52 results about "Cyhalothrin" patented technology

The invention belongs to the technical field of pesticide suspending agents, and particularly discloses a micro-capsule suspension-suspending agent containing chlorine fluorine and clothianidin and a preparation method of the micro-capsule suspension-suspending agent. The microcapsule suspension-suspending agent is prepared from the following raw materials: 11 to 13 percent of lambda-cyhalothrin, 12 to 14 percent of clothianidin, 9.20 to 9.60 percent of a solvent, 3.25 to 3.45 percent of a wall material I, 0.35 to 0.50 percent of protective glue, 2.13 to 2.33 percent of an emulsifier, 1.24 to 1.45 percent of a dispersing agent I, 0.24 to 0.45 percent of a wall material II, 3.90 to 4.10 percent of a dispersing agent II, 2.92 to 3.12 percent of an anti-freezing agent, 0.03 to 0.07 percent of a thickening agent I, 0.45 to 0.55 percent of a thickening agent II, 0.46 to 0.52 percent of a preservative and the balance of water. The microcapsule suspension-suspending agent prepared in the invention has good stability in the storage process, the slow release of effective components is controlled, and the lasting period is prolonged.

The invention relates to the field of pesticides, and particularly discloses a pH-light dual-response nano pesticide and a preparation process thereof. The invention relates to a preparation method of a pH-light dual-response nano insecticide. The preparation method comprises the following steps: adding water into polyethylene glycol, castor oil polyoxyethylene ether and sodium lignin sulfonate to prepare a water phase; the preparation method comprises the following steps: uniformly mixing an efficient cyhalothrin active compound with xylene, and adding diisocyanate to prepare an oil phase; adding the oil phase into the water phase, and adding ethylenediamine, YUS-SC3A, glycerol, xanthan gum, magnesium aluminum silicate and benzoic acid to obtain the lambda-cyhalothrin microcapsule suspending agent. The preparation method comprises the following steps: adding water into YUS-SC3A, uniformly mixing, and adding a clothianidin active compound, glycerol, xanthan gum, magnesium aluminum silicate, AF205 and benzoic acid to obtain a clothianidin suspending agent; mixing the two agents to obtain the nano insecticide, adding the composite dispersant, adding the pre-gel, adding azodiisobutyronitrile, blowing with inert gas, and adding Kathon. By preparing the pH-light dual-response nano insecticide, the insecticidal effect is improved, the generation of drug resistance is avoided, and efficient prevention and control of wheat aphids are realized.

The invention provides a medicine composition for killing ticks and application of the medicine composition. The pharmaceutical composition contains an effective component A and an effective component B, the effective component A is flumethrin, and the effective component B is lambda-cyhalothrin. When the effective component A and the effective component B are compounded according to the mass ratio of (10: 1)-(1: 2), a remarkable synergistic effect is achieved. The pharmaceutical composition provided by the invention consists of the flumethrin and the lambda-cyhalothrin, and compared with a single agent, the composition has the advantages that the killing effect on the ticks is obviously improved, the medication cost is obviously reduced, the composition is an effective compound medicament for killing the ticks, and the generation of the drug resistance of the ticks can be relieved.

This invention provides a method for storing mango seeds, belonging to the field of seed preservation technology. The method involves cutting off mango fruits with embryos, along with their pedicels and branches, 77-84 days after fruit set. A mixture of pyraclostrobin, lambda-cyhalothrin, and chlorothalonil is sprayed on the fruit, pedicels, and branches. After drying, styrene-butadiene latex is applied to the pedicels and branches. Once the latex dries, a mixture of guanidine-copper acetate and benzoyl-pyraclostrobin is sprayed on the fruit, pedicels, and branches again. After drying, the mango fruits with petioles and branches are placed in a sealed box and stored at 10-14°C. The mango variety used is the Golden Phoenix mango. This invention increases the storage period of Golden Phoenix mango seeds from 1.5 months to 5 months, which is of great significance for the genomics and cell biology research of Golden Phoenix mangoes.

The invention discloses a butenolide composition. The butenolide composition comprises butenolide and one or more insecticides. According to the invention, butenolide is mixed with insecticides such as imidacloprid, acetamiprid, spirotetramat, flonicamid or lambda-cyhalothrin for use, so that a relatively good insecticidal synergistic effect is realized. Compared with a single pesticide preparation, the pesticide preparation containing the butenolide composition has the advantage that the prevention effect on cotton aphids is remarkably improved.

The invention provides application of periplocin in preparation of anti-PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) drugs, and belongs to the technical field of antiviral drugs. Experimental results show that periplocin has extremely remarkable inhibiting and blocking effects on a 1-bit ribosome framing process of the PRRSV virus, and can be used for effectively inhibiting the replication of the PRRSV virus so as to inhibit the proliferation of the PRRSV virus; in addition, the compound has an extremely remarkable inhibition effect on the frame shift process of-1-bit ribosomes of different strains of PRRSV viruses; the periplocin can effectively inhibit replication and proliferation of PRRSV in vitro and in vivo of live pigs, can be used for preparing products for inhibiting proliferation of the PRRSV and can be used for preparing drugs for treating and preventing diseases caused by PRRSV infection, and the drugs are broad-spectrum anti-PRRSV drugs and have wide application prospects.

This invention discloses a composition containing isoxaflutole and lambda-cyhalothrin, and its uses. The insecticide composition comprises isoxaflutole and lambda-cyhalothrin, with a mass fraction ratio of 1:1-50 between the two active components. Within a certain ratio range, the composition of this invention exhibits a significant synergistic effect against diamondback moth and flea beetles, which is beneficial for achieving reduced pesticide use and increased efficiency, meeting the requirements of the green and environmentally friendly trend in pesticides.

The application belongs to the technical field of pesticide synergists, and discloses a use of an amide compound as a pesticide synergist. The application takes CYP6AE48 of Spodoptera litura as a main target, adopts a method combining computer-aided drug design technology and biological effect screening, and screens an amide compound, which is N-{5-[2-(2-{3-[2-(2-methylphenoxy)ethoxy]benzyl}hydrazino)-2-oxoethyl]-1,3,4-thiadiazol-2-yl}benzamide. It is known through experiments that the compound has a good inhibitory effect on CYP6AE48 of Spodoptera litura, can prevent degradation of lambda-cyhalothrin and chlorantraniliprole, and can play a synergistic effect as a pesticide synergist in pest control.

The invention relates to the field of microcapsule suspending agents, in particular to an efficient cyhalothrin microcapsule suspending agent with a slow release characteristic and a preparation method thereof, and the efficient cyhalothrin microcapsule suspending agent is prepared from the following raw materials in parts by mass: 75-80 parts of microcapsule primary emulsion, 1-3 parts of polylactic acid, 8-12 parts of dichloromethane, 28-32 parts of deionized water, 1-3 parts of dispersing agent T36 and the like. According to the invention, a microcapsule product with stable performance is successfully prepared by constructing a composite capsule wall structure and arranging the plant-source synergist in the composite capsule wall structure and combining with an optimized preparation process, and compared with the prior art, the product effectively overcomes the problems of burst release, short lasting period, poor stability and single function of a traditional preparation, and has a wide application prospect. According to the present invention, the stable release and the efficiency improvement of the pesticide are achieved, the risk to the environment is reduced, the huge potential is provided in the sustainable treatment of the agricultural pests, and the wide application prospect is provided.

The invention discloses an insecticidal composition capable of active attraction and local application and application, the active components comprise chlorenthrin and lambda-cyhalothrin, and the weight ratio of the chlorenthrin to the lambda-cyhalothrin is 1: 4-4: 1. According to the invention, by adding attractant components, conventional passive control is converted into active attractant attraction, so that the purpose of killing insects is achieved; by adding the synergistic additive, the expansibility and the adhesive force of the liquid medicine are improved, and the effective utilization rate of the liquid medicine is improved; by adding the macromolecular emulsifying dispersant, the problems that the water dispersible granules prepared from the low-melting-point chloroenthrin and the lambda-cyhalothrin are easy to form dead granules in the granulation process and cannot be disintegrated due to caking after being stored for a long time are solved; the chlorenthrin and the lambda-cyhalothrin are compounded and processed into the water dispersible granule, and the water dispersible granule has the characteristics of remarkable synergistic effect on prevention and treatment of public health pests and flies, capability of reducing the application amount of the medicament, cost saving, environmental friendliness, reduction of the risk of human health and the like.

The application discloses a nucleic acid aptamer for simultaneously identifying three pyrethroid pesticides and an evaluation method and application thereof, the nucleic acid aptamer is nucleic acid aptamer seq-7, and the nucleotide sequence is 5'-GCCATCTTTGATTGGAATGGCGGTGTCCGTGTTGCGCCATCGTCGGAGG CAAGATCAAGGTTGTGGCACC-3'. The nucleic acid aptamer is screened based on the Capture-SELEX technology, and the nucleic acid aptamer can simultaneously combine lambda-cyhalothrin, cyfluthrin and fenvalerate with high affinity, the application effectively overcomes the limitation that the existing nucleic acid aptamer technology can only identify a single pyrethroid pesticide, and provides a new method and new technology for simultaneously detecting and screening the three pesticide residues rapidly, at low cost, with high sensitivity and without interference. The aptamer not only has high specificity and affinity, but also can accurately detect the target pesticide in a complex sample background, remarkably improves the detection efficiency, reduces experimental cost and time, promotes the development of rapid detection technology, and has a wide application prospect.

The invention provides lodging-resistant pesticide-fertilizer granules for sugarcanes and a preparation method of the lodging-resistant pesticide-fertilizer granules, and relates to the technical field of pesticide-fertilizer granules. The medical fertilizer granule provided by the invention is prepared from the following components in percentage by weight: 0.8 to 1.2 percent of cyfluthrin-clothianidin complex, 0.4 to 0.6 percent of synergist, 1 to 3 percent of binder and the balance of slow-release chemical fertilizer, the slow-release chemical fertilizer comprises a slow-release matrix and a lodging-resistant chemical fertilizer filled in the slow-release matrix, and the lodging-resistant chemical fertilizer at least comprises a nitrogen fertilizer, a phosphorus fertilizer, a potassium fertilizer and a silicon fertilizer. According to the invention, pests in sugarcane growth can be inhibited, the absorption capability of sugarcanes on nutrients of the chemical fertilizer is improved, and the lodging resistance of sugarcanes in severe weather is effectively improved.

The invention discloses a preparation method of a suspending agent containing lambda-cyhalothrin and chlorantraniliprole, and relates to the technical field of pesticides. Comprising the following steps: uniformly mixing lambda-cyhalothrin and chlorantraniliprole, adding a hydrogen bond directing agent, adding an ethyl acetate-ethanol mixed solvent, and grinding; the preparation method comprises the following steps: dissolving N-isopropylacrylamide and acryloylated chitosan in water, adding gold nanorods, introducing nitrogen, injecting an initiator, and dialyzing and purifying; dissolving the co-crystallized powder in tetrahydrofuran, dispersing the composite gel in a choline propionate aqueous solution containing polyoxyethylene-polylactic acid, slowly adding the liquid medicine into a gel dispersion liquid, simultaneously carrying out ultrasonic treatment, and dialyzing to obtain a drug-loaded nanogel suspension; respectively adding glycerol and sodium citrate, homogenizing, shearing, adjusting the pH value, filtering with a filter membrane, and sterilizing; liquid medicine is loaded in a temperature-sensitive gel network, and a photothermal conversion material is introduced, so that on-demand release under the triggering of near-infrared light is realized.

The invention provides a pesticide composition containing a pyrethroid compound, which consists of a compound with a structural formula (I) and a second effective component, the second effective component is bifenthrin, beta-cyhalothrin, fenpropathrin, beta-cyhalothrin, beta-cyhalothrin, beta-cyhalothrin, cypermethrin, cyfluthrin, deltamethrin, ethofenprox, fenvalerate or cis-cypermethrin, and the weight ratio of the bifenthrin, the beta-cyhalothrin, the fenpropathrin, the fenvalerate and the cis-cypermethrin is (1-50): (1-50). The invention also provides application of the pesticide composition in prevention and control of agricultural and forestry pests, especially phyllotreta striolata, ostrinia nubilalis or tetranychus cinnabarinus. The invention verifies that a remarkable synergistic effect can be obtained by compounding the flufenoxanil and the pyrethroid insecticide in a proper proportion, the effects of improving the control effect, reducing the dosage and expanding the insecticidal spectrum are realized, and the composition has an excellent control effect on target pests such as chilo suppressalis, plutella xylostella, green peach aphid, beet armyworm, ostrinia nubilalis, thrips, flea beetle and tetranychid mites, and has a good control effect on the target pests such as chilo suppressalis, plutella xylostella, green peach aphid, beet armyworm, ostrinia nubilalis. (I).

The invention discloses a W-5 strain for improving pesticide tolerance of natural enemy insects and a culture method of the W-5 strain, the W-5 strain can well grow in a lowest-salt culture medium with lambda-lambda-cyhalothrin as a unique carbon source, the OD600 of a cultured bacteria solution is continuously increased, and the degradation rate of cyhalothrin pesticide reaches 98.24%. Furthermore, after the tenebrio molitor treated by the W-5 is fed to the hunting fuscipes, the activity of two types of key detoxifying enzymes, namely glutathione S-transferase and cytochrome P450, in the body of the hunting fuscipes can be remarkably improved. After the strain is continuously fed for one week, the W-5 is successfully colonized in intestinal tracts of the hpactor fuscipes, and the survival rate of the hpactor fuscipes under the stress of lambda-lambda-cyhalothrin is increased to 90.625%. Therefore, through double mechanisms of'direct microbial degradation 'and'host detoxification metabolism activation', the W-5 synergistically enhances the resistance of the Harpactor fuscipes to the lambda-lambda-cyhalothrin.

The present application relates to bromocyclen and chlorantraniliprole dispersible oil suspension and its preparation and application, including the following components and weight percentage: bromocyclen 0.1-20%, chlorantraniliprole 0.1-30%, emulsifier 15-25%, dispersant 0.1-5%, thickening agent 0.1-3%, viscosity reducer 0.1-3%, stabilizer 0.1-10%, synergist 0.1-50%, oil phase carrier to 100%. Compared with the prior art, the bromocyclen and chlorantraniliprole dispersible oil suspension of the present application is environmentally friendly, has good stability, high prevention effect and good safety on vegetable phyllotreta striolata, and its preparation method is simple and easy to industrialized mass production. In addition, the screened block polymeric carboxylate compound 100# provides a good viscosity reduction idea and selection for the development of dispersible oil suspension products containing soybean oil and other plant oil systems in the later stage.

The present application relates to the technical field of pesticide production, in particular to a high-efficiency lambda-cyhalothrin microcapsule suspending agent and a preparation method thereof, aiming at solving the problems of low encapsulation rate, poor dispersibility, insufficient stability and high skin irritation in the prior art. The microcapsule suspending agent is made of high-efficiency lambda-cyhalothrin, 150# aromatic hydrocarbon solvent, polyisocyanate, polyamine, lecithin and other components, and through specific preparation steps, a crosslinked network structure is formed to effectively coat the high-efficiency lambda-cyhalothrin and improve the encapsulation rate. The microcapsule suspending agent has high encapsulation rate, good dispersibility, excellent stability and low skin irritation, and can significantly improve the use effect and safety of pesticides. Through experimental verification, the microcapsule suspending agent performs well in terms of photolysis resistance, wet sieve test, persistent foaming property, low-temperature stability and heat storage stability.

The invention relates to a lambda-cyhalothrin hapten, a lambda-cyhalothrin artificial antigen and a preparation method and application of the lambda-cyhalothrin hapten and the lambda-cyhalothrin artificial antigen, the structure of the lambda-cyhalothrin hapten is provided, and the lambda-cyhalothrin artificial antigen is prepared after the lambda-cyhalothrin hapten is coupled with carrier protein. The detection limit of a monoclonal antibody obtained after a mouse is immunized by an artificial antigen prepared from the hapten synthesized by the method is 2ng / mL, and the antibody prepared by the method is good in specificity, high in sensitivity and low in cross reaction with a structural analogue, so that the antigen and the prepared antibody can be used for establishing an immunological detection method and can be applied to the field of immunology detection. Therefore, the method can be used for rapidly detecting the lambda-cyhalothrin in food.

The invention relates to a microbacterium X10 with a broad-spectrum pesticide degradation function and application of the microbacterium X10, the microbacterium X10 is named as a microbacterium X10 strain, the preservation number of the microbacterium X10 strain is GDMCC No: 66970, and the preservation date of the microbacterium X10 strain is September 17, 2025. The strain has an efficient degradation effect on a plurality of typical pesticides such as dinotefuran, carbendazim, atrazine, pendimethalin and lambda-cyhalothrin, and also has a plurality of probiotic functions of secreting indole-3-acetic acid, dissolving inorganic phosphorus, generating siderophores, antagonizing phytopathogens and the like. The strain can effectively relieve stress of pesticides on plants and promote growth of the plants. The strain can be used for repairing pesticide-polluted soil and promoting plant growth, and has a wide application prospect in green agriculture development.

The application belongs to the technical field of pesticide insecticide, and discloses a pesticide composition containing brofenvalerate, which comprises active ingredient A, active ingredient B and active ingredient C; the active ingredient A is brofenvalerate; the active ingredient B is high-efficiency lambda-cyhalothrin; and the active ingredient C is any one of thiamethoxam or thiamethoxam. The pesticide composition can effectively prevent and control various underground pests and seedling stage pests, especially the underground pests and seedling stage pests of peanuts and corns, and can enhance the stress resistance of plants, reduce the amount of pesticide, prolong the effective period, and has no pesticide damage to crops.

The invention relates to the technical field of microorganisms, and discloses an animal lactic acid bacterium ZS-1 and application thereof.The animal lactic acid bacterium ZS-1 has the characteristics of low temperature resistance, pH tolerance, salt tolerance and the like, can generate an excellent pesticide degradation effect, and particularly has high degradation capacity on cyhalothrin, metolachlor and chlorfenapyr.

The invention discloses a photocatalytic material for degrading pesticide residues and a preparation method of the photocatalytic material, and particularly relates to the technical field of crossing of material science and environmental sciences, the photocatalytic material is particularly thin-layer graphite phase carbon nitride, and the photocatalytic material is prepared by a method of combining thermal polycondensation of melamine with secondary roasting stripping. And the photocatalyst can be used for efficient photocatalytic degradation of broad-spectrum pesticides such as lambda-cyhalothrin and carbendazim. The nonmetal photocatalytic material provided by the invention is simple in specific synthesis method and easy to prepare, the photocatalytic degradation process is easy to operate, secondary pollution is avoided, environmental friendliness is fully reflected, reliable technical support is provided for treatment of tobacco pesticide residues, water pollution and the like, and economic and social benefits are remarkable.

The invention relates to the technical field of pesticide residue detection, in particular to a preparation method of a cyhalothrin colloidal gold quantitative test strip, and solves the technical problems of non-uniform antibody labeling, coating layer cracking and low detection sensitivity in the traditional process. Taking 1 ml of 40-nanometer colloidal gold particles, adding potassium carbonate, mixing and reacting for 5-15 minutes, then adding 5-7 micrograms of cyhalothrin monoclonal antibody, reacting, and finally adding confining liquid to prepare a colloidal gold labeled antibody solution; spraying the obtained solution on a glass fiber pad according to the spraying amount of 9.0-10.8 microliters per centimeter to prepare a gold-labeled pad; a specific coating buffer solution is used for preparing a quality control line solution and a detection line solution of 0.7-0.9 mg / ml cyhalothrin-BSA antigen, a nitrocellulose membrane is coated with the quality control line solution and the detection line solution, and after confining liquid treatment, centrifugation and resuspension, the nitrocellulose membrane is dried for 70-74 hours in inert gas with the temperature of 45 DEG C and the temperature of 2 DEG C; the test strip prepared by the method is used for high-precision quantitative detection of cyhalothrin residues in agricultural products.

The invention discloses a storage method of pithecellobium clypearia seeds. The storage method comprises the following steps: selecting naturally mature and full perennial pithecellobium clypearia plant seeds; removing pods and impurities, cleaning with clear water, soaking with lambda-cyhalothrin diluted by 500 times to kill pests, soaking with 0.5% potassium permanganate solution to sterilize, and drying in the shade indoors to obtain clean seeds; and putting the seeds dried in the shade into a sealing bag, and storing at 4-6 DEG C. The method can effectively solve the problems that the pithecellobium clypearia seeds are not resistant to storage and prone to inactivation, the storage time of the seeds is prolonged, and reference is provided for pithecellobium clypearia seed storage and actual production and planting requirements.

This application provides a method for preparing and applying a cobalt-cyhalothrin-supported halloysite composite material. The preparation method includes: dispersing halloysite nanotubes purified by hydrochloric acid in ethanol, followed by sonication to obtain a first mixture; adding an ethanol solution containing Co(NO3)2·6H2O and HCl to the first mixture, followed by sonication until complete dispersion to obtain a second mixture; adding an ethanol solution containing cyhalothrin to the second mixture to obtain a third mixture; continuously stirring the third mixture under room temperature and sonication conditions for at least 30 min; then centrifuging to collect the solid product, washing, and vacuum drying to obtain the cobalt-cyhalothrin-supported halloysite composite material; wherein the mass ratio of the hydrochloric acid-purified halloysite nanotubes, Co(NO3)2·6H2O, HCl, and cyhalothrin is 1:1~2:0.0073~0.0219:1.5~2.5. Using the method of this application, the recovery rate of the target compound is consistently maintained at 82.6%~105.1%, completely overcoming the limitation of unsatisfactory recovery rates in existing technologies.

The invention relates to a sanitary insecticide, in particular to a retention spraying insecticidal composition and application thereof. The composition comprises a component A and a component B in a weight ratio of (5: 1)-(1: 5), the component A is 4-trifluoromethyl nicotinamide, and the component B is any one of meperfluthrin, cis-cypermethrin, beta-cypermethrin, beta-cyhalothrin, beta-cyhalothrin and bifenthrin. The composition disclosed by the invention is compounded and processed into wettable powder, water dispersible granules or a suspending agent according to a scientific ratio, does not use an organic solvent, is more environment-friendly, and has an excellent lethal effect on public health pests. The compound insecticide is applied in a retention spraying mode, has a remarkable synergistic effect on prevention and treatment of public health pests, can reduce the application amount of the insecticide, saves the cost, delays the generation of pest resistance to drugs, and is widely applied to hotels, schools, factories, families, farmers, farms and public places.

The invention relates to the technical field of environmental microbiological technology and agricultural bioremediation, and discloses a rhodococcus bacterium X-20 and application thereof. The Rhodococcus sp. X-20 can efficiently degrade various pesticides in liquid and soil environments, including carbendazim, dinotefuran, atrazine, pendimethalin and cyhalothrin, and especially shows specific efficient degradation ability to carbendazim. In addition, the strain has various plant probiotic functions: the strain can secrete indole-3-acetic acid (IAA), generate iron carriers, dissolve inorganic phosphorus and antagonize phytophthora nicotianae, and the growth of tobacco seedlings can be remarkably promoted. Field experiments show that the strain can relieve growth inhibition of compound pesticide pollution on tobacco, and the strain can be used for preparing microbial agents and applied to bioremediation of pesticide-polluted soil and green agriculture.

The invention relates to an insecticidal varnish composed of a colourless, water-based acrylic copolymer with a satin finish and very low odour, the aqueous formulation of which contains microcapsules of lambda-cyhalothrin (C23H19ClF3NO3 - alpha-cyano-3-phenoxybenzyl-3-(2-chloro-3,3,3-trifluoropropenyl)-2,2-dimethylcyclopropanecarboxylate) in concentrations ranging from 0.001% w / w to a permitted maximum of 10% w / w, which, when broken by mechanical contact, release the insecticide slowly, gradually and safely, making the surface lethal to insects, with mortality efficacy levels of 100% in 24 hours for the dengue mosquito (Aedes aegypt) and 82.5% in 72 hours for cockroaches (Periplaneta americana).

The invention discloses the technical field of biology, and particularly relates to a CYP4C16 gene and application of the CYP4C16 gene in regulation and control of resistance of periplaneta americana to cyhalothrin, and the nucleotide sequence of the CYP4C16 gene is shown as SEQ ID NO.1.

The invention belongs to the technical field of pesticides, and particularly relates to the technical field of pesticide compounding, in particular to a synergistic acaricidal composition. The synergistic acaricidal composition comprises an active compound (A), a compound shown in a formula Ia (formula Ia) and at least one active compound (B), and the active compound (B) is selected from the group consisting of chlorfenapyr, phoxim, dimethoate, pyridazinofos, carbosulfan, amitraz, lambda-cyhalothrin, lime sulfur, sulfur, chlorpyrifos, profenofos, lambda-cyhalothrin, triflumizone, Sulfiflumin, Spirobudifen, Mivorisaner, Modoplaner, Tigolaner, Umifoxolaner and Flupentifenox. The weight ratio of the active compound (A) to the active compound (B) is (1: 100)-(100: 1). The synergistic acaricidal composition can effectively improve the prevention and control effect on pest mites, has a remarkable synergistic effect compared with a single agent, and can effectively reduce the use amount, reduce the use cost and reduce the influence on the environment.