63 results about "Dinotefuran" patented technology

The invention relates to the technical field of pesticides, in particular to a pesticide composition, application thereof and a pesticide preparation. The pesticide composition comprises a first effective component and a second effective component, the first effective component is 1, 8-cineole, and the second effective component comprises at least one of flonicamid, cyantraniliprole, nitenpyram, flubendiamide, spirotetramat, pyriproxyfen, pymetrozine, dinotefuran and sulfoxaflor. The mass ratio of the first effective component to the second effective component is (50: 1)-(1: 100). Through the synergistic interaction of the first effective component and the second effective component, the prevention and treatment effect is remarkably improved, the prevention and treatment spectrum is expanded, and the field dosage can be greatly reduced; specifically, leaf back bemisia tabaci and trialeurodes vaporariorum can be well controlled, the control effect on bemisia tabaci, trialeurodes vaporariorum, thrips and the like is improved, and the application prospect is good.

The invention relates to the technical field of pesticides, and discloses an insecticidal composition containing dinotefuran. The insecticidal composition contains 9-51% of effective active components, 1.5-15% of a synergist, 5-40% of an auxiliary agent and the balance of water, the effective active components are dinotefuran and fenobucarb, and the weight ratio of dinotefuran to fenobucarb is 1: 2. The synergist is a mixture of a biological enzyme and a polymer emulsifier, wherein the weight ratio of the biological enzyme to the polymer emulsifier is 7: 1-1: 1. The insecticidal composition disclosed by the invention is used for preventing and treating rice planthoppers, can obviously improve the permeability and wettability of a medicament, can act on pests from multiple aspects, achieves the purpose of effectively preventing and treating the pests, reduces the dosage of the medicament in the field, saves the economic cost, reduces the pollution of the medicament to the environment, and has good economic benefits and economic benefits. And the risk that pests generate resistance to the pesticide is also reduced.

The present invention belongs to the technical field of pesticide insecticides and discloses an insecticidal composition containing a nicotinoid insecticide and its use. The insecticidal composition comprises an active ingredient A and an active ingredient B, wherein the active ingredient A is isoflualanam, and the active ingredient B is a nicotinoid insecticide, wherein the nicotinoid insecticide is any one of sulfluramid, sulfoxaflor, clothianidin, thiamethoxam, acetamiprid, thiacloprid, imidacloprid, dinotefuran, nitenpyram, and flupyradone, and the mass ratio of the active ingredient A to the active ingredient B is 1:40 to 45:1. The insecticidal composition of the present invention has the advantages of significant synergistic effect, delayed resistance, and low drug cost.

The present invention relates to a flea and rodenticide and a preparation method thereof, belonging to the technical field of pesticides. A flea and rodenticide of the present invention is composed of the following components in percentage by weight: active ingredient A 0.002 - 0.01%, active ingredient B 0.0002 - 0.01%, additive 1 - 60%, cereal 0 - 80%, auxiliary material 0.5 - 60%; the active ingredient A is flocoumafen; the active ingredient B is dinotefuran, clothianidin or chlorantraniliprole; the weight ratio of the active ingredient A to the active ingredient B is 1:5 - 50:1. The present invention makes the palatability of the bait excellent through compounding and synergism, and its daily average consumption is increased by 1.5 - 2 times, greatly increasing the utilization rate of rodenticide and saving manpower and material resources; in addition, the rodenticide can also kill the fleas parasitic on the rats while killing the rats, thereby reducing the spread of diseases and filling the market gap.

The invention discloses a mosquito prevention and control composition based on jonquil extract and application of the mosquito prevention and control composition. The invention provides an application of an ethanol extract of jonquil leaves in killing mosquitoes or preparing products for killing mosquitoes. The invention firstly proves that the kalanchoe blossfeldiana ethanol extract has a killing effect on three mosquito species, and the killing effect is obviously superior to that of kalanchoe laciniata which is the same family plant. The invention further provides a mosquito prevention and control composition containing the ethanol extract of the jonquil leaves and a mosquito prevention and control compound composition containing the ethanol extract of the jonquil leaves and dinotefuran. The insecticide poison bait prepared by compounding the jonquil extract and the chemical insecticide provides a new thought for constructing an efficient, low-consumption and environment-friendly mosquito comprehensive treatment system, and is suitable for comprehensive prevention and control of mosquito-borne diseases.

The application relates to the technical field of anti-transpiration agents, and discloses application of a compound in the field of plant drought resistance and a plant drought resistance preparation. At least one of the compounds of pyrisoxazole, dinotefuran, azoxystrobin and fluopicolide and the plant drought resistance preparation can significantly reduce a water transpiration rate, improve the resistance of plants to general water shortage, and reduce economic losses of plants caused by drought and water shortage.

The invention relates to the technical field of pesticides, and particularly discloses a dispersible oil suspending agent containing pyriproxyfen and dinotefuran and a preparation method of the dispersible oil suspending agent. Through the synergistic effect of the dispersing agent, the emulsifying agent and the dispersing medium, the oil suspending agent is not prone to flocculation and sedimentation of pesticide particles when stored under the high-temperature condition, the particle size of the pesticide particles changes little in the storage process, and therefore the dinotefuran and the pyriproxyfen can be evenly dispersed into liquid medicine in the actual use process, and the oil suspending agent has the advantages that the oil suspending agent is environmentally friendly; and uniform pesticide application is realized in a spraying area range, so that full prevention and control of diseases and pests are facilitated.

The invention relates to a dinotefuran and fenobucarb emulsion in water and a preparation method thereof, and belongs to the technical field of agricultural chemicals. According to the dinotefuran and fenobucarb emulsion in water and the preparation method thereof, the dinotefuran and fenobucarb emulsion in water with smaller particle size and more uniform particle size distribution is prepared by selecting a specific emulsifier and a stabilizer, the stabilizer contains a hydrophilic sulfonate group, a hydrophilic quaternary ammonium salt group, cyclic piperidine and an imidazole group, and a molecular chain contains an appropriate carbon chain, so that the dinotefuran and fenobucarb emulsion in water is prepared. The emulsion in water has good hydrophilicity and lipophilicity, can effectively and stably disperse dinotefuran and fenobucarb in water at the same time through the synergistic effect with the polyethylene glycol butyl ether emulsifier and the physical and chemical effect of each functional group with dinotefuran and fenobucarb, can endow the emulsion in water with good wettability, can quickly wet the surfaces of pests, and has the advantages of no toxicity and no harm to the environment. The diffusion rate of the dinotefuran and the fenobucarb from the body surfaces of the spider millettii and the oriental rice locust to the body is increased, and the insecticidal efficiency of the dinotefuran and the fenobucarb is improved.

The invention discloses a nutrient solution for secondary grafting of poria cocos as well as a preparation method and application of the nutrient solution, and relates to the technical field of poria cocos planting. The method comprises the following steps: mixing plain boiled water, white sugar, edible white vinegar, fresh milk, moroxydine, dinotefuran, table salt and monopotassium phosphate, uniformly shaking to prepare a nutrient solution for secondary grafting of poria cocos, and filling the nutrient solution into a closed container for later use. The method comprises the following steps: soaking small blocks of fresh poria cocos sclerotium to be subjected to secondary grafting in a nutrient solution by hands, attaching the small blocks of the fresh poria cocos sclerotium to the scraped basswood grafting position, and covering with surface soil. The yield of the poria cocos is obviously increased through secondary grafting. In the process, proper carbon and nitrogen elements are provided through white sugar and fresh milk; the salt and the monopotassium phosphate provide sodium, phosphorus and potassium elements; the white vinegar, the viroxydine and the dinotefuran have the effects of disinfection, disease prevention and insect prevention respectively; under the synergistic effect of the raw materials, reasonable supplementation of exogenous nutrients of pine trees is guaranteed, and with the assistance of soil moisture and nutrition, the purposes of harvesting 20-30 days in advance and achieving high-quality, high-yield and efficient cultivation production are achieved.

The application relates to the technical field of insecticidal compositions. The application discloses a composition containing chlorantraniliprole and dinotefuran as well as a preparation method and application thereof. Raw material composition of the composition comprises chlorantraniliprole, dinotefuran, d-cycloprothrin, d-phenothrin, azocyclotin, polyethylene diamine, sophoraflavescens aiton, grapefruit peel extract, capsicum annuum extract, plant essential oil and solvent. The preparation method comprises the following steps: S1, mixing chlorantraniliprole, dinotefuran, d-cycloprothrin and azocyclotin, and stirring; S2, adding polyethylene diamine and solvent, and stirring and mixing; S3, adding sophoraflavescens aiton, grapefruit peel extract, capsicum annuum extract and plant essential oil, stirring and mixing, and preparing the composition. The application also discloses application of the composition in the field of pest control. The prepared composition containing chlorantraniliprole and dinotefuran can effectively improve the pest control effect and has a long effective duration.

The present application relates to the technical field of cotton leafhopper control, and particularly relates to a composition for preventing and treating cotton leafhopper, an insecticide and application thereof and a preparation method thereof.The composition comprises dinotefuran, potassium dihydrogen phosphate, orange peel essential oil and eucalyptus oil, wherein the mass fraction of dinotefuran is 67.5-94.5 parts, the mass fraction of potassium dihydrogen phosphate is 900 parts, the mass fraction of orange peel essential oil is 900 parts, and the mass fraction of eucalyptus oil is 7.5 parts.The insecticide in the present application can not only achieve better control effect, but also reduce the dosage of dinotefuran when applied to the control of cotton leafhopper, so as to effectively delay the development of drug resistance of cotton leafhopper.

The invention discloses a compound pesticide containing chlorantraniliprole. The compound pesticide is formed by compounding an active component A and an active component B, the active component A is chlorantraniliprole, the active component B is any one of dinotefuran, thiamethoxam, cyantraniliprole and spinetoram, and the mass ratio of the active component A to the active component B is (1-10): (1-30); the composition further comprises auxiliary materials and the balance of agriculturally acceptable auxiliaries and water or organic solvents. The auxiliary materials comprise one or more of a dispersing agent, a wetting agent, a thickening agent and a stabilizing agent, and the total mass of the auxiliary materials accounts for 1-20% of the total mass of the preparation. Compared with the prior art, the chlorantraniliprole-containing composite insecticide has the advantages of high efficiency, broad spectrum, low toxicity and synergistic interaction.

The present invention provides a synergistic insecticidal composition comprising chlorfenapyr, fipronil, and at least one more insecticide. The present invention further provides a method for preparation of the insecticidal composition and use thereof. The insecticidal composition of the present invention is effective against pests of different crops and serves as a useful tool for managing resistance. The composition has a broad spectrum, is environmentally safe, has a reduced dosage, and has a lower frequency of application than existing formulations.

The present invention provides a test method for toxicity of raw dinotefuran drug on early life stage of fish. The method includes: preparing a standard diluent, preparing test drug liquids, selecting a test organism, toxicant exposure of the embryos, toxicant exposure of larvae, monitoring and controlling test conditions, observation in the test, and statistically analyzing data and drawing results.

The invention relates to the technical field of pesticide residue detection, in particular to a method for rapidly screening neonicotinoid and macrolide pesticide residues in vegetables through trichogramma chilonis. The 10% lethal effect condition of the trichogramma on nine kinds of common neonicotinoid or macrolide pesticides such as imidacloprid, acetamiprid, dinotefuran, thiamethoxam, clothianidin, nitenpyram, abamectin, methylamino abamectin benzoate and ivermectin is determined; acute toxic effects and action rules of nine common neonicotinoid or macrolide pesticides in vegetables on trichogramma are researched; according to the method, the 1-hour action dose of the pesticide is determined by adopting 10% of death effect, the detection limit of the trichogramma biotoxicity method on the residues of the 9 pesticides in the vegetables is calculated by combining the quality and surface area of the vegetables, and finally, the common neonicotinoid or macrolide pesticide residues in the vegetables are rapidly screened by adopting the trichogramma biotoxicity limit value determination method.

The utility model relates to a special granulator for dinotefuran water dispersible granules, which comprises a granulation box and a horizontal drying bin, the granulation box is positioned at the top of the horizontal drying bin, the granulation box is communicated with the horizontal drying bin through a rotary feeding valve, a shaftless screw conveyor is rotatably mounted in the horizontal drying bin, and the shaftless screw conveyor is communicated with the horizontal drying bin through a rotary feeding valve. Two mounting grooves which are symmetrically distributed left and right are formed in the horizontal drying bin, two conveying pipes are fixedly mounted in each of the two mounting grooves, metal sintering filter screens are fixedly mounted in the two mounting grooves, and the metal sintering filter screens are located above the conveying pipes; the hot air pipe conveys external hot air into the conveying pipe and then the hot air is exhausted through the air outlet hole, so that the hot air moves upwards, particles entering the horizontal drying bin can be better dried, the shaftless spiral conveyor is suitable for viscous wet particles, and the situation that the particle drying rate is reduced due to material winding at the shaft rod is avoided.

The invention discloses a bemisia tabaci control agent and a preparation method thereof, and belongs to the technical field of bemisia tabaci control, the effective components of the control agent are matrine and dinotefuran, and the matrine and dinotefuran are compounded to solve the problem that drug resistance is easily generated when single dinotefuran is applied; the auxiliary material components in the control agent comprise gelatin, humic acid and the like, the gelatin is adopted as an embedding material to embed the effective components to prepare the slow-release control agent with immediate and constant-speed drug release, the drug loss and decomposition are inhibited, the stability of the effective components is improved, the action time of the control agent is prolonged, the effect of the control agent is improved, and the control effect of the control agent is improved. The efficient control on the bemisia tabaci is realized, and a good application prospect is realized.

The utility model relates to the technical field of pesticide processing equipment, and discloses a pyriproxyfen and dinotefuran compound medicament mixing device which comprises a bottom frame, a frame is fixedly connected to the middle of the top wall of the bottom frame, a fixing plate is fixedly connected to the middle of the frame, and a mixing barrel is fixedly connected to the inner wall of the fixing plate. A servo motor is fixedly connected to the top wall of the mixing barrel, the output end of the servo motor penetrates through the top of the mixing barrel and is fixedly connected with stirring blades, electric push rods are fixedly connected to the left side and the right side of the top wall of the bottom frame, and connecting plates are fixedly connected to the top ends of the electric push rods. According to the utility model, raw materials in the feeding barrel are pushed into the mixing barrel through the injection rod, so that the purpose of preliminary accurate injection is realized, and the size of medicine particles can be further refined by matching with high-speed shearing equipment until an ideal state is achieved; therefore, the situation that the raw material processing efficiency is reduced due to insufficient mixing effect during raw material mixing is avoided.

The invention relates to the technical field of sanitary pest killing, in particular to a sanitary pest control concentrated composition and application thereof. The sanitary pest control concentrated composition is prepared from the following components in percentage by mass: 10-50% of an active component A and an active component B, 10-40% of a feeding accelerant, 5-15% of a macromolecular humectant, 5-15% of a macromolecular thickener and other auxiliary materials, the active component A is selected from one or more of clothianidin, dinotefuran and sulfoxaflor; and the active component B is selected from one or more of chlorfenapyr, chlorfenapyr bisamide, metafluzamide and tetrachlorantraniliprole. According to the sanitary pest control concentrated composition, through reasonable compounding of the active components and performance combination of the preferable feeding accelerant, the preferable high-molecular humectant and the preferable high-molecular thickening agent, increase of effective components retained on the surface and improvement of surface moisture retention and palatability are achieved, the quick-acting and long-term persistent effect of the product is obviously improved, and the sanitary pest control concentrated composition is suitable for being applied to the field of agricultural products. The killing effect of the effective components on target pests is fully exerted.

The invention belongs to the field of pesticides, and relates to a pesticide composition and application, the pesticide composition comprises an active component A and an active component B, the active component A is any one of imidacloprid, dinotefuran and nitenpyram, the active component B is a compound of formula (I), and the mass ratio of the active component A to the active component B is 1: 64-60: 1. The pesticide composition disclosed by the invention has an excellent prevention and treatment effect on hemiptera pests, has a remarkable synergistic effect under a certain mass ratio, can delay the generation of drug resistance of the pests, and is safe to the environment.

This invention belongs to the field of pesticides and insecticides, specifically relating to an insecticidal composition containing bis(triflufenoxuron) and its application. The insecticidal composition includes active ingredient A and active ingredient B. Active ingredient A is bis(triflufenoxuron), and active ingredient B is any one of dinotefuran, spinosad, flonicamid, and acetamiprid. The mass ratio of active ingredient A to active ingredient B is 1:30 to 25:1. The insecticidal composition of this invention has advantages such as synergistic effects and reduced resistance. This insecticidal composition can be used to control agricultural, forestry, and horticultural pests.

The present invention relates to a stable synergistic pesticidal composition comprising A) a compound of Formula I, i. e., 2-tert-butyl-5- [ ( 4-tert-butylbenzyl) thio ] -4-chloropyridazin-3 ( 2H) - one or its agrochemically acceptable salts, isomers, esters and derivatives; B) Hexythiazox or its agrochemically acceptable salts, isomers, esters and derivatives; and C) Dinotefuran or its agrochemically acceptable salts, isomers, esters or its derivatives for effective control of various pests including but not limited to insects-pests, mites, arachnid, etc. and wide range of diseases caused by such pests. The present invention also relates to a process for preparation of such pesticidal composition for synergistic and efficacious control of various pests including insects pests, mites, arachnid, etc and associated diseases.

The invention relates to a method for determining pesticide residues, in particular to a method for rapidly separating and quantitatively determining dinotefuran enantiomers in a cucumber sample, an analysis system and application of the dinotefuran enantiomers. The method comprises the following steps: extracting a cucumber sample by using a 1% acetic acid-acetonitrile solution, purifying the cucumber sample by using a Pestii-Carb / PSA solid-phase extraction small column, fixing the volume by using isopropanol / n-heptane (2: 8, v / v), introducing the sample into a UPC2 system equipped with a CHIRALPAK AD-3 chiral chromatographic column, and realizing baseline separation of (+)-(S)-dinotefuran and (-)-(R)-dinotefuran within 4 minutes under the conditions of supercritical CO2 / methanol gradient elution, proper column temperature and back pressure. The method is good in linearity within the range of 0.5-20.0 mg / L, the quantitation limits of the two enantiomers in the cucumber matrix are both 0.1 mg / kg, the adding standard recovery rate is 80.4%-106%, and the relative standard deviation is not larger than 7.5%. The method and the system have the advantages of high analysis speed, low solvent consumption and high sensitivity and precision, and are suitable for conventional monitoring and risk assessment of dinotefuran enantiomer residues in vegetables such as cucumbers and the like.

The invention relates to a microbacterium X10 with a broad-spectrum pesticide degradation function and application of the microbacterium X10, the microbacterium X10 is named as a microbacterium X10 strain, the preservation number of the microbacterium X10 strain is GDMCC No: 66970, and the preservation date of the microbacterium X10 strain is September 17, 2025. The strain has an efficient degradation effect on a plurality of typical pesticides such as dinotefuran, carbendazim, atrazine, pendimethalin and lambda-cyhalothrin, and also has a plurality of probiotic functions of secreting indole-3-acetic acid, dissolving inorganic phosphorus, generating siderophores, antagonizing phytopathogens and the like. The strain can effectively relieve stress of pesticides on plants and promote growth of the plants. The strain can be used for repairing pesticide-polluted soil and promoting plant growth, and has a wide application prospect in green agriculture development.

The present invention discloses an insecticide bait composition containing a piperic acid derivative compound. The compounded insecticide bait comprises active ingredients A and B, wherein A is a piperic acid derivative compound and B is one of fipronil, indoxacarb, dinotefuran, hydrazone, or imidacloprid. The weight ratio of A to B is 20:1 to 1:10. Because the piperic acid derivative compound is a brand-new insecticide ingredient with a novel mechanism of action, a good lethal effect, and no repellency to sanitary pests, the composition can delay the resistance of single insecticide baits, improve the control effect, and prolong the lasting effect.

The invention relates to the technical field of pesticides, in particular to spinetoram dinotefuran water dispersible granules as well as a preparation method and application thereof. The water dispersible granule is prepared from the following raw materials in percentage by weight: 5 to 20 percent of spinetoram, 30 to 50 percent of dinotefuran, 8 to 25 percent of auxiliaries and the balance of filler. The spinetoram-dinotefuran water dispersible granule disclosed by the invention not only has a remarkable insect prevention effect, but also has excellent safety, and after the spinetoram-dinotefuran water dispersible granule is applied, the dry heart rate of rice is relatively low, and the plant protection effect is good. And the obtained water dispersible granules are uniform and dense solid particles, are free of impurities and hard blocks, and have stable physical and chemical properties and excellent comprehensive properties.

The invention discloses two typical neonicotinoid insecticide aptamers, dinotefuran and nitenpyram are respectively taken as targets, graphene oxide is adopted to adsorb ssDNA sequences which are not combined with the targets, and the dinotefuran and nitenpyram aptamers are obtained through screening. The sequence of the dinotefuran aptamer is CGCAAGTGTTGGCCC-AGGTCGACGCATGCGCCG, and the dissociation constant of the dinotefuran aptamer to the dinotefuran is 48.03 nM. The dinotefuran aptamer can be used for preparing the dinotefuran. The sequence of the aptamer of the nitenpyram is TAGGGAATTCGTCGACGGATCCGCTGGGTGTACGACGTCCCTA, and the dissociation constant of the aptamer of the nitenpyram to the nitenpyram is 25.20 nM. Specific analysis finds that the two aptamers obtained through screening only have a recognition effect on dinotefuran and nitenpyram and do not have affinity to other insecticides. Molecular docking results show that the aptamer is mainly combined with dinotefuran and nitenpyram through hydrogen bonds and hydrophobic interaction. According to the aptamer screening method, the target does not need to be specified, the affinity of the aptamer obtained through screening to the target is improved through combination of positive screening and negative screening, and a new recognition element is provided for construction of a dinotefuran and nitenpyram detection method.

The invention discloses a urea type surfactant for a dinotefuran suspending agent and a preparation method of the urea type surfactant. Organic amine and isocyanate are adopted to generate a urea compound, and active amine hydroxyl, epoxypropane and ethylene oxide are adopted to generate the urea type surfactant; the polarity of the ureido structure is large, and surfactant molecules are more easily interacted through intermolecular hydrogen bonds or dipole moments, so that the surfactant molecules of the adsorption layer are more closely arranged, the viscosity and elasticity of the adsorption layer are increased, the stability of an adsorption film is enhanced, and the performance of the surfactant is improved; the surfactant contains polyether with a macromolecular long-chain structure and a urea structure with relatively strong polarity, forms characteristics similar to those of a chelate in a molecular structure, can possibly act with pesticide molecules to obtain a more stable molecular structure, and can solve many problems of a dinotefuran suspending agent in a stable dispersion system.

The invention discloses a dinotefuran polylactic acid microcapsule as well as a preparation method and application thereof, and belongs to the technical field of pesticide preparation. The dinotefuran-polylactic acid microcapsule provided by the invention comprises a wall material and a core material wrapped in the wall material, the wall material is polylactic acid; the core material is dinotefuran; the dinotefuran and polylactic acid microcapsule has a water-in-oil capsule structure. The prepared dinotefuran-polylactic acid microcapsule particles are uniform in dispersion and good in stability, have excellent surface tension, smaller contact angle, excellent slow release performance and photolysis resistance and can be better wetted on rice leaves, the adhesion of the microcapsule particles is improved, the dosage of pesticide applied to a field is reduced, and the application prospect is wide. The dosage of the pesticide entering target crops is increased, the control effect of the pesticide on the target crops is improved, and the bactericidal composition has a wide application prospect in pesticides.

The invention relates to the technical field of environmental microbiological technology and agricultural bioremediation, and discloses a rhodococcus bacterium X-20 and application thereof. The Rhodococcus sp. X-20 can efficiently degrade various pesticides in liquid and soil environments, including carbendazim, dinotefuran, atrazine, pendimethalin and cyhalothrin, and especially shows specific efficient degradation ability to carbendazim. In addition, the strain has various plant probiotic functions: the strain can secrete indole-3-acetic acid (IAA), generate iron carriers, dissolve inorganic phosphorus and antagonize phytophthora nicotianae, and the growth of tobacco seedlings can be remarkably promoted. Field experiments show that the strain can relieve growth inhibition of compound pesticide pollution on tobacco, and the strain can be used for preparing microbial agents and applied to bioremediation of pesticide-polluted soil and green agriculture.