single knockout strain and the double knockout strain both can improve the resistance of the rice to the xanthomonas oryzae sclerotiorum, and the double knockout strain has stronger resistance, so that a new genetic resource is provided for research on disease-resistant breeding of the rice.

The invention discloses preparation and application of a novel sclerotium-eating fungicide. The invention provides a combined bacterium, which is prepared from Intraporporus sclerotiporus S003 (CGMCC (China General Microbiological Culture Collection Center) No.35463) and Bacillus amyloliquefaciens L1017 (CGMCC No.36133). The invention also provides a preparation method of the combined bacterium, and the combined bacterium is prepared from the following raw materials: the Intraporporus sclerotiporus S003, the Bacillus amyloliquefaciens L1017, the Bacillus amyloliquefaciens L1017 and the Bacillus amyloliquefaciens L1017, the Bacillus amyloliquefaciens L1017 and the Bacillus amyloliquefaciens L1017. The complex microbial inoculant composed of the bacillus subtilis and the bacillus subtilis has a synergistic inhibition function on rhizoctonia solani CGMCC (China General Microbiological Culture Collection Center) 3.7376. The bacillus subtilis and the bacillus subtilis have a synergistic inhibition function on rhizoctonia solani. The two functional bacteria are scientifically screened and compounded to form a stable compound microbial agent, and the compound microbial agent is used for disease prevention and control and crop growth promotion and has wide application prospects and industrial value.